ID: 1019608702

View in Genome Browser
Species Human (GRCh38)
Location 7:1924043-1924065
Sequence TTAAGCAGCATGAAAAGAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019608700_1019608702 22 Left 1019608700 7:1923998-1924020 CCTAGAATCTCGGGATATTCAAA 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1019608702 7:1924043-1924065 TTAAGCAGCATGAAAAGAACCGG No data
1019608701_1019608702 -5 Left 1019608701 7:1924025-1924047 CCAGAATGCAATCTAAAATTAAG 0: 1
1: 0
2: 0
3: 15
4: 310
Right 1019608702 7:1924043-1924065 TTAAGCAGCATGAAAAGAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019608702 Original CRISPR TTAAGCAGCATGAAAAGAAC CGG Intronic
No off target data available for this crispr