ID: 1019603275

View in Genome Browser
Species Human (GRCh38)
Location 7:1895870-1895892
Sequence TGTCCCTTCTTTCCAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 221}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019603275_1019603292 28 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603292 7:1895921-1895943 GGCGGCCTGGGGAGGCGCCAAGG No data
1019603275_1019603287 10 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603287 7:1895903-1895925 GAGGATGGGCAGTGAGGGGGCGG 0: 1
1: 0
2: 11
3: 134
4: 1317
1019603275_1019603281 -5 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603281 7:1895888-1895910 GGACAGCAAGGGCTGGAGGATGG No data
1019603275_1019603280 -9 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603280 7:1895884-1895906 GAAGGGACAGCAAGGGCTGGAGG 0: 1
1: 0
2: 6
3: 66
4: 646
1019603275_1019603288 15 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603288 7:1895908-1895930 TGGGCAGTGAGGGGGCGGCCTGG 0: 1
1: 0
2: 5
3: 62
4: 639
1019603275_1019603289 16 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603289 7:1895909-1895931 GGGCAGTGAGGGGGCGGCCTGGG No data
1019603275_1019603290 17 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603290 7:1895910-1895932 GGCAGTGAGGGGGCGGCCTGGGG No data
1019603275_1019603284 5 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603284 7:1895898-1895920 GGCTGGAGGATGGGCAGTGAGGG 0: 1
1: 0
2: 7
3: 104
4: 712
1019603275_1019603286 7 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603286 7:1895900-1895922 CTGGAGGATGGGCAGTGAGGGGG No data
1019603275_1019603291 20 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603291 7:1895913-1895935 AGTGAGGGGGCGGCCTGGGGAGG No data
1019603275_1019603283 4 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603283 7:1895897-1895919 GGGCTGGAGGATGGGCAGTGAGG 0: 1
1: 0
2: 14
3: 124
4: 1159
1019603275_1019603282 -4 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603282 7:1895889-1895911 GACAGCAAGGGCTGGAGGATGGG 0: 1
1: 0
2: 2
3: 45
4: 407
1019603275_1019603285 6 Left 1019603275 7:1895870-1895892 CCTGCCACTGGAAAGAAGGGACA 0: 1
1: 1
2: 1
3: 21
4: 221
Right 1019603285 7:1895899-1895921 GCTGGAGGATGGGCAGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019603275 Original CRISPR TGTCCCTTCTTTCCAGTGGC AGG (reversed) Intronic
900494522 1:2970492-2970514 GGCCCCTTCTCTGCAGTGGCTGG + Intergenic
901157696 1:7151469-7151491 TGTCCCTGCCTTCCACTGCCTGG + Intronic
901681226 1:10914021-10914043 TGGTCCTCCTTTCCAGTGGAGGG - Intergenic
902103742 1:14015796-14015818 TTTCCCATCTTTCCACTGGAGGG + Intergenic
902755381 1:18545947-18545969 TGTCCCTCCTTTCCAGTTGAGGG + Intergenic
904607043 1:31703824-31703846 TATCCCTACTTACCGGTGGCCGG + Exonic
905900521 1:41579144-41579166 TATCCCTCCTTACCAGTGGATGG - Intronic
906274893 1:44508154-44508176 TGACCTTTCTTTCCCGAGGCAGG + Intronic
908349996 1:63277123-63277145 GGTCCCCTCTGTCCAGTGACAGG - Intergenic
917267935 1:173241767-173241789 TGACCCTTGTTTCCTGTGGGAGG + Intergenic
917642885 1:176999845-176999867 TGGCACCTCTTTACAGTGGCAGG - Intronic
918865806 1:189897978-189898000 TGTTTTTTCTTTCCAGTGACAGG + Intergenic
919523700 1:198621213-198621235 TGGGACTCCTTTCCAGTGGCTGG - Intergenic
920042469 1:203110913-203110935 TCTCCCTTCTATTCAGTGTCAGG + Intronic
923327607 1:232894719-232894741 AGTCCCTTCATTCCTGTTGCTGG - Intergenic
923329146 1:232906610-232906632 TGTCCCTTCCTCACAGTGTCAGG + Intergenic
924280461 1:242432020-242432042 TGTGCCCCCTTTCCTGTGGCTGG - Intronic
1062905561 10:1177223-1177245 TGTCCCTTCTTTGGGGTGGGTGG + Intergenic
1063223094 10:3989370-3989392 TGTTCACTCTTTCCAGGGGCCGG - Intergenic
1064471223 10:15637990-15638012 TTTACCTTCTATGCAGTGGCTGG + Intronic
1064599000 10:16974384-16974406 TGTCTCTTCTGCCCACTGGCTGG + Intronic
1066450201 10:35521733-35521755 TGCCCCTGCTTTCCAGGGGCCGG + Intronic
1068718739 10:60218394-60218416 TGTCATGTCTTTGCAGTGGCTGG + Intronic
1069826397 10:71257508-71257530 TATGCCTTCTTGCCAGGGGCTGG - Intronic
1069876250 10:71565045-71565067 TGGCCCTCCTTTCTTGTGGCAGG + Intronic
1070287643 10:75095306-75095328 TATACCTTCTGTCCAGTGCCTGG + Intronic
1073257256 10:102160868-102160890 TTTCCTTTCTTTGCAGAGGCTGG - Exonic
1073834944 10:107430546-107430568 TGTCCCTACTGTCCAGAGGAGGG + Intergenic
1074151372 10:110762674-110762696 TCATCCTTCTTTCCTGTGGCTGG + Intronic
1075521785 10:123147828-123147850 GGACCCTTCTCTCCAGAGGCAGG - Intergenic
1076049330 10:127320306-127320328 TTTCAAGTCTTTCCAGTGGCTGG + Intronic
1077754452 11:5011151-5011173 TTACCCTTCTGTCCAGTGGCTGG + Intergenic
1078412880 11:11142118-11142140 TGCCTCTTCTTTCCCGGGGCTGG - Intergenic
1079773228 11:24490584-24490606 TGTCCTTTTTGTCCAGAGGCAGG - Intergenic
1081779230 11:45698600-45698622 AGACCCTGCTTCCCAGTGGCAGG - Intergenic
1083838809 11:65291112-65291134 TGTCCCTTTTCCCCAGTGCCAGG + Intronic
1083853225 11:65379664-65379686 TGTCCCCACTTCCCTGTGGCAGG - Intronic
1084898741 11:72294266-72294288 TGTTCCAGATTTCCAGTGGCTGG + Intronic
1085967260 11:81542409-81542431 TTTTCCTTCATTCCAGTGCCTGG - Intergenic
1085999873 11:81970174-81970196 TGTCTCTGCTATCCAGTGGGTGG - Intergenic
1086044110 11:82512507-82512529 TGAGTCTTCTTCCCAGTGGCTGG - Intergenic
1088327894 11:108619741-108619763 TCTCCCCTCTTGCCAGTGGTTGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1089911238 11:122102621-122102643 TTCCCTTTCCTTCCAGTGGCTGG + Intergenic
1090363207 11:126187266-126187288 TGTCCCTTCTCTCCTCTGGGTGG - Intergenic
1092126537 12:6078733-6078755 GGTCTCTTCTTTCCCTTGGCTGG - Intronic
1092442279 12:8516824-8516846 TGTGCCTTGTTTCCAGTGTTTGG - Intronic
1093998108 12:25664555-25664577 TGGCCCGTTTTTGCAGTGGCTGG + Intergenic
1095434321 12:42170729-42170751 TGTCCCTTACTCCCAGTAGCTGG - Intronic
1095654002 12:44648171-44648193 TGAACCTTCTTTCTAGTGGGAGG - Intronic
1096463569 12:51836236-51836258 TGTCCCTCCTCTCCTGAGGCAGG - Intergenic
1099809123 12:87558199-87558221 TGTTGCATTTTTCCAGTGGCTGG - Intergenic
1100164684 12:91902952-91902974 TGTCCATTCTTTCCAGAAGATGG - Intergenic
1100758441 12:97778019-97778041 TTTCCTTTCTTTCCACTGCCTGG + Intergenic
1101598699 12:106189715-106189737 TCTCTCTTCATTCCAGTTGCAGG - Intergenic
1101770358 12:107744325-107744347 TGTCCTCTATTTCCAGTAGCTGG + Intronic
1103308540 12:119986939-119986961 TGTGCCTTGTCTCCATTGGCTGG + Intergenic
1103904793 12:124321716-124321738 TGTCCCTGCTTACCAGTAGCTGG + Intergenic
1104004976 12:124885399-124885421 TCTCCCTTCCTTCCTGTGCCTGG - Intergenic
1104185868 12:126430589-126430611 AGTACCTTCTTTTTAGTGGCTGG - Intergenic
1106625987 13:31421515-31421537 TGACCTTTGTTTCCAGTGGAGGG + Intergenic
1106810091 13:33350484-33350506 CGTCCGTCCTTTCCAGTCGCCGG - Intronic
1109197844 13:59398344-59398366 TCTGCCTTTTTTCCAGAGGCTGG - Intergenic
1112234649 13:97624510-97624532 TGTCCCTTGGTTCCAGGGGGAGG - Intergenic
1112356210 13:98676599-98676621 TGTCCCTGCTTTGCAGTGGCTGG - Intergenic
1112672702 13:101659574-101659596 TGGCCATTCTTTCCTGTAGCTGG + Intronic
1113667964 13:112154049-112154071 TGGCCCTGCTTCCCAGAGGCTGG + Intergenic
1113940536 13:114016407-114016429 TGCCCCTCCGTGCCAGTGGCCGG - Intronic
1115812965 14:37130985-37131007 TCTCCCTCCTTCCCAGTGGTGGG - Intronic
1117424734 14:55581319-55581341 TGGCCCTTCTTTCCTGTGGGAGG + Intronic
1117861223 14:60094566-60094588 TGGCCCTTTGTTCCAGTTGCAGG - Intronic
1119371081 14:74143940-74143962 TCTCCCCTCTTTCCAGTTTCTGG + Intronic
1119517379 14:75258900-75258922 TGTCCTGGCTTTCCAGGGGCTGG + Intronic
1120095782 14:80386205-80386227 TGACACCTCTTTTCAGTGGCAGG - Intronic
1120108103 14:80519460-80519482 TGTTCCTTCTCTCCAGGGGAAGG - Intronic
1121741284 14:96254072-96254094 TGTCCTCTATTTCCAGAGGCAGG + Intronic
1122057902 14:99117596-99117618 TGCCCCTTCTTGCCTGTGCCTGG + Intergenic
1122634376 14:103123306-103123328 TGTCCCTGCGTCCCAGGGGCTGG - Intergenic
1124072015 15:26404117-26404139 TGGCCCCTCTTTCCAGCTGCTGG + Intergenic
1124404060 15:29378541-29378563 TTTCTCTTCTTTCCACTGACTGG - Intronic
1125063125 15:35448275-35448297 TATCCATTCTTTCCAGTAACTGG - Intronic
1126717843 15:51539971-51539993 TGTTCTTTCTTTCCAGTTCCTGG + Intronic
1126928205 15:53615316-53615338 CCTTCCTTCTTTCCAGTGGGGGG - Intronic
1129892652 15:79081756-79081778 TGTCCCATCCTCCCAGTGCCAGG + Intronic
1133129119 16:3665274-3665296 TGTCCCTTCTCCCCAGCAGCAGG - Exonic
1134570321 16:15285048-15285070 GGTGCCTTCTTGCCAGAGGCAGG + Intergenic
1134732056 16:16471005-16471027 GGTGCCTTCTTGCCAGAGGCAGG - Intergenic
1134804978 16:17116560-17116582 TGTTTCTCCTTTCCAGTGTCAGG + Intronic
1134935385 16:18240958-18240980 GGTGCCTTCTTGCCAGAGGCAGG + Intergenic
1136026745 16:27473627-27473649 TGCACCTTCCTTCCAGTGGAGGG + Intronic
1136638859 16:31544825-31544847 TGTGCCTGGTTTCCACTGGCTGG - Intergenic
1140670875 16:77277780-77277802 TATCCCTTCTTTCATGTGGCTGG - Intronic
1141149262 16:81552840-81552862 TGTTCCTTCATTGCTGTGGCTGG + Intronic
1144018460 17:11219783-11219805 TGTCCCTTCTTCTCCGTGCCTGG + Intergenic
1144318900 17:14094051-14094073 TCTCCCTTTTTTTCAGAGGCAGG - Intronic
1145782476 17:27572061-27572083 TCTCCATTCTCTCCAGTGGAGGG - Intronic
1148062442 17:44846186-44846208 TTTCCTTACTTTCCAGTGCCTGG + Intergenic
1153189478 18:2521871-2521893 TGTCTCTTCTCTCCAATGGCTGG - Intergenic
1153741678 18:8136586-8136608 TGTCCCTAATTTCCAGTGTAGGG - Intronic
1153960188 18:10133761-10133783 TGGTCTTTCTCTCCAGTGGCTGG - Intergenic
1155436030 18:25813969-25813991 TGTTCCTTTTTTTCAGTGCCAGG + Intergenic
1158597267 18:58827408-58827430 TGTTCATTCCTTCCAGTGGGTGG + Intergenic
1159946381 18:74447277-74447299 GTTCCCTTCCTTCCAGTGCCAGG - Exonic
1160071321 18:75630927-75630949 TGTCCCTTCTTTACCTTTGCAGG + Intergenic
1160238913 18:77108543-77108565 TGTCCAGTCATCCCAGTGGCTGG - Intronic
1161713241 19:5861780-5861802 TGTCCCTTCTTTCCCCTGCTGGG + Intergenic
1166563904 19:43751697-43751719 TGCCCCTTCCTCCCAGTGACAGG + Intronic
1166681085 19:44767504-44767526 TGTTTCTTCTTCCCAGTGGTTGG - Intergenic
926096097 2:10081056-10081078 TTTTGCTTCTTTCCTGTGGCGGG - Intergenic
927040872 2:19229043-19229065 TGTCCCTTGTCTCCACTGGGTGG - Intergenic
928180974 2:29068249-29068271 TTTCATTTCTTTCAAGTGGCTGG + Intronic
929189648 2:39127237-39127259 TTTCCCTTTTTTACAGTTGCTGG - Intergenic
929907413 2:46058321-46058343 TGTCCCAGCTTTCCAGAGGCTGG - Intronic
932319360 2:70809765-70809787 TGTCCCATCTGTCCAGCGCCAGG + Exonic
932507981 2:72255176-72255198 GGACCCTTCTGTCTAGTGGCAGG + Intronic
932576216 2:72963732-72963754 TGGCCCTTCATTCCAGTGCCAGG + Intronic
933145791 2:78851164-78851186 TGTGCTTTCTCTCCTGTGGCTGG - Intergenic
933521933 2:83384760-83384782 TGTCACTTCTTTTCAGTAGCAGG + Intergenic
934522947 2:95031321-95031343 TGTCCCTTCATTCCTGTTGGGGG - Intronic
934578750 2:95421111-95421133 TGCTGCTTCTTTCCACTGGCTGG - Intergenic
934600697 2:95655592-95655614 TGCTGCTTCTTTCCACTGGCTGG + Intergenic
935897118 2:107749454-107749476 TATCCCTTATTTCCAGTAGTGGG + Intergenic
936025034 2:109025014-109025036 TGTCCCCTCTTCCCAGCTGCTGG + Intergenic
936341704 2:111639577-111639599 TCTCCCTTCCTTCCACAGGCTGG + Intergenic
937369702 2:121288703-121288725 TGTCTCTTCTTCTCAGTGTCGGG - Intergenic
937865900 2:126751711-126751733 TGTCTATTCTTTCCAGGTGCTGG + Intergenic
938065554 2:128280270-128280292 TGCCTCCTCTTTCCTGTGGCAGG + Intronic
940181236 2:150935558-150935580 TGTCCCTTTTTCCAAGTGTCTGG + Intergenic
940634230 2:156277830-156277852 TCTCCCTTCTTTCCAGTGGCAGG - Intergenic
942452518 2:176117214-176117236 GGTCCCTTCGTACCAGAGGCTGG + Exonic
945065486 2:205944532-205944554 TTTCTCTTCTTTCCCATGGCTGG - Intergenic
947034597 2:225837860-225837882 ACTCCCTTCTTTCCAGTGTCTGG - Intergenic
947829044 2:233125890-233125912 TGTCCATGCTTTGCAGTCGCTGG - Exonic
948900715 2:240955693-240955715 TGCCCCTCCTCCCCAGTGGCAGG + Intronic
1169017975 20:2307218-2307240 AGTCCCCTCTCTCCAGTGGCAGG + Intronic
1169139883 20:3221819-3221841 TGTCCCCCCTTTCCTGTGGCAGG + Exonic
1172489702 20:35325975-35325997 TGTTCTTTCTTTCATGTGGCTGG - Intronic
1175147335 20:56906892-56906914 TTTCCCTTCATTCCTCTGGCTGG - Intergenic
1177253727 21:18631987-18632009 AGTCCCTGCTCTACAGTGGCTGG + Intergenic
1177407669 21:20691477-20691499 TCTCACCTCTTTCCAGTGGAAGG - Intergenic
1179014625 21:37585259-37585281 TTTCCCTTCTTACCAGTGTAAGG + Intergenic
1179083479 21:38195426-38195448 TGTCCCTTCTTTGCTGTGTTGGG + Intronic
1181407031 22:22692364-22692386 TGTCCCTGCTTACCTGGGGCTGG - Intergenic
1182647390 22:31821412-31821434 TCTCCCTTCTTTCCAGCTACTGG - Intronic
1183210276 22:36447037-36447059 TGTCCCCTCTTCTCAGAGGCAGG + Intergenic
1183474961 22:38031045-38031067 AGACCCGTCTTTCCATTGGCAGG - Intronic
1184354294 22:43968573-43968595 TTTCCCTTCTGTCATGTGGCTGG + Intronic
1184790163 22:46695275-46695297 TGTCCCTTCATAGCAGTGGTGGG + Exonic
949205474 3:1433149-1433171 GTTCCCATCTTTCCTGTGGCTGG + Intergenic
949410161 3:3754865-3754887 TCTCCCTAGTTTCCAGTGGTTGG - Intronic
949916922 3:8972245-8972267 TGTTCTTTCTTTCAAGAGGCAGG + Intergenic
949995203 3:9611175-9611197 TGTCCTTTCTTTACACTGGGAGG - Intergenic
950467503 3:13163816-13163838 TGTCCCTTCCTTTCTGGGGCTGG - Intergenic
950758298 3:15196580-15196602 TGTCCCTTCTTTTAAGCGGTAGG - Intergenic
951147927 3:19251638-19251660 AGTACCTTCTTTCCCATGGCAGG + Intronic
952850580 3:37725172-37725194 TGTGGCTTCATTCCAGTGGGAGG + Intronic
955464721 3:59224946-59224968 TGGCCTTTTTTTTCAGTGGCTGG + Intergenic
956237800 3:67094294-67094316 TCTCCGTTCTTTCCGGTGGCAGG - Intergenic
957289414 3:78258935-78258957 AGTCCCTTCTTCCCTGTGGGAGG + Intergenic
960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG + Intronic
960934724 3:122891262-122891284 TTTCCCTTCTTTCCAGTCCCAGG + Intergenic
961058405 3:123808199-123808221 TGTCCATTCTCACCAGGGGCAGG + Intronic
962278738 3:134034588-134034610 TGTCTCTTCTCACCACTGGCTGG + Intronic
963502337 3:146143591-146143613 AATCCCTTCTTTCTACTGGCCGG + Intronic
963580635 3:147122689-147122711 TGTCCCTTGGTTCCTGTGGGAGG - Intergenic
969078387 4:4598941-4598963 TGTCCCTTTTTGTCAGTGGGAGG + Intergenic
969227771 4:5810370-5810392 GGTCCCCTCTTTCCTGGGGCAGG - Exonic
969505938 4:7587765-7587787 TGCCCCCTCTTTCCAGCTGCAGG + Intronic
972346693 4:38198301-38198323 TGGCCCTTCTTCCCAGTGAGGGG + Intergenic
972459367 4:39286490-39286512 TGTCCTTCCCTCCCAGTGGCCGG + Intergenic
975138305 4:70895672-70895694 TGTCCTTGGATTCCAGTGGCAGG + Intergenic
978336441 4:107674076-107674098 TGTCACATTTTTGCAGTGGCTGG - Intronic
979178311 4:117692458-117692480 TGTCCAGGCTTTCCAATGGCAGG - Intergenic
980740754 4:136947017-136947039 AGTAGCTTCTTTCCAGAGGCAGG - Intergenic
981068979 4:140515010-140515032 TGTGTCTTCTTTCTATTGGCAGG + Intergenic
982373050 4:154655466-154655488 TGTCTCTTGTTTCTAGTGCCAGG + Intronic
985403043 4:189611100-189611122 TCTCCCTTCTTTTATGTGGCAGG - Intergenic
989117493 5:37969462-37969484 TGTCCTTTTATCCCAGTGGCTGG + Intergenic
989379286 5:40797951-40797973 CGTCCCTTCTTTCCAGGGCTGGG - Intronic
990800092 5:59591671-59591693 TCTCCATTCTTTCAAGAGGCTGG + Intronic
992125763 5:73638959-73638981 TTTCCCTTCTTTAGAGTAGCTGG + Intronic
995490671 5:112688430-112688452 TTTCCTTTCATTCAAGTGGCAGG - Intergenic
995578063 5:113562553-113562575 TGTTCCTTCCTTCCTGTGACTGG - Intronic
1000399923 5:160815014-160815036 TGTCATGTCTTTGCAGTGGCTGG - Intronic
1000868166 5:166540601-166540623 TGTCTATTCTTTTCAGTGGAGGG - Intergenic
1002199742 5:177521030-177521052 TTTCTCCTCTTTCCAGTGCCAGG - Intronic
1002604002 5:180371308-180371330 TCTCCCATCTGTCCAGTGGGTGG - Intergenic
1002940755 6:1713473-1713495 TGTCTCTTCTTTCAGCTGGCGGG - Intronic
1003417543 6:5925887-5925909 TGGTCCTTCTTTCCAGTTACAGG - Intergenic
1003989007 6:11467181-11467203 TATCCCTTCTTTGGAGTGACTGG + Intergenic
1006012522 6:31054564-31054586 GGTCCCTGCTTCCCTGTGGCAGG - Intergenic
1006168631 6:32080575-32080597 TTTCCCTTCTGTCAGGTGGCTGG - Intronic
1007378046 6:41469663-41469685 TGACCTTTCTTTCCAGGAGCTGG + Intergenic
1008388294 6:50919946-50919968 TGTCCCTTTTTTGCAGTTGCTGG + Intergenic
1009056035 6:58336323-58336345 TATACCTTCTGTTCAGTGGCAGG - Intergenic
1009235144 6:61114275-61114297 TATACCTTCTGTTCAGTGGCAGG + Intergenic
1013720401 6:113019307-113019329 TTTCCCTTCTCTCCTGTGGAAGG - Intergenic
1014242707 6:119035317-119035339 TGTCCCTGAATTCCAGTGGGAGG - Intronic
1016619452 6:146091201-146091223 AGTTCCTTCTTCCCATTGGCAGG + Intronic
1016866944 6:148776952-148776974 TGTCCCTGCTCTCAAGTGGCTGG + Intronic
1019162741 6:170080139-170080161 TGGCCTTTCTTCCCAGTGTCAGG - Intergenic
1019603275 7:1895870-1895892 TGTCCCTTCTTTCCAGTGGCAGG - Intronic
1020177510 7:5894899-5894921 TCTCCCTTCTTACCATAGGCTGG + Intergenic
1020346166 7:7166038-7166060 TGTCCCTTATCTCAAGTGCCTGG - Intronic
1021797987 7:24277093-24277115 TGTCATGTCTTTGCAGTGGCTGG + Intergenic
1022101689 7:27173056-27173078 TGTGCGCTCTTTCCTGTGGCCGG - Intronic
1024213895 7:47230032-47230054 TTTCCCTTCTTCCTATTGGCTGG - Intergenic
1026469456 7:70682539-70682561 TGTCACTTCCTCCCAGAGGCAGG + Intronic
1028535131 7:91883333-91883355 TGGACCTTATTTCTAGTGGCAGG + Intergenic
1028602018 7:92611958-92611980 TGTCCCTCCTTTGAAGTGGATGG - Exonic
1029081328 7:97976102-97976124 TCTCCCTTCTTACCATAGGCTGG - Intergenic
1029419202 7:100463744-100463766 TGTGCCTTCTTTTCTGTGGATGG - Intronic
1030552412 7:110979738-110979760 TGTCCCATTTTTCAAGTGGTTGG - Intronic
1032705112 7:134414700-134414722 TATCCCTTCTCTCCAGGAGCAGG + Intergenic
1033284315 7:140027217-140027239 TGTCCCTTCACACCACTGGCTGG - Intronic
1033921561 7:146399327-146399349 TGTCCCTTCCCTCCAGTCTCTGG + Intronic
1036025977 8:4909565-4909587 TATCCCTTCTTACCTCTGGCAGG - Intronic
1036943029 8:13069469-13069491 TGTCCCCTGTTTCCATGGGCCGG + Intergenic
1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG + Intergenic
1041789860 8:61682868-61682890 TGTGCATTTTTTCCAGTGACAGG + Intronic
1041939135 8:63367531-63367553 TGTGTCTTGTTTCCATTGGCTGG + Intergenic
1042934912 8:74048560-74048582 TCTTCCTTCCTTCCACTGGCTGG - Intergenic
1044073948 8:87795162-87795184 TGGCCTGTTTTTCCAGTGGCTGG - Intergenic
1045018693 8:98022626-98022648 TGTCCTTTCTTTCCAGGGTAGGG - Intronic
1045426973 8:102077116-102077138 TGTCTCTCCTTTGCAGAGGCTGG + Intronic
1045498687 8:102728940-102728962 AGTCCATTCTTTCCCGTGTCAGG - Intergenic
1047484064 8:125312762-125312784 TGAGCCTTTTGTCCAGTGGCAGG + Intronic
1048633492 8:136270357-136270379 TGTCCCATGTTTCCATGGGCTGG - Intergenic
1048956685 8:139543360-139543382 TGTCTCTCCCTGCCAGTGGCTGG - Intergenic
1052052495 9:23864718-23864740 TGTCACGTTTTTGCAGTGGCTGG + Intergenic
1055923570 9:81487942-81487964 TGTCCCTTCTTTCTAATGGTTGG - Intergenic
1056726095 9:89119247-89119269 TATCCCTTCTTTTTATTGGCTGG - Intronic
1057880974 9:98792367-98792389 TGTCTCTCCTATTCAGTGGCAGG + Intronic
1058923762 9:109641655-109641677 TGACCCTTCCTTGGAGTGGCTGG - Intronic
1060825877 9:126687821-126687843 TGGGCCTTCTTCTCAGTGGCTGG + Intronic
1061000615 9:127900073-127900095 TCTCCCTATTTTCCAGAGGCAGG - Intronic
1186058595 X:5679159-5679181 TGTCATTTCTTTGCAGTGGCAGG - Intergenic
1186649555 X:11543673-11543695 TGTCACTTGTTGCCACTGGCAGG - Intronic
1190596080 X:52053563-52053585 GATCCCCTCTTTCCAGGGGCAGG + Intronic
1190612744 X:52200510-52200532 GATCCCCTCTTTCCAGGGGCAGG - Intronic
1193659750 X:84243142-84243164 TGTCCCTACTTTCCAGGGCCTGG - Intergenic
1195059099 X:101177004-101177026 GGTCCCTTGATTCCAGTGGCGGG + Intergenic
1199344357 X:146721093-146721115 TGGCCTGTTTTTCCAGTGGCTGG - Intergenic
1199518995 X:148713647-148713669 TATCTCTTCTATCCATTGGCAGG + Intronic
1199796193 X:151200065-151200087 TGTCCCGTTTTTCCAGGTGCAGG - Intergenic