ID: 1019597977

View in Genome Browser
Species Human (GRCh38)
Location 7:1867171-1867193
Sequence GCCACAGACATGGGCACCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019597977 Original CRISPR GCCACAGACATGGGCACCGT AGG Intronic
900103818 1:973884-973906 GGCACAGACACAGGCACCGAGGG - Exonic
903500368 1:23797091-23797113 GCCAGAGGCATGGGCACCTGTGG + Exonic
904450270 1:30606427-30606449 GCCACAGAGATGGGCAGAGCTGG + Intergenic
905326794 1:37158653-37158675 GCAACAGACATGGGCCCAGCAGG - Intergenic
915300405 1:154948240-154948262 TCCACAGCCAGGGGCACCATGGG + Exonic
923147734 1:231209788-231209810 GCCACAGCTGTGGGCACCCTTGG - Intronic
923267405 1:232328013-232328035 GCCCCAGAGATGGGCTCTGTTGG - Intergenic
1066654250 10:37684175-37684197 GCCACAGCCATGGCCACTGAGGG + Intergenic
1067024272 10:42830000-42830022 ACCATAGAAATGGGCACAGTGGG + Intronic
1069825083 10:71250016-71250038 GGCACAGAGATGGGCACCTGTGG - Intronic
1070375393 10:75825794-75825816 GCCAGATACATAGGCACTGTTGG + Intronic
1074419317 10:113295063-113295085 GCCACAGACAAAGGCTCCTTTGG + Intergenic
1076043795 10:127274509-127274531 GCCAAAGACATGGCCATCGCTGG - Intronic
1077819923 11:5727223-5727245 GACACAGACATGGGAACCACAGG - Intronic
1080190255 11:29536754-29536776 GCCCCAGACATTGGCATAGTAGG + Intergenic
1084295685 11:68212661-68212683 GCCACGGCCAGGGGCGCCGTCGG + Intronic
1084317494 11:68353935-68353957 GCCACCCACATGGGTACCCTGGG - Intronic
1084982607 11:72838958-72838980 TCCAAGGACATGGGCACCCTAGG + Intronic
1087162624 11:94964353-94964375 GCAACAAACGTGGGCACCTTTGG + Intronic
1091219388 11:133921008-133921030 GCCACAGATGTGGGCACCAGTGG + Exonic
1094628115 12:32145316-32145338 GCCACAGACAGGTGCAGAGTAGG + Intronic
1096541231 12:52308416-52308438 GCCACAGACAACGCCACCGCGGG - Exonic
1100700695 12:97144757-97144779 GACACAGAGATGGGCAATGTAGG - Intergenic
1110833389 13:80057176-80057198 GCCACAGCCAAGGACACCATGGG + Intergenic
1113488776 13:110676253-110676275 CCCACAGCCAGGGGCACCTTGGG - Intronic
1121231354 14:92361111-92361133 TCCACAACCATGGGCACAGTTGG - Intronic
1122370569 14:101226939-101226961 CCCACAGACAGGGGCACCCAGGG + Intergenic
1122613989 14:103004259-103004281 GCCACAGAAATGGTGCCCGTGGG - Intronic
1122767630 14:104082788-104082810 CCCACTGACCTGGGCACTGTGGG + Intergenic
1122972498 14:105158119-105158141 GCCACAGACAGGGGCCCCATGGG + Intronic
1123425426 15:20167027-20167049 ACCACAGAAATAGGCACAGTGGG + Intergenic
1123534649 15:21173545-21173567 ACCACAGAAATAGGCACAGTGGG + Intergenic
1125329031 15:38564615-38564637 GCCGCGGCCATGGGCACCCTGGG - Exonic
1130673475 15:85932708-85932730 ACCAAATACCTGGGCACCGTGGG + Intergenic
1133303557 16:4797045-4797067 GCCACAGACAGAGCCACCCTAGG - Exonic
1133820424 16:9231434-9231456 GCCACAGAGATGGTCGCCCTGGG - Intergenic
1136250280 16:28999861-28999883 GCCACTCACATGGGCATAGTGGG + Intergenic
1138418940 16:56886827-56886849 GCAAAAGAAAAGGGCACCGTGGG + Intronic
1139259577 16:65578885-65578907 GCCACAGGCTTGGCCACAGTTGG - Intergenic
1140352301 16:74273685-74273707 GCCACATAGATGGGAACAGTGGG - Intergenic
1143535733 17:7538146-7538168 GCCACAGACAAGGGCAGAGGTGG + Intergenic
1144956269 17:19020352-19020374 GCCACAGACACGGGCCCAGAAGG - Exonic
1145127901 17:20316918-20316940 GCCACAGTCATTGGCAACTTGGG - Intronic
1145196647 17:20899904-20899926 GCCACAGTCATTGGCAACTTGGG + Intergenic
1151703336 17:75754518-75754540 GCCCCAGACCCGGGCCCCGTGGG - Intronic
1152285896 17:79413223-79413245 GGCACAGAAATGGGCACTGCAGG - Intronic
1154274597 18:12948110-12948132 GCCACAAACATGGTTTCCGTCGG - Exonic
1155320144 18:24611175-24611197 GCCACACACAGGCCCACCGTTGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1161421019 19:4175902-4175924 GACACAGTCGTGGGCACCATGGG - Exonic
1163288846 19:16365574-16365596 GCCACCGGCAGGGGCACCCTGGG + Intronic
1164839434 19:31381239-31381261 GCCACAGCCATGGGCACAGCAGG - Intergenic
925231611 2:2237855-2237877 GCCACAGACAGAGGCAACCTGGG + Intronic
927494470 2:23543320-23543342 GGCACAGACATGGGCAGCGCCGG + Intronic
929923225 2:46188505-46188527 GGCACAGACATGGGCTGCATGGG - Intergenic
932805691 2:74780814-74780836 GACACAGACATGGGCATGATGGG + Intergenic
935386291 2:102502848-102502870 GCCACAGACATGTGGCACGTGGG + Intronic
936111222 2:109666871-109666893 ACCATAGAAATGGGCACGGTTGG + Intergenic
936458097 2:112690936-112690958 ACCACAGACATAGGCACTGGTGG + Intergenic
938065522 2:128280132-128280154 GTCAGAGGCATGGGCACCGGGGG - Intronic
938289022 2:130139862-130139884 CCCACAGGCATGGGGACAGTGGG - Intronic
938378286 2:130822867-130822889 GCCACAGCCATGGGTGCCCTCGG + Intergenic
938467507 2:131533076-131533098 CCCACAGGCATGGGGACAGTGGG + Intronic
940316841 2:152335595-152335617 GCCGCCGACATGGGCAACGCAGG + Exonic
945713146 2:213325862-213325884 GGCACAGAGATAGGCCCCGTGGG - Intronic
947102837 2:226639796-226639818 GCCACAGACATGGATACCCATGG + Intergenic
947254971 2:228152896-228152918 GCCACAGACATGGGAATTATGGG - Intronic
948838554 2:240637824-240637846 GGCACAGACAGGGGCAGGGTGGG - Intergenic
1169199098 20:3699065-3699087 GTCACAGACCTGGCCACAGTGGG - Intronic
1169490549 20:6067845-6067867 GAAACATACATGGGCACAGTTGG - Intergenic
1172220651 20:33272558-33272580 GCCACCAAGATGGGCACCCTGGG - Intergenic
1173592384 20:44234935-44234957 GCCACAGATATGGGTAGGGTCGG - Intergenic
1174036364 20:47670935-47670957 GCCAGAGAAATGGGCTACGTGGG + Intronic
1175689008 20:61052381-61052403 GCCAGAGACATCGTCACCGATGG - Intergenic
1175885260 20:62286698-62286720 GACACAGACCTGGGCAGAGTTGG - Exonic
1176050732 20:63118170-63118192 GTCAGAGACGTGGGCACCTTTGG - Intergenic
1176119724 20:63448815-63448837 GCCACAGGCATGGGCATCCTGGG + Intronic
1178905320 21:36631671-36631693 GCCACAGATAAGGGCAGCTTAGG + Intergenic
1180207037 21:46267212-46267234 ACCACAGCCATGGCCAGCGTGGG + Intronic
1180871564 22:19149862-19149884 CCCAGAGACAAGGGCACCGCCGG + Exonic
1183629059 22:39022251-39022273 GCCACAGAGCTGGGGACAGTTGG - Intronic
1183865817 22:40703352-40703374 GACACAGACAAGGACACAGTGGG - Intergenic
1185158287 22:49207349-49207371 GCCACAGCCATGAGAGCCGTGGG + Intergenic
1185249819 22:49795264-49795286 GCCACAGACCTGGAGGCCGTGGG - Intronic
952933297 3:38376202-38376224 TCCACAGAGATGGGCAACGGTGG + Exonic
953021197 3:39114461-39114483 ACCTGACACATGGGCACCGTGGG - Intronic
953548851 3:43884906-43884928 GGCACAGCCAGGGGCACAGTCGG - Intergenic
954406071 3:50345654-50345676 GTCCCAGACTTTGGCACCGTCGG - Exonic
961035370 3:123638089-123638111 GCCACAGACATGTGGAGCATCGG - Exonic
967087900 3:186110438-186110460 GCCCCAGAGTTGGCCACCGTGGG - Intronic
968490336 4:886752-886774 GCCACAGCCCTGGGCCCAGTGGG + Intronic
968687875 4:1973649-1973671 GTCCCAGACAGGGGCACCCTGGG + Intronic
975719942 4:77239692-77239714 GCCACAAACCTGGGCTCTGTAGG - Intronic
980881896 4:138718974-138718996 TCCACAGACATGGGATCTGTCGG - Intergenic
984391248 4:179136973-179136995 GCCTCAGGCATGGACCCCGTAGG + Intergenic
985030939 4:185788766-185788788 GCCACAGTGATGGGCACCGTTGG - Intronic
985543931 5:499941-499963 CCCACAGCCCTGGGCCCCGTCGG + Intronic
988514941 5:31896052-31896074 GACACAGACTTGGGAACAGTAGG + Intronic
997388874 5:133497127-133497149 GCTTCAGAGCTGGGCACCGTGGG - Intronic
997637917 5:135428280-135428302 GCCCCAGCCATGGGCAGCCTGGG - Intergenic
998031571 5:138874367-138874389 GCCACAGACAAGGGCTCTCTGGG - Exonic
1002769814 6:281305-281327 GCGAGAGAGATGGGCACCTTTGG - Intergenic
1007411365 6:41663879-41663901 GACACAAACATGTGCACCGCAGG - Intergenic
1007607928 6:43129808-43129830 GCCACATTGATGGGCACCCTCGG + Exonic
1018720698 6:166569660-166569682 ACCACAGACAAGGTCACCTTGGG + Intronic
1018891568 6:167986531-167986553 GCCACAGACCTGGGCAGCGCGGG + Intergenic
1019596008 7:1858743-1858765 GCCACAGACTAGGCCACCATGGG + Intronic
1019597977 7:1867171-1867193 GCCACAGACATGGGCACCGTAGG + Intronic
1019670348 7:2274692-2274714 GCCTGAGCCATGGGCACCATGGG - Intronic
1020795098 7:12669168-12669190 GCCAGGGACAATGGCACCGTGGG + Intergenic
1023057122 7:36299459-36299481 GCCACAGACCTGAGCAGCATTGG + Exonic
1024253546 7:47523542-47523564 ACAGCAGCCATGGGCACCGTTGG - Intronic
1029458350 7:100682220-100682242 GCTACAGCCATGGGCACTGCAGG + Exonic
1036643248 8:10597128-10597150 TCCAGAGACATAGGCACCCTGGG + Intergenic
1048508410 8:135041382-135041404 GCCAGAGACATGGGCTGAGTGGG - Intergenic
1050566461 9:6889437-6889459 GCCTCCGAGATGTGCACCGTGGG + Intronic
1053122745 9:35558725-35558747 GACAGAGTCATGGGCACAGTGGG - Intronic
1054983905 9:71238990-71239012 GACACAGTCATGTGCACCTTTGG - Intronic
1057288231 9:93778012-93778034 CACACAGACATGAGCACCGATGG - Intergenic
1057739535 9:97699457-97699479 GCCACATCCATGGGCTCCGGAGG + Intergenic
1060821479 9:126664033-126664055 GACTCAGACTTGGGCTCCGTGGG - Intronic
1060870125 9:127033304-127033326 GCCACAGACAGGGGCTTGGTGGG - Intronic
1061424692 9:130491608-130491630 GGCACAGACAGGGGAACCCTGGG + Intronic
1187102089 X:16203920-16203942 GCCACAAACATGGGCCCCTCAGG - Intergenic
1192146535 X:68686486-68686508 GCCACGGACGTGGACTCCGTGGG + Intronic
1200985921 Y:9303588-9303610 GCCACAGACATGGGCAGCCAGGG - Intergenic
1202124658 Y:21557307-21557329 GCCACAGACATGGGCAGCCAGGG + Intergenic
1202154350 Y:21872073-21872095 GCCACAGACATGGGCAGCCAGGG - Intergenic
1202195318 Y:22294767-22294789 GACACAGACATGGGCAGCCAGGG - Intergenic