ID: 1019607804

View in Genome Browser
Species Human (GRCh38)
Location 7:1918828-1918850
Sequence CCCCAGGGCGACTGGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019607793_1019607804 4 Left 1019607793 7:1918801-1918823 CCCACCTGAGGAGACCACAGCTC 0: 1
1: 0
2: 0
3: 15
4: 465
Right 1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 207
1019607789_1019607804 25 Left 1019607789 7:1918780-1918802 CCCACCTGGACTGCACTTGGGCC 0: 1
1: 1
2: 0
3: 18
4: 199
Right 1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 207
1019607791_1019607804 21 Left 1019607791 7:1918784-1918806 CCTGGACTGCACTTGGGCCCACC 0: 1
1: 0
2: 1
3: 19
4: 163
Right 1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 207
1019607795_1019607804 0 Left 1019607795 7:1918805-1918827 CCTGAGGAGACCACAGCTCCCGG 0: 1
1: 0
2: 2
3: 23
4: 166
Right 1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 207
1019607790_1019607804 24 Left 1019607790 7:1918781-1918803 CCACCTGGACTGCACTTGGGCCC 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 207
1019607794_1019607804 3 Left 1019607794 7:1918802-1918824 CCACCTGAGGAGACCACAGCTCC 0: 1
1: 0
2: 3
3: 35
4: 232
Right 1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 207
1019607799_1019607804 -10 Left 1019607799 7:1918815-1918837 CCACAGCTCCCGGCCCCAGGGCG 0: 1
1: 0
2: 7
3: 50
4: 618
Right 1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 207
1019607788_1019607804 26 Left 1019607788 7:1918779-1918801 CCCCACCTGGACTGCACTTGGGC 0: 1
1: 0
2: 2
3: 13
4: 218
Right 1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019607804 Original CRISPR CCCCAGGGCGACTGGTGCTG TGG Intronic
900144278 1:1151138-1151160 ACCCAGGGCCCATGGTGCTGAGG + Intergenic
901016828 1:6236600-6236622 CCCCAGGGCGTCTGGTTTTCGGG - Intergenic
901615511 1:10536329-10536351 CTACAGGGGGACTGGGGCTGGGG + Intronic
902229684 1:15020042-15020064 CCCCAGGGCCCCTGGGGCTGGGG - Intronic
902261343 1:15227067-15227089 CCCCTGGGAGACTGGTGTGGAGG - Intergenic
903007480 1:20308368-20308390 CCCAAGGTGGACTGGAGCTGAGG + Intronic
903469526 1:23576190-23576212 CCTCATGGCTACTGGTGGTGGGG + Intergenic
903859759 1:26357478-26357500 CGCCAGGGGGACTGGGGGTGTGG - Intergenic
904285216 1:29449616-29449638 CCCCAGGTCAGCTGGTCCTGTGG + Intergenic
904576214 1:31506738-31506760 CCCCAGGGGGACTGGTGCAGCGG - Intergenic
906033686 1:42738354-42738376 CCCCGAGGCCACTGGGGCTGGGG + Intronic
906258023 1:44365542-44365564 CTCCTGGGCTACTGCTGCTGGGG + Intergenic
907520346 1:55019704-55019726 CCCCAGGGCAAGTGGAGGTGGGG - Intergenic
912567292 1:110597216-110597238 CCCCAGGGAGACGGATGCTGAGG - Intronic
913521411 1:119648365-119648387 CTCCAGGGCGCCCGCTGCTGCGG - Intergenic
915963306 1:160284863-160284885 CACCCCGGCGACTGGAGCTGGGG - Intronic
920054104 1:203180416-203180438 CCCCAGGGCTGCTGGTGGTGTGG + Intronic
921719231 1:218452039-218452061 CACCAGGCAGACAGGTGCTGGGG - Intergenic
922596201 1:226815282-226815304 CCCCAGGGTGTCCTGTGCTGGGG - Intergenic
922602139 1:226864573-226864595 TCCCTGGGGGACTGGTGCAGAGG + Intergenic
923405500 1:233655108-233655130 CCCCAGGCCCACTAGGGCTGTGG - Intronic
1063639765 10:7818331-7818353 GCCCAGGGCGGCAGGTGCTGGGG - Intergenic
1067346586 10:45442708-45442730 GCCCAGGCCCGCTGGTGCTGGGG + Intronic
1067850576 10:49751437-49751459 CCCCAGGGCTGCAGGGGCTGGGG - Intronic
1069545827 10:69327969-69327991 CTCCATGGCCCCTGGTGCTGTGG + Intronic
1071601658 10:86961512-86961534 CCCCAGGGCCTCTTTTGCTGGGG - Intronic
1074160472 10:110832843-110832865 GCCCTGGGCCACAGGTGCTGTGG - Intronic
1075055627 10:119216396-119216418 CCACAGGGCCACTGGTGCCTCGG + Intronic
1075244756 10:120811087-120811109 ACCCAGGGCGTTTGGGGCTGGGG - Intergenic
1077431222 11:2516939-2516961 CCCTAGAGGGACAGGTGCTGGGG - Intronic
1078325742 11:10379251-10379273 CCCCTGGGCCACTGGTGTTCTGG + Intronic
1079024988 11:16940023-16940045 AGCCAGGGCCACTGGTGCTGGGG + Intronic
1080750435 11:35145634-35145656 CCCCAAGGTGGCTGCTGCTGGGG - Intronic
1083213901 11:61206662-61206684 CCCAGGGTCGGCTGGTGCTGGGG - Intronic
1083216785 11:61225491-61225513 CCCAGGGTCGGCTGGTGCTGGGG - Intronic
1083219667 11:61244317-61244339 CCCAGGGTCGGCTGGTGCTGGGG - Intronic
1083272726 11:61580419-61580441 CCCCCGGGGCACCGGTGCTGGGG + Intronic
1083635464 11:64118317-64118339 CGCCAGGGCAGCTGGGGCTGAGG - Exonic
1083694766 11:64435316-64435338 CCCAAGTGCCAATGGTGCTGAGG - Intergenic
1083936392 11:65872163-65872185 ACCCAGGGTGACTGCTGCCGGGG - Intronic
1085678568 11:78549114-78549136 CCCAAGTGGGACTGGGGCTGAGG - Intronic
1090669884 11:128938683-128938705 CCCCAGGGCGGCGGGAGCTCTGG + Intronic
1091219320 11:133920796-133920818 CCCCAGGGCTGCTGCTGCTGAGG + Exonic
1091632464 12:2172227-2172249 TCCCAGGGCCCCTGTTGCTGAGG - Intronic
1096517133 12:52163050-52163072 CCCCAGGGGGGCTGGTTCTTGGG - Intergenic
1101063297 12:100993959-100993981 CCCCAGTGCCATTAGTGCTGAGG - Intronic
1101598591 12:106189100-106189122 CCCCAGGGCAGAGGGTGCTGTGG - Intergenic
1101837782 12:108307181-108307203 CCAAAGGGTGGCTGGTGCTGGGG + Intronic
1102986272 12:117280993-117281015 CCCCAGGGCCAATGGAGCAGCGG + Intronic
1104388900 12:128374994-128375016 GCCAAGAGCGAATGGTGCTGAGG - Intronic
1107002177 13:35560650-35560672 CCACAGGGTGCCTGGGGCTGGGG + Intronic
1107120174 13:36787491-36787513 CTCCAGGGGGACTGAGGCTGGGG + Intergenic
1116021506 14:39468097-39468119 CCCCAAGGCCACTAATGCTGTGG + Intergenic
1119537800 14:75417146-75417168 CCCCAGGGCTACTTGTGGTTGGG - Intergenic
1121108969 14:91299513-91299535 CCCCACGGAGACTGGTCTTGGGG + Intronic
1122388987 14:101367659-101367681 CCCCAGGGCTTCTCCTGCTGGGG - Intergenic
1122688309 14:103520393-103520415 CCCCGGGGGGACTGATGCTGGGG + Intronic
1122762867 14:104042763-104042785 TCCCAGGGAGACTGGCTCTGGGG - Intronic
1122843621 14:104478704-104478726 CCCCAGCTCGAGGGGTGCTGGGG + Intronic
1123048853 14:105531138-105531160 CCCCAGGTGGCCTGGAGCTGGGG - Intergenic
1124856037 15:33390316-33390338 CCCCAGGTATACTGGTACTGAGG - Intronic
1125603887 15:40929382-40929404 CACCAAGGCGGCTGGGGCTGCGG - Exonic
1125605301 15:40936840-40936862 CCCCAGGGCCCCTGGGGCGGGGG + Exonic
1127264023 15:57346791-57346813 GCTGAGGGCGGCTGGTGCTGGGG + Intergenic
1128248522 15:66149158-66149180 CTCCAGGGCGCCTGGGCCTGTGG - Intronic
1129520319 15:76181978-76182000 TCTCAGGGTGAATGGTGCTGAGG - Intronic
1132548343 16:543878-543900 CCCCAGGACAGCAGGTGCTGTGG + Intronic
1132629691 16:911308-911330 CTCCAGGGCGAAGGGTGCCGAGG - Intronic
1133006291 16:2883446-2883468 CCCGAGGGCTGCGGGTGCTGAGG + Intronic
1133188990 16:4119503-4119525 ACCCCGGGGGACTGGGGCTGTGG + Intergenic
1135206833 16:20491924-20491946 CCCCAGGGCGACGGGCTCTGGGG - Intergenic
1135212052 16:20531708-20531730 CCCCAGGGCGACGGGCTCTGGGG + Intergenic
1136418324 16:30116861-30116883 CCCCAGCCCCACTGCTGCTGGGG + Intronic
1137723708 16:50642788-50642810 CCCCAGTGAGACAGCTGCTGTGG + Intergenic
1138432906 16:56980972-56980994 CCCCAAAGCCACAGGTGCTGGGG + Intronic
1139432708 16:66919626-66919648 CCCCAGGGGGACCTGTGGTGGGG + Intergenic
1139870808 16:70107468-70107490 CGCCAGGGCCTCTGGGGCTGTGG - Intergenic
1140376071 16:74446409-74446431 CGCCAGGGCCTCTGGGGCTGTGG + Intergenic
1141895303 16:86955362-86955384 TCCCAGGAGGCCTGGTGCTGGGG - Intergenic
1142193062 16:88726678-88726700 CCCCAGGGCGGTGGGTGCGGGGG + Intronic
1143003743 17:3813193-3813215 TCACAGGGCGCCTGGCGCTGAGG - Exonic
1143223504 17:5281738-5281760 CCCCAGGTCTTCTGGTGCAGAGG - Intergenic
1143319533 17:6059264-6059286 CCCTGGGGGGACTGGGGCTGCGG + Intronic
1143473771 17:7191837-7191859 GCCCAGGGCCACAGGTGTTGGGG + Intronic
1143627322 17:8118027-8118049 CTCCAGGCCGGCTGCTGCTGCGG - Exonic
1144809948 17:17992643-17992665 CCCCAGTGCTGATGGTGCTGTGG + Intronic
1148386568 17:47238553-47238575 CCCCAGGGCGGCGGGCTCTGGGG + Intergenic
1148847775 17:50539216-50539238 CCCCATGGCCAATGGTGCAGGGG + Exonic
1151685392 17:75643272-75643294 CTCCAGGGCGGCTGAGGCTGAGG + Intronic
1152223270 17:79080989-79081011 TCCCAGGGGGCCTGGTGCTCTGG + Exonic
1152688595 17:81707319-81707341 CCACTGGGCGCCTGGTGCTGGGG - Exonic
1152766867 17:82146093-82146115 CCCCTGGGCCACCGGTGCTGGGG + Intronic
1154337146 18:13474864-13474886 CCCAGGGGCTACAGGTGCTGGGG + Intronic
1156528828 18:37795480-37795502 CCCCAGGACATCTTGTGCTGTGG - Intergenic
1158664449 18:59420127-59420149 CCCCAGGGGGGCTGGGGCTGTGG + Intergenic
1159025211 18:63177413-63177435 ACCCAGGGCCTCTGATGCTGGGG + Intronic
1162363116 19:10231259-10231281 CCCCAGGGCGGCCGCGGCTGGGG + Exonic
1163263364 19:16204420-16204442 CCCCATGGCTGCTGGAGCTGGGG - Intronic
1163460841 19:17436605-17436627 CTCCAGGGCTGCAGGTGCTGTGG + Exonic
1164656048 19:29922762-29922784 CCCAAGGGTGAATGGAGCTGGGG - Intergenic
1165159594 19:33808217-33808239 CCCCAGGGCTACTGGTCCTCTGG - Intronic
1165351391 19:35277768-35277790 CCCCACGGTGCCTGGTGCTGGGG + Intronic
1165388413 19:35525007-35525029 CTCCAGGGTGACTGGGGCTGCGG + Intronic
1166676957 19:44746691-44746713 TCCCAGGGCAGCTGGTGCAGTGG - Intergenic
1166812745 19:45523960-45523982 AGTCAGGGCGAATGGTGCTGGGG + Intronic
1167175532 19:47861304-47861326 CCACAAGGCGCCTGGGGCTGGGG - Intergenic
1167461107 19:49625212-49625234 TCCCAGGGCGATGGGTGCTGTGG - Intronic
926722518 2:15971716-15971738 CCCCAGGGCGAGGGCTGATGAGG - Intergenic
927552146 2:24010107-24010129 CCCCTTGGCGGCTGGTGCAGGGG - Exonic
927882877 2:26701067-26701089 CCCAAGGGACACTGATGCTGTGG + Intronic
927891490 2:26753094-26753116 CCCCAGGGAGTCAGGGGCTGGGG + Intergenic
929139586 2:38655253-38655275 CACCAAGACGAGTGGTGCTGTGG - Intergenic
931245152 2:60486172-60486194 TCCTAGGGAGACTGGTACTGGGG + Intronic
932467034 2:71930514-71930536 CCGCAGGGCCAGTGTTGCTGAGG + Intergenic
932578086 2:72973694-72973716 GCCCTGGGCGCCTGGGGCTGAGG - Intronic
932667262 2:73707934-73707956 CCCAAGGGAGACTGGGGTTGGGG + Intergenic
932715792 2:74100180-74100202 CCCCAGTGGGGCTGGGGCTGGGG + Intronic
938957931 2:136315710-136315732 CCCCAGTGGGACTGGTCCTCAGG + Intergenic
941088506 2:161146953-161146975 CCCTAGGGGGAGGGGTGCTGCGG - Intronic
941705603 2:168655566-168655588 CTCCAGGTCCACTGGCGCTGTGG - Intronic
944773001 2:202932932-202932954 CCCCTGGAGAACTGGTGCTGTGG - Intronic
946644708 2:221820559-221820581 CCCCTGAGCTACTGCTGCTGTGG + Intergenic
947461005 2:230305508-230305530 TCCCAGGGCAACTGGCTCTGGGG - Intronic
947574394 2:231261056-231261078 GCCCAGGGCGTCTGATGCTCTGG + Intronic
948209266 2:236179873-236179895 ACCCTTGGGGACTGGTGCTGGGG + Intergenic
948556854 2:238817990-238818012 CCCCAGGCCCAGTGGGGCTGTGG + Intergenic
948790206 2:240372861-240372883 CCCCAGGGCCACTCCTGTTGGGG + Intergenic
948852245 2:240714164-240714186 CACCAGGGCCCCAGGTGCTGGGG + Exonic
1172097323 20:32466815-32466837 GCCCAGGGAGGCTGGTGCAGGGG + Intronic
1172214250 20:33223886-33223908 CCCTGGGGCCACTTGTGCTGAGG - Exonic
1175161579 20:57011782-57011804 GCCCAGGGGGACTGGCCCTGAGG - Intergenic
1175551369 20:59820020-59820042 CTCCAGGGGGACCGTTGCTGGGG + Intronic
1176299377 21:5091284-5091306 CCAGAGGGCCACTGGTGCTCAGG - Intergenic
1177153268 21:17476165-17476187 CACCAGGGTGACTGGTCCAGGGG - Intergenic
1179857649 21:44170663-44170685 CCAGAGGGCCACTGGTGCTCAGG + Intergenic
1179884405 21:44307280-44307302 TCCCACGGGGACTGGGGCTGAGG - Intronic
1180840010 22:18954820-18954842 CATCAGGGGGCCTGGTGCTGGGG - Intergenic
1180988647 22:19920250-19920272 ACCCAGGGCCACAGGTTCTGGGG + Intronic
1181061890 22:20285660-20285682 CATCAGGGGGCCTGGTGCTGGGG + Intergenic
1181427758 22:22855411-22855433 TCCCAGGGCCACAGGAGCTGAGG - Intronic
1181518896 22:23434018-23434040 CCACAGGGCCACGGGGGCTGCGG + Intergenic
1182451998 22:30427197-30427219 CGCCAGGGTGACTGTGGCTGTGG + Exonic
1182661344 22:31927373-31927395 CCCCTGGGCAACTGGTGGCGGGG - Intergenic
1183490199 22:38111818-38111840 CCTCAGGGAGGCTGGGGCTGGGG + Exonic
1183746302 22:39694003-39694025 CCCCAGGGCCACTTGTGGTCTGG + Intergenic
1184232532 22:43166381-43166403 CTCCAGGGCCACTAGAGCTGTGG + Intergenic
1184468717 22:44683697-44683719 CCCCAGAGGGACTGGATCTGAGG - Intronic
1184757659 22:46526066-46526088 TCCCCGGGCAGCTGGTGCTGAGG + Intronic
1185202846 22:49518570-49518592 CCCCGGGGAGCCTGGTGCGGGGG - Intronic
1185344183 22:50304242-50304264 CCCCAGGCCCAGTGGTGCCGGGG - Intronic
1185394948 22:50582208-50582230 CCCTAAAGCCACTGGTGCTGCGG + Intronic
950031324 3:9855710-9855732 CCCCATGGCTGCTGGTGCTCTGG - Intergenic
952217359 3:31290757-31290779 GCCAAGGGCAGCTGGTGCTGGGG - Intergenic
953223788 3:40998391-40998413 CCCCAGGTCGACAGGTACGGAGG - Intergenic
953759895 3:45678434-45678456 CCCCAGGGTGGCAGGAGCTGAGG + Exonic
954801526 3:53189752-53189774 CCCCAGGCTGACTGGGGCTGGGG + Intronic
964801766 3:160565471-160565493 CCCCAGCGCGACTGCAGCTCCGG + Exonic
968108293 3:196019735-196019757 ACCCAGGGCATGTGGTGCTGAGG + Intergenic
968504114 4:964140-964162 CCACAGAGCGAGTGGAGCTGGGG + Intronic
968890842 4:3367636-3367658 CCCCAGGGCACTTGCTGCTGGGG + Intronic
969049178 4:4360546-4360568 CCCCAGGGAGTTTGGGGCTGGGG - Intronic
969465660 4:7354764-7354786 CCCCAGGGCTCCTCGTGCTGTGG - Intronic
969674860 4:8608838-8608860 CCCCAGGGAGCCGGGTGCAGGGG + Intronic
969690043 4:8699189-8699211 CCCCAGGGATCCTGGTGCTAGGG - Intergenic
970593289 4:17577611-17577633 CCCGTGGGCTACTGGGGCTGCGG + Intronic
971387771 4:26156996-26157018 GCCCAGGGAGACTGAGGCTGTGG + Intergenic
975526198 4:75353077-75353099 CCCCAGAGAGACTGCTGCTGAGG + Intergenic
985470234 5:37402-37424 ACCCAGGGCATGTGGTGCTGAGG + Intergenic
985616288 5:923636-923658 GCCCAGGGCCGCTGGTGCTGGGG - Intergenic
985823259 5:2175308-2175330 ACCCAGGGTGAGGGGTGCTGTGG + Intergenic
985899790 5:2779699-2779721 CCCCAGGGGAACTGGTGCTGAGG + Intergenic
990988095 5:61659614-61659636 CTGCAGGGAGACTGGTGCCGCGG + Intronic
992939965 5:81751588-81751610 CCCCAGGGCGGCTGAGGCCGTGG - Intronic
998407040 5:141879822-141879844 CCCCTGGGCTCCTGGGGCTGAGG - Intergenic
1000050422 5:157558296-157558318 ACCCGGGGAGACAGGTGCTGAGG - Intronic
1002352405 5:178592242-178592264 ACCAAGGGCCACAGGTGCTGTGG - Intergenic
1003070689 6:2943286-2943308 TACCAGGGCCATTGGTGCTGGGG - Intergenic
1003152292 6:3563065-3563087 CCCCAGGGTGACTGGTGCACTGG + Intergenic
1004509885 6:16277000-16277022 CCCCAGGCCTACTGCAGCTGAGG + Intronic
1006512720 6:34530315-34530337 TGCCGGGGCCACTGGTGCTGCGG - Exonic
1008977530 6:57445539-57445561 GCCCAGGGCAACAGGTGCAGTGG - Intronic
1009165670 6:60338493-60338515 GCCCAGGGCAACAGGTGCAGTGG - Intergenic
1009491720 6:64300257-64300279 CCCCAGGCCGACAGGGGCCGCGG + Intronic
1012586068 6:100923946-100923968 GCCCATGGAGACTGGAGCTGGGG + Intergenic
1013225969 6:108119554-108119576 CCCCAGTGCTGGTGGTGCTGCGG - Intronic
1015382863 6:132589398-132589420 CCACTGAGCGAATGGTGCTGAGG + Exonic
1016996564 6:149965509-149965531 CCCTAGGGCCAGTGGGGCTGCGG - Intronic
1017002235 6:150004733-150004755 CCCGAGGGCGAGTAGGGCTGCGG + Intergenic
1017011831 6:150068665-150068687 CCCGAGGACGAGTGGGGCTGCGG + Intronic
1017285277 6:152667753-152667775 CCACAGGGACACTGGTTCTGGGG + Intergenic
1018838868 6:167505106-167505128 CCCCAGAGCTTCTGGTTCTGTGG + Intergenic
1018910508 6:168098662-168098684 CCCCAGGTGGAATGGTGCTGGGG - Intergenic
1019478443 7:1255218-1255240 CCGGAGGGCGACTGGAGCTGTGG - Intergenic
1019592391 7:1842307-1842329 CCACAGGGCCACGGGGGCTGCGG - Intronic
1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG + Intronic
1019737819 7:2659275-2659297 CCCCTGGGCGGCTGGTCCCGAGG - Intronic
1020016804 7:4836086-4836108 CCTGAAGGCGCCTGGTGCTGAGG + Intronic
1022283165 7:28930795-28930817 CTCCAGGGCCACTGATGCAGAGG - Intergenic
1022989742 7:35695365-35695387 CCCCAGGGCAGCTGGGGCCGAGG - Intronic
1024364408 7:48504712-48504734 CCCGTGGACCACTGGTGCTGTGG - Intronic
1025887706 7:65614072-65614094 AGCCAGCGCTACTGGTGCTGGGG - Intergenic
1026342874 7:69449165-69449187 CCCCAGTGATGCTGGTGCTGGGG - Intergenic
1026600484 7:71773510-71773532 AGCCAGGGGGACTGATGCTGTGG + Intergenic
1028977871 7:96933948-96933970 ACCCAGGATGACTGATGCTGAGG - Intergenic
1029222724 7:99003142-99003164 CACCAGGGCGACTGGAGGTCAGG - Intronic
1029732717 7:102448310-102448332 GCTCAGGGCAGCTGGTGCTGCGG - Exonic
1031854701 7:126907846-126907868 AGCCAGCGCTACTGGTGCTGGGG + Intronic
1031978095 7:128106516-128106538 CCCCAAAGACACTGGTGCTGGGG - Intergenic
1032421247 7:131781778-131781800 TCCCAGGGAGATTGGTGCGGAGG + Intergenic
1034438604 7:151075545-151075567 CCCCAGGGCTACTGGGGCCAGGG + Intronic
1034509250 7:151520560-151520582 CACCGGGGCGGCTGGTGCGGCGG + Intergenic
1035337966 7:158142244-158142266 CCCCAGGGTGACTAGGGCAGCGG - Intronic
1035953096 8:4045450-4045472 CGGAAGGGCCACTGGTGCTGGGG + Intronic
1036482556 8:9151386-9151408 CCCCAGGGCGTATGCTGCCGCGG - Intronic
1036563604 8:9919166-9919188 CCCTAGAGCAACTGCTGCTGCGG + Intergenic
1037300140 8:17443104-17443126 CCCCAGGGGGCCAGGTGCGGTGG + Intergenic
1038338415 8:26663571-26663593 CCCCAGTGCCACTGGGGCTCTGG + Intergenic
1040474340 8:47763559-47763581 TCCCAGGGGGACTGTTTCTGGGG - Intergenic
1040517596 8:48147365-48147387 CCCCAGGGCGGGTGGTGCAAAGG - Intergenic
1043053264 8:75407495-75407517 CCCCAGGGCGACTGGCGGTCGGG - Intergenic
1046036964 8:108854375-108854397 CCCCTGGCTGCCTGGTGCTGAGG + Intergenic
1048094009 8:131271810-131271832 GGCCAGGGCTACTGTTGCTGGGG - Intergenic
1049288975 8:141791636-141791658 CCCCAGGGGGACAGGTTCTGTGG - Intergenic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1050537672 9:6644981-6645003 CCACAGGGCCACTTGGGCTGGGG + Intronic
1056815982 9:89801281-89801303 CCCCAGTTAGACTGGTGCTTTGG - Intergenic
1056942174 9:90965015-90965037 CCCCAGGCCTGCTGGTGCTGAGG - Intergenic
1057024592 9:91725443-91725465 CCCCAGGGCAGCTGGTGCCTGGG - Intronic
1057391378 9:94643917-94643939 CCCCGGGGCCACAGGAGCTGGGG - Intergenic
1060883229 9:127133256-127133278 CCCCTTGGGGACTGGGGCTGAGG - Intronic
1061191763 9:129086354-129086376 TCCCAGGGAGACAGGGGCTGGGG - Intronic
1062159270 9:135070713-135070735 CCCCAGACCGACTGGAGCTTTGG + Intergenic
1189959189 X:46308240-46308262 CCCCAGGGCTTCTGATCCTGTGG + Intergenic
1191252205 X:58265083-58265105 CCCCAGCGGGCCTGGTGCAGGGG - Intergenic
1192274661 X:69616608-69616630 GCCCAAGGTGACTGGTGATGGGG - Exonic
1197881917 X:131175837-131175859 CCCTAGGGAGACTGGAGCAGAGG - Intergenic