ID: 1019609216

View in Genome Browser
Species Human (GRCh38)
Location 7:1928495-1928517
Sequence TCTAGGGACCTGCAGGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019609216_1019609228 20 Left 1019609216 7:1928495-1928517 CCCATGACCTGCAGGTCCCTAGA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1019609228 7:1928538-1928560 ATCTCAGCTTGGCACAGGACTGG No data
1019609216_1019609221 -9 Left 1019609216 7:1928495-1928517 CCCATGACCTGCAGGTCCCTAGA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1019609221 7:1928509-1928531 GTCCCTAGATGGCAGGACCCAGG 0: 1
1: 0
2: 2
3: 18
4: 188
1019609216_1019609229 21 Left 1019609216 7:1928495-1928517 CCCATGACCTGCAGGTCCCTAGA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1019609229 7:1928539-1928561 TCTCAGCTTGGCACAGGACTGGG 0: 1
1: 0
2: 1
3: 25
4: 308
1019609216_1019609227 15 Left 1019609216 7:1928495-1928517 CCCATGACCTGCAGGTCCCTAGA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1019609227 7:1928533-1928555 AGACGATCTCAGCTTGGCACAGG No data
1019609216_1019609230 30 Left 1019609216 7:1928495-1928517 CCCATGACCTGCAGGTCCCTAGA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1019609230 7:1928548-1928570 GGCACAGGACTGGGCCAAACAGG 0: 1
1: 0
2: 1
3: 11
4: 179
1019609216_1019609226 9 Left 1019609216 7:1928495-1928517 CCCATGACCTGCAGGTCCCTAGA 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1019609226 7:1928527-1928549 CCAGGCAGACGATCTCAGCTTGG 0: 1
1: 0
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019609216 Original CRISPR TCTAGGGACCTGCAGGTCAT GGG (reversed) Intronic
900616009 1:3565966-3565988 TCTATGAACCTGCAGGGCAGTGG - Intronic
901228210 1:7626867-7626889 TCCAGGGTCCTGCAAGTCAGGGG - Intronic
902271784 1:15310076-15310098 TCTCGAGACCTGCAGATGATAGG + Intronic
903269493 1:22178561-22178583 CCTGGGGACCTGCATGACATAGG - Intergenic
903579691 1:24361553-24361575 TCTAAAGACCTGCTGGTCTTGGG - Intronic
904914882 1:33962598-33962620 CCTGGGGCCCTGCAGGCCATTGG - Intronic
905380647 1:37559273-37559295 GCTAGGGACCTTCAAGTCAACGG + Intronic
912594814 1:110864163-110864185 TCTCAGTACCTGCAGGTCACAGG - Intergenic
912876639 1:113366517-113366539 TTGAGTGATCTGCAGGTCATTGG + Intergenic
914505175 1:148282264-148282286 TGGAGGGACCTGCTGGCCATGGG + Intergenic
914507390 1:148301884-148301906 TGGAGGGACCTGCTGGCCATGGG - Intergenic
922049854 1:221978399-221978421 TCTGAGGACCTGAGGGTCATAGG + Intergenic
924372240 1:243363145-243363167 ACAAGGAAGCTGCAGGTCATAGG - Intronic
1066183631 10:32987446-32987468 TCTAGTGACCTGCAGATTTTTGG + Intronic
1067208089 10:44236658-44236680 TCTAGGGACCTGCTGTCCAATGG + Intergenic
1070815802 10:79322513-79322535 TCTTGGGATCTGCAGACCATGGG - Intergenic
1070890228 10:79937574-79937596 TTTAGGGACAGGAAGGTCATTGG + Intergenic
1070963364 10:80514711-80514733 TTTAGGGACCTGCATTTCACAGG + Intronic
1077961534 11:7081071-7081093 TCTAGGGGCCAGCATGTCTTTGG + Intergenic
1078666946 11:13333657-13333679 GCTAGGGAACTGCCTGTCATGGG - Intronic
1079094730 11:17502925-17502947 TCTAGGGACCTGCATGCTGTGGG - Intronic
1079809458 11:24978751-24978773 TCTAAGTACCTGTGGGTCATAGG + Intronic
1083455252 11:62774456-62774478 TGTAGGGACCTGGACGTCACTGG + Intronic
1083536266 11:63469309-63469331 TCCAAAGACCTGCAGGTCACAGG - Intronic
1083748278 11:64746800-64746822 TCTTGGGTTCTGCAGGTCAAAGG + Exonic
1084303226 11:68264810-68264832 TTCAGGGACCTGCAGTCCATGGG + Intronic
1085945993 11:81274115-81274137 TCTAGGAATCTGCACATCATAGG + Intergenic
1086930623 11:92689138-92689160 TCTAGGCAGCTGCATGTCCTTGG - Intronic
1089589578 11:119531789-119531811 TCTTGGCACCTGCAGGTCTGGGG + Intergenic
1089679896 11:120113482-120113504 TATTGGGATCTGCAGGGCATGGG - Intronic
1090985910 11:131766002-131766024 TCTAGGGACCTGAATATAATGGG + Intronic
1091957633 12:4660792-4660814 TCTACTGACATGGAGGTCATTGG + Intronic
1096110941 12:49028909-49028931 TCCAGGGACCTCCAGGCCAAGGG + Exonic
1096201325 12:49685548-49685570 TTTAGGGACCTCCAGGTACTGGG - Intronic
1101142534 12:101811136-101811158 TCTCTGGATGTGCAGGTCATTGG - Intronic
1101575338 12:105992126-105992148 TCTATGGATGTGCAGGTCATGGG + Intergenic
1103745324 12:123119006-123119028 TTTAGTCACCTGCAGGTCAGGGG + Intronic
1112815951 13:103273672-103273694 TCCAGTGACCTGCAGATGATTGG + Intergenic
1113579734 13:111420603-111420625 TCTAGGGGACTTCAGGGCATGGG - Intergenic
1115274627 14:31593577-31593599 TCTAGGTATCTGCAGGGCATTGG - Intronic
1115901059 14:38148659-38148681 GCAAGGGACTTCCAGGTCATAGG - Intergenic
1116722838 14:48522967-48522989 TCCTGGGATCTGCAGGTAATGGG - Intergenic
1119766974 14:77196324-77196346 GCTAGAGAGCTGCAGGCCATGGG - Intronic
1132862424 16:2078185-2078207 GCTAGGATCCTGCAGGGCATGGG + Intronic
1133215335 16:4288692-4288714 TGTAGGGATCTGCAGGGCCTCGG - Intergenic
1134513087 16:14864513-14864535 TCTAGCGCCCTGTAGGTCAGGGG + Intronic
1134700724 16:16263002-16263024 TCTAGCGCCCTGTAGGTCAGGGG + Intronic
1134971101 16:18531657-18531679 TCTAGCGCCCTGTAGGTCAGGGG - Intronic
1135399521 16:22156557-22156579 TCTGGGGACCTGCAGATCCTGGG - Exonic
1139922884 16:70470843-70470865 TCTAGGGTGCTGCAGGGCAGGGG + Intronic
1141608179 16:85167450-85167472 GCTGGGGACATGCAGGTCAGCGG - Intergenic
1149043636 17:52219685-52219707 TCCAGTAAACTGCAGGTCATTGG - Intergenic
1152238324 17:79149742-79149764 TAAACGGACCTGCAGGTCCTGGG + Intronic
1152242620 17:79168187-79168209 TTTAGGGCCCTGCCGGTCAGGGG - Intronic
1153905198 18:9654861-9654883 GCAAGGGGCCTGCATGTCATTGG - Intergenic
1155208198 18:23578628-23578650 TCTAGGGAGGTGCAGGTGAAGGG - Intronic
1155300836 18:24427164-24427186 TCTCGGGACCTGCAGGGTCTGGG - Intronic
1159993874 18:74942639-74942661 TATAGGGACCTGCTGGTCCACGG + Intronic
1159995874 18:74963387-74963409 TCACTGGACCTGCAGGTTATCGG + Intronic
1162295484 19:9810744-9810766 CCTAGGGACCTCCAGACCATTGG - Exonic
1163581802 19:18143907-18143929 TCTTGGGGCCTGCAGGGCCTGGG - Exonic
1164309482 19:24033555-24033577 TCTCCGGACCTGCAGATCACAGG - Intronic
1164541850 19:29127414-29127436 TCTGGTGACCTGAAGTTCATGGG - Intergenic
1164855628 19:31518392-31518414 TCCAGGCTCCTGCAGGCCATGGG - Intergenic
1165752289 19:38267684-38267706 TCTTGGGACCTAGAGGTCAGAGG + Intronic
1166849560 19:45752841-45752863 TCTGGGGACAGGCAAGTCATTGG - Intronic
1168083824 19:54030179-54030201 TCAAGGGAACTGCAGGTGAGAGG + Intergenic
1168397532 19:56061712-56061734 GCTAGAGACCTTCAAGTCATAGG + Exonic
927217556 2:20676659-20676681 GGTGGGTACCTGCAGGTCATGGG - Intergenic
928094815 2:28397973-28397995 TCTAGAGGCCTGCAGGACACAGG - Intronic
934685899 2:96321521-96321543 TCTAGGGACCGGTAGCTCAGAGG + Intergenic
936150087 2:110012644-110012666 TCTATGGACCAGCAGGTATTGGG - Intergenic
936194588 2:110358726-110358748 TCTATGGACCAGCAGGTATTGGG + Intergenic
937000705 2:118464643-118464665 CCCAGAGACCTGCAGGTCATAGG - Intergenic
937770091 2:125710650-125710672 TCTTGGCTCCTGCAGGCCATCGG - Intergenic
937880415 2:126860154-126860176 TCCAGGGACATGCAGCTCTTGGG + Intergenic
939000911 2:136733099-136733121 TCTAGCAACATGGAGGTCATTGG - Intergenic
945178528 2:207067741-207067763 TCTGGGGTGCTGCAGGTCAGAGG + Intergenic
949073246 2:242039294-242039316 TCTGGGCACCTGCAGGCCCTGGG - Intergenic
1172311736 20:33923603-33923625 TCTAGCAACATGGAGGTCATTGG + Intergenic
1172706243 20:36884196-36884218 TGTAGGGACTTGTAGATCATTGG - Intronic
1174357958 20:50010596-50010618 GCTGGGCACCTGCAGGTCCTGGG - Intergenic
1179026190 21:37680734-37680756 TCCAGGAAACTGCAGGTCTTGGG + Intronic
1179469787 21:41602835-41602857 TCTAGGGAGATGCAGGGAATTGG + Intergenic
1179547385 21:42121963-42121985 TGCAGGGACCTGCAGGAGATGGG + Intronic
1183477186 22:38042206-38042228 TCCTGGTCCCTGCAGGTCATGGG + Intergenic
1183527866 22:38334716-38334738 TCTGGAGGCCTGGAGGTCATTGG + Intronic
1185108163 22:48885798-48885820 TCCAGGGAGCAGCAGGTCCTGGG - Intergenic
954863485 3:53709724-53709746 TCTCGTGACCTGGTGGTCATGGG + Intronic
955926632 3:64012566-64012588 TGTAGGGCCTTGTAGGTCATGGG - Intronic
962744140 3:138384945-138384967 TTTAGTGACATGGAGGTCATTGG + Intronic
962949285 3:140203246-140203268 TGTAGCAACCTGGAGGTCATGGG + Intronic
965512964 3:169589467-169589489 TATAGGTAACTGCAGGTCCTAGG + Intronic
968351458 3:198057225-198057247 TCTAGGGACTTGAAGGCCGTTGG - Intergenic
968883115 4:3311299-3311321 TCTCTGTACCTGCAGGTCTTGGG + Intronic
971311244 4:25527486-25527508 TCTTGGGACTTACAGGTTATAGG - Intergenic
979929832 4:126617039-126617061 GGAAGGGACCTGCAGGTAATGGG - Intergenic
980329782 4:131395757-131395779 AGTAGGGTCTTGCAGGTCATAGG - Intergenic
983024444 4:162715705-162715727 AGTGGGGACCTCCAGGTCATAGG - Intergenic
983685539 4:170404051-170404073 TGTAGGGACCTGGATGTGATTGG + Intergenic
984689324 4:182707713-182707735 ACCAAGGACCCGCAGGTCATAGG + Intronic
986130129 5:4922510-4922532 TCATGGGACTTGCAGGTCAGAGG - Intergenic
987301255 5:16599958-16599980 TCCTGGGACCTGCAGCTCAGGGG - Intronic
987641382 5:20616235-20616257 TCTAGGGCTTTGGAGGTCATTGG - Intergenic
990185004 5:53202663-53202685 TCAGGGGCCCTGCAGGCCATGGG + Intergenic
992888040 5:81178614-81178636 TATAGGGACATGAAGGTTATTGG + Intronic
998953808 5:147417698-147417720 TCTAGGGAGTTGCATGCCATTGG - Intronic
1000871732 5:166585298-166585320 TCTTGTGACCTGCATCTCATGGG - Intergenic
1001225709 5:169943054-169943076 TGGAGGAACCTGCAGGTCTTTGG + Intronic
1002853319 6:1015896-1015918 TGCAGGGCCCTCCAGGTCATGGG + Intergenic
1004947467 6:20631398-20631420 TCTAGGGAGGAGCAGGTCAGGGG - Intronic
1004955380 6:20723048-20723070 TCTGGGTACCTGCAGTTGATGGG - Intronic
1005798572 6:29394049-29394071 TCTAGAGATCTGCAGCTCATTGG + Intronic
1014809356 6:125868677-125868699 TATAGGGACATGCCTGTCATTGG + Intronic
1015701520 6:136040375-136040397 TCTATGCAGCAGCAGGTCATAGG + Intronic
1017801480 6:157900067-157900089 ACTAGGGAGATGCAGGTCAAAGG - Intronic
1019488662 7:1301004-1301026 TCTAGGGAGCCGCAGGGCAGAGG - Intergenic
1019609124 7:1928123-1928145 TCTAGGGACCGGCGGGTCGTGGG - Intronic
1019609172 7:1928309-1928331 TCTAGGGACCGGCGGGTCGTCGG - Intronic
1019609200 7:1928432-1928454 TCTAGGGACCGGTGGGTCGTGGG - Intronic
1019609216 7:1928495-1928517 TCTAGGGACCTGCAGGTCATGGG - Intronic
1022168491 7:27797888-27797910 TCTAGGTACGTGCAATTCATTGG - Intronic
1023935668 7:44738116-44738138 GCCAGGGGCCTGCTGGTCATGGG + Intergenic
1026485046 7:70810817-70810839 TCTAGGGACCTTCTGTTTATTGG - Intergenic
1027716799 7:81681900-81681922 TCTAGAGAACTGCAAGCCATTGG + Intergenic
1029803738 7:102975887-102975909 TCAGGGGCCCTGCAGGCCATGGG + Intronic
1034109916 7:148527039-148527061 TGCAGGGACTTCCAGGTCATGGG - Intergenic
1037762167 8:21748856-21748878 TCTGGGGAGCTGCAGGTGTTGGG - Intronic
1042484726 8:69337152-69337174 TCTGGGCACCTGCAGGCCCTGGG - Intergenic
1044598551 8:93981332-93981354 ACCCGGGAGCTGCAGGTCATCGG - Intergenic
1048287666 8:133154371-133154393 TCTAGGGACCTTATGGTCTTGGG + Intergenic
1049700503 8:144009266-144009288 TTTAGGGACTTGGAAGTCATTGG - Intronic
1050235858 9:3579322-3579344 TCCAGGGTCCTGCAAGTGATGGG + Intergenic
1050422409 9:5479587-5479609 TCTAGGGCACTGAAGGTCTTTGG + Intergenic
1052119333 9:24691687-24691709 TCTAGGGTCCTGCAAATGATAGG + Intergenic
1055751580 9:79512495-79512517 TCCCAGGACCTGCAGGTCTTGGG - Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1057058871 9:91985410-91985432 TTCAGGGACCTGCTGGGCATGGG - Intergenic
1058946651 9:109863506-109863528 TATAGGGATCTGCAGCTCAAAGG + Intronic
1060834266 9:126743224-126743246 GCTAGGGAAGTGAAGGTCATGGG + Intergenic
1185793489 X:2945312-2945334 TCTGGGCAGCAGCAGGTCATGGG + Intronic
1187409203 X:19033994-19034016 TATCGGGACCTTCAGGTGATAGG + Intronic
1193500417 X:82267152-82267174 TCTTGGGAACTGAAGGTCCTTGG - Intergenic
1193789578 X:85801471-85801493 TCCCAGTACCTGCAGGTCATAGG + Intergenic
1195585968 X:106566014-106566036 TCTACAGTCCTGCAGGTCACAGG - Intergenic
1196103785 X:111874498-111874520 TCTAGGGACCAGCATGTGGTGGG + Intronic
1197893001 X:131284536-131284558 TCTAGAAACCTCCAGGCCATGGG + Intronic