ID: 1019604139

View in Genome Browser
Species Human (GRCh38)
Location 7:1900066-1900088
Sequence CAGCGGCCCTGCGCTCTCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019604139_1019604143 -9 Left 1019604139 7:1900066-1900088 CCGCCGAGAGCGCAGGGCCGCTG 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1019604143 7:1900080-1900102 GGGCCGCTGGGCACCCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019604139 Original CRISPR CAGCGGCCCTGCGCTCTCGG CGG (reversed) Intronic
900458599 1:2789542-2789564 CTCCGGCCCTGCGCTCTGGACGG + Exonic
901532758 1:9863847-9863869 CAGCGGCCCTGCCCTATTAGGGG - Intronic
902456164 1:16535394-16535416 CAGCTTCCCTGAGCTCTGGGAGG + Intergenic
902496001 1:16872517-16872539 CAGCTTCCCTGAGCTCTGGGAGG - Intronic
903769387 1:25754325-25754347 CAGGGGCCCTGGGCTCTGGTTGG + Intronic
905106283 1:35565440-35565462 CCGCTGCCCTGCGCTCCCGCTGG + Exonic
915734821 1:158078099-158078121 AGGCCGCCCTGCGCTCTCGGCGG + Exonic
917838627 1:178959990-178960012 CAGCTGCCCTGTGCTCCTGGGGG + Intergenic
923790682 1:237108466-237108488 CAGCGGCCCTGCTCCCAGGGAGG - Intronic
924436414 1:244048098-244048120 CAGAGGCCCCGCGCACTCTGCGG - Intergenic
1063574825 10:7252240-7252262 CAGAAGCCCTGCCCTCTCTGAGG + Intronic
1066962384 10:42234630-42234652 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1069534649 10:69244055-69244077 CAGCCGCCTTGCTTTCTCGGAGG + Intronic
1070594292 10:77821454-77821476 CAGAGGCCCCGCCCTCTTGGAGG + Exonic
1071078704 10:81784292-81784314 CAGCGGTCCTGCACTCGGGGTGG + Intergenic
1074362090 10:112831963-112831985 CAGCAGCCCCGCGCTCTTGCCGG + Intergenic
1075679582 10:124322745-124322767 CAGAGGCCCTGTGCTTTAGGCGG - Intergenic
1075859412 10:125661782-125661804 CAGCGGCGCTGCCCCCTGGGAGG + Intronic
1077224237 11:1433165-1433187 CAGCTGCCCTGTGCCCTTGGTGG + Intronic
1084207941 11:67606827-67606849 CAGCGGCCCCGCCTCCTCGGGGG - Intergenic
1084675679 11:70632678-70632700 CACCCGCCCTGAGCACTCGGTGG + Intronic
1084730784 11:71072188-71072210 AAGGGGCCCTGGGCTCACGGGGG - Intronic
1084888145 11:72223905-72223927 CAGCGGCCCTGGGCTCCAGGCGG - Intronic
1091688998 12:2583150-2583172 CAGCGGCGCCGCGCTCCGGGCGG + Intronic
1097280866 12:57845134-57845156 CACCGGCCCTTCGCGCTCGGTGG + Intronic
1102928409 12:116843965-116843987 CATCTGCCCTGCCCTCTAGGTGG - Intronic
1103749940 12:123151379-123151401 CAGCAGCCGAGCGCACTCGGGGG + Intergenic
1105307580 13:19180046-19180068 CACCCGCCCTGTGCTCTCCGAGG + Intronic
1105891037 13:24682437-24682459 CAGAGGCCCTGACCTCTGGGTGG - Intronic
1106157487 13:27171758-27171780 CGGCGGCCCAGCGGGCTCGGTGG - Exonic
1110008081 13:70297243-70297265 CAGCCTCCCTGTGCTCTTGGGGG + Intergenic
1112387597 13:98954651-98954673 CAGAGGCCCTGCACTCTGTGTGG - Intronic
1113928092 13:113952314-113952336 CAGCGGCCCTGGGCAGGCGGAGG - Intergenic
1113945014 13:114039183-114039205 CAGCGGCCCTGGGATGTGGGAGG - Intronic
1114957732 14:27845433-27845455 CTGCGGCCCTGCACTCTGAGCGG + Intergenic
1117828557 14:59727553-59727575 CACCGGCCGTGGGTTCTCGGCGG + Exonic
1120578936 14:86221977-86221999 CAACGGCTCTGCTCTCTCTGGGG + Intergenic
1123021067 14:105398256-105398278 CTGCGGCCCCGCGCGCGCGGAGG + Intergenic
1123071512 14:105644716-105644738 CAGGGCCGCTGTGCTCTCGGAGG + Intergenic
1202929990 14_KI270725v1_random:27766-27788 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1123787400 15:23687127-23687149 CAGCAGCCCTGGGGTTTCGGAGG - Exonic
1124952703 15:34338059-34338081 CAGCGCGCCTGCGCTCGCCGCGG + Intronic
1126185862 15:45829851-45829873 CAGCCTCCCTGTGCTCTTGGGGG - Intergenic
1128081723 15:64861050-64861072 CAGAGGCCCTGCTCTCTCTCTGG + Intronic
1128218887 15:65953788-65953810 CCGTGTCCCTGTGCTCTCGGGGG + Intronic
1128506822 15:68278354-68278376 CAGCTGCCGTGCGCCCCCGGAGG - Exonic
1128980244 15:72180420-72180442 GAGCGCCCCTGTGCTCTTGGGGG + Intronic
1129905477 15:79184255-79184277 CAGAGGCTCTGCTCACTCGGAGG + Intergenic
1132504945 16:303219-303241 CAGCCGGCCTGCGCACTGGGAGG + Intronic
1132522192 16:397075-397097 CCGTGGCCCGGCGCTCACGGGGG - Intronic
1132670275 16:1099698-1099720 CAGCTGCCCTGCTCCCTGGGCGG + Intergenic
1133006281 16:2883422-2883444 CCCCGGCCCGGCTCTCTCGGGGG + Intronic
1134014415 16:10878574-10878596 CAGGGGCCATGTGCCCTCGGAGG + Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134248150 16:12555272-12555294 CAGCACCCCTGCTCTCTGGGAGG - Intronic
1134248190 16:12555517-12555539 CAGCGCCCCTGCTCTCTGGGAGG + Intronic
1135798881 16:25474236-25474258 CAGCTGCTCTGTGCTCTGGGAGG + Intergenic
1136718574 16:32302862-32302884 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1136773392 16:32859288-32859310 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1136836945 16:33509126-33509148 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1136897222 16:34002231-34002253 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1141452749 16:84116740-84116762 CGCCGGCCCTGAGCTCCCGGCGG - Exonic
1203007857 16_KI270728v1_random:214909-214931 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1203075808 16_KI270728v1_random:1121398-1121420 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1203123927 16_KI270728v1_random:1560055-1560077 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1203147123 16_KI270728v1_random:1809405-1809427 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1142560390 17:806027-806049 CACTGGCCCTGCGCTCACTGTGG - Intronic
1143508255 17:7381275-7381297 ACCCGGCCCTGCGCGCTCGGTGG - Intronic
1143778277 17:9213393-9213415 CTGCTGCCCTGCTCTCTCAGGGG - Intronic
1149469178 17:56902119-56902141 CAGCTGCCCCGAGCTCTCGAAGG - Intronic
1150360579 17:64530127-64530149 CAGTGGCCCTGCACTTTGGGAGG + Intronic
1152706727 17:81847440-81847462 CAGCAGCCCTGCCCTCCCGTGGG + Intronic
1152785382 17:82245290-82245312 CGGCGGCCACGCGCGCTCGGCGG - Intronic
1154160855 18:11980571-11980593 CTGCGGCCTTGTGCGCTCGGCGG + Intergenic
1154415387 18:14173116-14173138 CATCGGCCCTGCTCTCTCTATGG - Intergenic
1156382115 18:36572713-36572735 CAGAGGCCCTGAGCTCTTGGGGG + Intronic
1159511308 18:69400974-69400996 CCGCGGCGCTGGGCTCGCGGCGG + Intergenic
1160709396 19:544157-544179 CTGAGGCCCAGCGCTCTCGGTGG + Intronic
1161510944 19:4670528-4670550 CGGCGGCCCCGCCCCCTCGGCGG - Intergenic
1164157008 19:22603099-22603121 CGGCAGCCCTGAGCTCTGGGGGG - Intergenic
1165966978 19:39590127-39590149 CTGCTGCCCTGTGCTCTTGGTGG + Intergenic
1168239201 19:55080825-55080847 CCGCCGCCCTGCGCTCCCCGCGG - Exonic
1168339592 19:55615509-55615531 CAGCTGCCCTGCGCCCTGGCCGG + Exonic
1202707051 1_KI270713v1_random:31750-31772 CAGCTTCCCTGAGCTCTGGGAGG + Intergenic
925119064 2:1403408-1403430 CAGCAGCTCTGGGCTCTCCGTGG + Intronic
925977155 2:9149541-9149563 CAGCGGCTCTGGGCTCTGTGTGG + Intergenic
929979661 2:46666532-46666554 CAGCTGCCCCGAGCTCTCTGGGG - Intergenic
930089534 2:47521593-47521615 CCGCGGCTCCGCGCTCTCGGAGG - Exonic
931704704 2:64937777-64937799 CAGCAGCTCTGTGCTCTCAGTGG - Intergenic
932165090 2:69498524-69498546 CTGGGGCACTGGGCTCTCGGGGG - Intronic
934238458 2:90249964-90249986 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
934322570 2:91982489-91982511 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
934460881 2:94213306-94213328 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
934883692 2:98006132-98006154 CAGGGGAGCTGCGCTCTCAGAGG - Intergenic
937182957 2:120012835-120012857 CTGCGGCCCTCCGCCCGCGGAGG - Intergenic
937326552 2:120992977-120992999 CAGGGGCTCTGAGCTCTAGGGGG + Intergenic
948384158 2:237571328-237571350 CAGAGGCCCTGCCCTCACTGAGG + Intergenic
948699405 2:239750768-239750790 CAGCGTCCCTGGGCTGTGGGAGG + Intergenic
948874351 2:240819169-240819191 CAGCCGCGCTGCCCTCTCGCTGG - Intronic
1169494959 20:6106523-6106545 CAGTGACCCTGCGCACTCAGAGG + Intronic
1171272208 20:23826029-23826051 CAGCTGCCCTGGGCTGTAGGGGG + Intronic
1171283712 20:23921436-23921458 CAGCTGCCCTGGGCTGTCGGGGG + Intergenic
1172064274 20:32207949-32207971 CAGCGGCCGTGCCCACGCGGCGG - Exonic
1172676577 20:36676989-36677011 CAGCCTCCCTGTGCTCTTGGGGG + Intronic
1176235454 20:64051562-64051584 CAGTGACTCTGGGCTCTCGGGGG - Intronic
1176592007 21:8656348-8656370 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1176866655 21:14058047-14058069 CATCGGCCCTGCTCTCTCTATGG - Intergenic
1179613308 21:42566125-42566147 CAGTGGCCCTGGGCACTCAGTGG + Intronic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180221670 21:46363067-46363089 CAGTGGCCCAGCGCTATCTGTGG + Intronic
1180274856 22:10633477-10633499 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1180549322 22:16528393-16528415 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
957417769 3:79929005-79929027 CAGCATCCCTGTGCTCTCAGGGG + Intergenic
957625750 3:82650515-82650537 AAGCGTCCCTGTGCTCTTGGTGG + Intergenic
957986788 3:87582317-87582339 CAACCACCCTGCGCTCTGGGAGG + Intergenic
961094195 3:124140777-124140799 CAGCAGCCTTGCCCTCCCGGGGG + Intronic
963906206 3:150775104-150775126 ATGCATCCCTGCGCTCTCGGGGG - Intergenic
965051484 3:163655190-163655212 AAGCATCCCTGCACTCTCGGGGG - Intergenic
965118719 3:164522584-164522606 CAGCATCTCTGCTCTCTCGGGGG - Intergenic
967859105 3:194138182-194138204 CAGCGGCCCCTCGCTTACGGCGG + Exonic
971076124 4:23151809-23151831 CACCGGCCCTTTGCTCTCGCTGG + Intergenic
978754148 4:112285244-112285266 CTACGGCCCCACGCTCTCGGTGG - Intronic
979642366 4:123023950-123023972 CATCAGGCATGCGCTCTCGGTGG - Intronic
981081722 4:140643997-140644019 CAGCGGCTCTGGGATCTTGGAGG + Intronic
982545050 4:156724004-156724026 CAGCCTCCCTGTGCTCTTGGAGG + Intergenic
984296550 4:177861647-177861669 CAGGATCCCTGTGCTCTCGGGGG + Intronic
986421850 5:7593104-7593126 CAGCTGCCCAGCGCCCTCTGGGG + Intronic
987373990 5:17217748-17217770 CAGCGACCCCGGCCTCTCGGCGG + Exonic
988380238 5:30489523-30489545 CAGCGGCTCTGCCTTCTTGGTGG + Intergenic
990023613 5:51159487-51159509 CAGCGTCTCTGTGCTCTTGGGGG + Intergenic
1002612753 5:180432189-180432211 CAGGGGCTGTGCGCTCTCGCGGG + Intergenic
1006500792 6:34457755-34457777 CAGCCTCCCTGTGCTCTTGGAGG + Intergenic
1010368121 6:75076249-75076271 CAGCCGGCCTGCGCACTGGGAGG - Intergenic
1013730084 6:113155107-113155129 CAGAGGCCCAGAGCTCTAGGGGG + Intergenic
1014186972 6:118445782-118445804 CAGCAGCCCTGTGCTGTAGGAGG - Intergenic
1016936318 6:149451323-149451345 GAGCCGCCCGGGGCTCTCGGTGG + Exonic
1018784064 6:167094171-167094193 CAGCCGCCCTCAGCTCGCGGGGG - Intergenic
1018842271 6:167525921-167525943 CAGCGTCCATGCGCTCACCGTGG + Intergenic
1019437276 7:1028598-1028620 CAGGGGCCCTGCGCGGGCGGGGG - Intronic
1019491925 7:1318223-1318245 CAGGACCCCTGCGCTCTGGGAGG + Intergenic
1019604139 7:1900066-1900088 CAGCGGCCCTGCGCTCTCGGCGG - Intronic
1020096272 7:5371162-5371184 CAGCGGCTCTGTGATCTTGGAGG + Exonic
1029220895 7:98989387-98989409 CAGCAGCCCTGAGCTCAGGGTGG + Intronic
1029458463 7:100682663-100682685 CAGCGGCCTGGGGCTCTGGGAGG - Exonic
1030143342 7:106327724-106327746 CAGCAGCCCTGAGCTCTCCTGGG + Intergenic
1032522857 7:132559519-132559541 CAGAGGCCCTGCACTGTCTGGGG + Intronic
1036224923 8:6949633-6949655 CAGTGACCCTGTCCTCTCGGAGG + Intergenic
1042224595 8:66505428-66505450 CAGGGTCCCTGCGGTCTCCGCGG - Exonic
1042858948 8:73294669-73294691 CCCCGGCCCTGCACTCTCCGCGG - Exonic
1049416692 8:142498687-142498709 CAGCGGCCCTGGGCCCTTGCTGG - Intronic
1049591861 8:143466327-143466349 CAGTGTCCCTGGGCTCTAGGTGG + Intronic
1053691377 9:40589004-40589026 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1054273425 9:63048481-63048503 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1054302637 9:63389975-63389997 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1054401409 9:64716475-64716497 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1054435017 9:65200795-65200817 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1054495373 9:65820886-65820908 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1055933561 9:81584354-81584376 CAGAGGCCCTGCTCCCTCGGAGG + Intronic
1057379164 9:94553576-94553598 CATCGGCACTGCGCTCTTCGGGG + Intergenic
1061149025 9:128818599-128818621 CAGCAGCCCTGTGCCCTCGTTGG + Exonic
1061424549 9:130490889-130490911 CAGCTGCCCTGAGCTGTGGGAGG + Intronic
1062165628 9:135105963-135105985 AAGCCGCCCTGAGCCCTCGGGGG + Intronic
1062216850 9:135393932-135393954 CACCGTCCCTGCTCCCTCGGAGG + Intergenic
1062685255 9:137809407-137809429 CGGCGGCCCTGCGCCCTCGGAGG + Intronic
1203622056 Un_KI270749v1:135195-135217 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1187334711 X:18372294-18372316 CAGAGGCCCAGAGCTCTAGGAGG + Intergenic
1192595814 X:72407257-72407279 CAGCTGGCCTGCGCACTGGGAGG + Intronic
1196616123 X:117769142-117769164 CAGCGGCCCTGCCCTCTGATCGG + Intergenic
1200003146 X:153072334-153072356 CAACGGCCCTGCGCTCTCCCGGG + Intergenic
1200004577 X:153077675-153077697 CAACGGCCCTGCGCTCTCCCGGG - Intergenic
1202583564 Y:26404262-26404284 CATCAGCCCTGCTCTCTCTGTGG - Intergenic