ID: 1019599474

View in Genome Browser
Species Human (GRCh38)
Location 7:1874079-1874101
Sequence GGCCACCGGGGATCCCGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019599464_1019599474 5 Left 1019599464 7:1874051-1874073 CCCCATGCTAGGGTCGGTGCTTC 0: 1
1: 0
2: 1
3: 3
4: 56
Right 1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG No data
1019599460_1019599474 17 Left 1019599460 7:1874039-1874061 CCTCTCTGAGCACCCCATGCTAG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG No data
1019599465_1019599474 4 Left 1019599465 7:1874052-1874074 CCCATGCTAGGGTCGGTGCTTCT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG No data
1019599466_1019599474 3 Left 1019599466 7:1874053-1874075 CCATGCTAGGGTCGGTGCTTCTG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019599474 Original CRISPR GGCCACCGGGGATCCCGGGA CGG Intronic
No off target data available for this crispr