ID: 1019603499

View in Genome Browser
Species Human (GRCh38)
Location 7:1897090-1897112
Sequence GCTGCACGGGGGCACCGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019603499_1019603509 11 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603509 7:1897124-1897146 AGACGGGCGGGTTGTGCAGAAGG 0: 1
1: 0
2: 1
3: 5
4: 95
1019603499_1019603505 -6 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603505 7:1897107-1897129 TGCAGCGCAGGCTGTGAAGACGG 0: 1
1: 0
2: 1
3: 23
4: 253
1019603499_1019603508 -1 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603508 7:1897112-1897134 CGCAGGCTGTGAAGACGGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 130
1019603499_1019603506 -5 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603506 7:1897108-1897130 GCAGCGCAGGCTGTGAAGACGGG 0: 1
1: 0
2: 0
3: 19
4: 196
1019603499_1019603513 27 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG 0: 1
1: 1
2: 21
3: 217
4: 1781
1019603499_1019603510 14 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603510 7:1897127-1897149 CGGGCGGGTTGTGCAGAAGGAGG No data
1019603499_1019603511 17 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603511 7:1897130-1897152 GCGGGTTGTGCAGAAGGAGGAGG 0: 1
1: 0
2: 3
3: 26
4: 307
1019603499_1019603512 26 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603512 7:1897139-1897161 GCAGAAGGAGGAGGAAGAGCCGG No data
1019603499_1019603507 -2 Left 1019603499 7:1897090-1897112 CCGGCACGGTGCCCCCGTGCAGC 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1019603507 7:1897111-1897133 GCGCAGGCTGTGAAGACGGGCGG 0: 1
1: 0
2: 1
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019603499 Original CRISPR GCTGCACGGGGGCACCGTGC CGG (reversed) Intronic
900244008 1:1629457-1629479 CCTGCACGTGGGCGCCGCGCCGG + Exonic
900610290 1:3541814-3541836 GCTCCCTGGGGGCACCGTGGGGG + Intronic
902193851 1:14783404-14783426 GCTTCTCGGGGTCACCGTGAAGG - Intronic
903939815 1:26921905-26921927 GCAGCACGAGGGCGGCGTGCAGG + Exonic
904200840 1:28818141-28818163 GCTGCAGGTGGGCAGAGTGCAGG + Intronic
1074864796 10:117538443-117538465 GAAGCCCGGGGGCACCTTGCAGG + Intergenic
1075961244 10:126569028-126569050 GCAGCCCGGGGGCAGGGTGCAGG + Intronic
1076258243 10:129045491-129045513 GCTGTAATGAGGCACCGTGCCGG + Intergenic
1076694466 10:132240469-132240491 CCTGCACGGGGGCATGGAGCTGG + Intronic
1076834373 10:133013757-133013779 GCGGCACGGGGGCTGCGTGGTGG + Intergenic
1077298390 11:1836439-1836461 GCTGCCAGGGGCCACCCTGCAGG + Exonic
1077504067 11:2922155-2922177 GCTGCTCCGGGCCAGCGTGCTGG + Exonic
1078470295 11:11580970-11580992 GCTTCAGGGTGGCACCGTGGAGG - Intronic
1078487736 11:11739736-11739758 GCTGGAGGGGGGCACGGTGGAGG + Intergenic
1081867199 11:46366480-46366502 GCAGGAAGGGGGCACAGTGCTGG - Exonic
1081914140 11:46720047-46720069 GCTGCACAGGGACACAGTCCAGG - Intronic
1083994682 11:66266179-66266201 GCTGCAGGGGGGCACCCCCCAGG + Exonic
1084321854 11:68377690-68377712 GATGAACGGGGTCACGGTGCAGG - Intronic
1088883503 11:113989652-113989674 GCTGCGCGTGGGCTCCGTGCTGG + Exonic
1090652976 11:128823521-128823543 GCTCCACGAGGGCACCGCTCTGG + Intergenic
1090976297 11:131683336-131683358 TCTGCAGCGGGGCACTGTGCAGG + Intronic
1091395152 12:149837-149859 GCTGCAGGGGGGGACCATGCTGG + Intronic
1100186522 12:92145529-92145551 GATGCATGGGGGCGGCGTGCGGG + Exonic
1100390207 12:94141095-94141117 GGTGCAGGGGGGCACCGATCGGG - Intergenic
1103459598 12:121093519-121093541 GGAGCACGGGCGCACCTTGCGGG - Intergenic
1103725961 12:122997491-122997513 GCTGCACGGAGGCACCATCCTGG - Exonic
1106081155 13:26501214-26501236 GCTGCATGTGGGCAGCCTGCAGG - Intergenic
1113763706 13:112867730-112867752 GCTGCACGCGGGTTCCGTGGGGG - Intronic
1115742173 14:36399832-36399854 GCAGCCCTGGGGCACCATGCTGG + Intergenic
1119263165 14:73250148-73250170 GCTGCCTGGGGGCTCAGTGCGGG + Intronic
1119575352 14:75716075-75716097 GATGCAAAGGGGCCCCGTGCTGG - Intronic
1121526352 14:94621952-94621974 GCTTCACGGGGGCACCAGGAGGG - Intronic
1121639437 14:95475361-95475383 GCTGCACGGGTCCCCCCTGCAGG + Intronic
1123043605 14:105500553-105500575 GCAGCACTAGGGCACCCTGCCGG - Intergenic
1123413003 15:20074426-20074448 GCTGCGCGGCGGCACCGGGGCGG - Intergenic
1123522345 15:21081539-21081561 GCTGCGCGGCGGCACCGGGGCGG - Intergenic
1124348684 15:28939789-28939811 GCTGCACGGAGGCACCCTAGGGG - Intronic
1124499563 15:30215186-30215208 GCTGCACAGGAGCTCCGTGGAGG - Intergenic
1124744016 15:32323475-32323497 GCTGCACAGGAGCTCCGTGGAGG + Intergenic
1125720316 15:41842186-41842208 GCTCCTCGGGGGCATCCTGCAGG - Exonic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1132393130 15:101453340-101453362 GCTGCACAGGGGCAGCCTGCGGG - Intronic
1132711966 16:1272823-1272845 GCTGCAGGTGGGCACTGGGCAGG + Intergenic
1134248101 16:12555023-12555045 GCTGCTCGGTGGCACCAGGCAGG - Intronic
1139359399 16:66388153-66388175 CCTGCATGGGGGCAAAGTGCTGG - Intronic
1140478773 16:75251574-75251596 GCTGCGCGGCGGCACCGGGGCGG - Intronic
1144812099 17:18007017-18007039 GCTGCACGATGGCTCAGTGCCGG + Exonic
1145112848 17:20179455-20179477 GCTGCAAGGGGGCACTGAGAAGG + Intronic
1145989478 17:29070306-29070328 ACTGCACGGGGGCACCACTCTGG + Intergenic
1151210552 17:72540843-72540865 GCTGCTCTGGGGCATCCTGCAGG + Intergenic
1151448092 17:74180472-74180494 GCTGCCCGGAGGCACGGGGCGGG + Intergenic
1151922026 17:77164189-77164211 CCTGCTCGGGGGCACGGTACCGG - Intronic
1152111368 17:78359359-78359381 GCTGCCCGGGGCCACCCTGCCGG - Intronic
1152720733 17:81922690-81922712 GCGGCAAGGGGGCCCCGGGCTGG + Exonic
1152793883 17:82297360-82297382 GCTGCAGGGTGGCACGGTGTTGG - Intergenic
1159523395 18:69556236-69556258 GCTGCAAGGGGCCAGCGTGGAGG - Intronic
1160723931 19:609247-609269 GCTGCCGGGGGGCACCGTCCTGG + Intronic
1162127129 19:8505800-8505822 GCCCCACGGGGGCGCCGTGGGGG + Intergenic
1165342843 19:35224902-35224924 GCTGCTCGTGGTCACCGTCCTGG - Exonic
1166315357 19:41986208-41986230 GCTGTACCTGGGCATCGTGCTGG - Exonic
1168272422 19:55257673-55257695 GCTGCAGGGGGCCACAGAGCGGG - Intronic
925388954 2:3482687-3482709 GCTGGTCGGGGGCACTGTGTGGG + Intronic
927639936 2:24839964-24839986 GGTGCACACGGGCACCGTGCTGG - Exonic
928718755 2:34094959-34094981 GGTACACGTGGGCAACGTGCAGG + Intergenic
929188585 2:39120416-39120438 GCGCCCCGGGGGCACCATGCAGG - Exonic
934754780 2:96817255-96817277 GCTGGACGCCAGCACCGTGCTGG + Exonic
935798691 2:106670993-106671015 GATGGAAGGGGCCACCGTGCAGG - Intergenic
936954172 2:118007855-118007877 GCTCCACGGGGTCACAGTCCTGG - Intronic
937325830 2:120989145-120989167 TCTGGACGAGGGCACCGGGCAGG + Exonic
940322234 2:152389733-152389755 GCAGCACGAGGGCGGCGTGCAGG + Intronic
946245543 2:218385158-218385180 GCTGCTCTGGGCCACCGTGTTGG + Exonic
946412889 2:219523883-219523905 GCTGCAGGGAGCCACCGTGATGG - Intronic
947641225 2:231708876-231708898 GCTGCCTGAGGGCACCGCGCCGG - Intronic
949035641 2:241814664-241814686 GCTGGCCGGGGGCTCCGTGCGGG + Exonic
1171362536 20:24598163-24598185 GCTGCAGACGGGCACTGTGCAGG + Intronic
1172429339 20:34876792-34876814 GCTGCACCGGCGCTCCGTGGAGG + Exonic
1172775309 20:37403581-37403603 GCTGGACAGAGTCACCGTGCTGG - Exonic
1173894674 20:46541776-46541798 GCTGCGCGGGGACGCCGGGCGGG + Exonic
1184422343 22:44389415-44389437 GCTGCAGAGGGGGGCCGTGCTGG + Intergenic
950078695 3:10205961-10205983 GCAGGACGGGGGCCCTGTGCTGG + Intronic
951088102 3:18538657-18538679 GCTGTACAGTGGCACCATGCAGG + Intergenic
953082464 3:39633676-39633698 GCTGCATGGAGGCCCCATGCTGG - Intergenic
954293779 3:49663093-49663115 GCCGCCCGTGGTCACCGTGCCGG - Exonic
954860854 3:53689266-53689288 GCTGCCAGGGTGCTCCGTGCTGG + Intronic
967273498 3:187750565-187750587 ACTCCACGGGGGCACAGTGTAGG + Intergenic
968503835 4:963029-963051 GCTCCACGGGGATCCCGTGCTGG - Intronic
968701115 4:2058805-2058827 GCTTCCCGGGGGCTCCGGGCCGG + Intergenic
983834203 4:172369548-172369570 GCTGCATGGGAGCACCCTGGGGG + Intronic
985104299 4:186485888-186485910 GCTGCCCAGGAGCGCCGTGCTGG - Intronic
985486744 5:156148-156170 GCTGGAGGGGGGCACCGTCCTGG + Exonic
985591723 5:768973-768995 ACTGCACTGGGGCACCGCGTTGG - Intergenic
985609639 5:879932-879954 ACTGCACTGGGGCACCGCGTTGG - Intronic
985631757 5:1017671-1017693 GCTGCAGGGCGGCCCCGTGGTGG - Intronic
991638741 5:68732773-68732795 GATGCACTGGGGCACAGGGCTGG + Intergenic
1001104924 5:168844684-168844706 GCTGAGCGGGGGCAGCGTGAGGG + Intronic
1001698897 5:173692423-173692445 CCTGAACTGGGGCACTGTGCAGG + Intergenic
1004179094 6:13365447-13365469 GGTGCACGGCGGCAGCCTGCTGG - Exonic
1013584630 6:111567201-111567223 GCTGCACGTGGGCACCTCGGGGG + Intronic
1013949246 6:115759624-115759646 GCTGCACTGGGGCAGAGAGCAGG - Intergenic
1018735386 6:166683961-166683983 GCAGCAAGGGGCTACCGTGCAGG + Intronic
1019603499 7:1897090-1897112 GCTGCACGGGGGCACCGTGCCGG - Intronic
1019670973 7:2278165-2278187 GCTGGCCAGGGACACCGTGCAGG - Exonic
1020211931 7:6164228-6164250 GCTGCACGCTGCCCCCGTGCCGG + Exonic
1023902213 7:44490528-44490550 GCAGCACGTGGGCAACGTCCAGG - Exonic
1029075659 7:97931926-97931948 GCTGCAGAGCGGCAACGTGCAGG + Intergenic
1029169365 7:98619831-98619853 GCTGCAGAGGGTCACCGAGCTGG + Exonic
1029640771 7:101817460-101817482 GCGCCGCGGGGGGACCGTGCCGG + Intronic
1034195004 7:149239727-149239749 GCAGCACGGGGGCTCCGAGGCGG + Exonic
1034229963 7:149516218-149516240 GCTGCATGGGAGCAGGGTGCAGG - Intergenic
1034619510 7:152446097-152446119 GCTGCACGGGGGGACACTGGAGG + Intergenic
1035203515 7:157280661-157280683 TCTGCACGGGGTCACCCTGCTGG + Intergenic
1035277808 7:157758464-157758486 GCTGCACGGGGGCCACGGTCTGG - Intronic
1035605196 8:926019-926041 GCCGCTCGGGGGCACAGAGCAGG + Intergenic
1038455999 8:27672307-27672329 TCTGCATGGGGGCACTCTGCAGG + Exonic
1039880216 8:41621013-41621035 GCTGGCTGGGGCCACCGTGCGGG + Exonic
1049497273 8:142942140-142942162 GCTGCACCAGGCCACCCTGCTGG + Intergenic
1049574112 8:143382588-143382610 GCTTCACTGGGGCACAGGGCTGG - Exonic
1049642388 8:143721542-143721564 GCTGCACGGGGGGACTCTGTGGG - Exonic
1049673733 8:143880631-143880653 GCTCCATGGAGTCACCGTGCTGG + Intergenic
1049686824 8:143942431-143942453 GCTGGACGGGGGCTGCGAGCCGG - Intronic
1049783749 8:144440720-144440742 GCTGCGCAGCGGCAACGTGCTGG - Exonic
1058663079 9:107283614-107283636 GCTGCGCGGCGGCACCATGCAGG + Exonic
1061303978 9:129722213-129722235 GCTGTAGGGTGGCACTGTGCTGG - Exonic
1062137176 9:134935374-134935396 GCTCCACGGAAGCACCCTGCTGG + Intergenic
1062431878 9:136529985-136530007 GCTGCACGGGGGCCCTGCCCTGG + Intronic
1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG + Intergenic
1187792012 X:22961208-22961230 GCTGCAAGGGGGCACAATGGGGG + Intergenic
1188963582 X:36523417-36523439 GGGGGACAGGGGCACCGTGCTGG + Intergenic