ID: 1019605857

View in Genome Browser
Species Human (GRCh38)
Location 7:1909888-1909910
Sequence CGCCCTGGAATTACACACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019605854_1019605857 -7 Left 1019605854 7:1909872-1909894 CCAGTGAGAAGACACTCGCCCTG 0: 1
1: 0
2: 0
3: 14
4: 84
Right 1019605857 7:1909888-1909910 CGCCCTGGAATTACACACGGAGG No data
1019605853_1019605857 22 Left 1019605853 7:1909843-1909865 CCTGCTGGGCAGAAACTGCACAC 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1019605857 7:1909888-1909910 CGCCCTGGAATTACACACGGAGG No data
1019605851_1019605857 24 Left 1019605851 7:1909841-1909863 CCCCTGCTGGGCAGAAACTGCAC 0: 1
1: 0
2: 15
3: 23
4: 231
Right 1019605857 7:1909888-1909910 CGCCCTGGAATTACACACGGAGG No data
1019605852_1019605857 23 Left 1019605852 7:1909842-1909864 CCCTGCTGGGCAGAAACTGCACA 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1019605857 7:1909888-1909910 CGCCCTGGAATTACACACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019605857 Original CRISPR CGCCCTGGAATTACACACGG AGG Intronic
No off target data available for this crispr