ID: 1019610702

View in Genome Browser
Species Human (GRCh38)
Location 7:1935363-1935385
Sequence CATCAGCTCGCCCCTCAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019610693_1019610702 18 Left 1019610693 7:1935322-1935344 CCCTTGTGCAGGTGGGGAGCTGG 0: 1
1: 0
2: 2
3: 44
4: 335
Right 1019610702 7:1935363-1935385 CATCAGCTCGCCCCTCAATCTGG 0: 1
1: 0
2: 0
3: 4
4: 53
1019610695_1019610702 17 Left 1019610695 7:1935323-1935345 CCTTGTGCAGGTGGGGAGCTGGA 0: 1
1: 0
2: 3
3: 41
4: 308
Right 1019610702 7:1935363-1935385 CATCAGCTCGCCCCTCAATCTGG 0: 1
1: 0
2: 0
3: 4
4: 53
1019610689_1019610702 28 Left 1019610689 7:1935312-1935334 CCGGGAGCAGCCCTTGTGCAGGT 0: 1
1: 0
2: 0
3: 12
4: 202
Right 1019610702 7:1935363-1935385 CATCAGCTCGCCCCTCAATCTGG 0: 1
1: 0
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019610702 Original CRISPR CATCAGCTCGCCCCTCAATC TGG Intronic
903084808 1:20846414-20846436 CATAACCTCGCCCTTCCATCTGG + Intronic
908648627 1:66307630-66307652 CCTCAGCAAGGCCCTCAATCTGG - Intronic
924551298 1:245080499-245080521 CCTCAGCTGGTCCCTCACTCAGG + Intronic
1064273985 10:13890504-13890526 CAGCAGCTGAACCCTCAATCAGG + Intronic
1068756482 10:60660349-60660371 CAGCATCTCTCCCCTCAATCAGG + Intronic
1069883905 10:71611271-71611293 CCTCTGCTCCCCCCTCATTCAGG - Intronic
1074907335 10:117876582-117876604 AATCAGCTTCCCCCTAAATCTGG + Intergenic
1077374779 11:2200366-2200388 CATCTGCTGGCCCCTTGATCTGG - Intergenic
1081128192 11:39344356-39344378 CATCAGCTCCTTCTTCAATCTGG - Intergenic
1083669273 11:64291405-64291427 CATCAGCTGGCCCGTCTCTCCGG - Intronic
1083891776 11:65599265-65599287 CATCAGCTGGACCCTGAACCAGG - Intronic
1087393967 11:97573324-97573346 CTTCAGCTGGCCCCTCCATTCGG - Intergenic
1088765603 11:112972941-112972963 CATCACCTCTCCCCTCCCTCTGG - Intronic
1091871343 12:3893711-3893733 CATCAGCTCTCCTCTCTATACGG + Intergenic
1097871962 12:64609976-64609998 CAGCAGCTCGCCCCTCCAGGAGG - Intergenic
1119423615 14:74522486-74522508 GATCAGCCCACCCCTCAAACTGG - Intronic
1125500971 15:40240158-40240180 CATCAGCTGCCCCTTCATTCTGG + Intronic
1127931110 15:63598090-63598112 AATCAGCTCACCCCTCCATTAGG + Intronic
1131589636 15:93734615-93734637 CATCAGCTGGTCCCTCCATTTGG - Intergenic
1134406631 16:13965210-13965232 CTTCAGCTGGTCCCTCCATCTGG + Intergenic
1138016420 16:53433048-53433070 CCTCAGATTGCTCCTCAATCTGG + Intergenic
1144384922 17:14740597-14740619 CCTCAGCTGGCCCCTCACACAGG - Intergenic
1149775785 17:59355918-59355940 CCTCAGCTCTCCCCACAGTCAGG - Intronic
1157425326 18:47579725-47579747 CATTAGCTCACCCCTAAATGAGG - Intergenic
1158035543 18:53025101-53025123 CATGAGCTTGCCCTTAAATCTGG + Intronic
1165914633 19:39250223-39250245 CATGAGCTCGCCCAGCAATAAGG + Intergenic
928604097 2:32928112-32928134 CATCTGCTCACCCTTCAATGAGG - Intergenic
945312057 2:208325484-208325506 CATGCCCTCGTCCCTCAATCAGG - Exonic
947316693 2:228866492-228866514 CATGAGCTCCCCCCTCCAGCTGG - Intronic
947969241 2:234308134-234308156 CATCAGCAAGGCCCTCACTCAGG - Intergenic
1168827677 20:824745-824767 AATCAGCTGGCACCTCCATCTGG + Intergenic
1173790163 20:45823184-45823206 CCTCGGCTCTCCCCTCATTCAGG + Intergenic
1174681199 20:52410445-52410467 TATCAGCTCGCCTGTAAATCAGG + Intergenic
1179250745 21:39669455-39669477 CCTCAGCTTGACCCTCATTCAGG - Exonic
1180231067 21:46426965-46426987 CCTCCGCTCGCCCCTCCAGCAGG + Intronic
1182535748 22:31001567-31001589 CATCAGCTAGCTCCTGAATGGGG + Intergenic
1183436349 22:37797830-37797852 CAGCAGATGGCCCCTCACTCAGG - Intergenic
1184722092 22:46320797-46320819 CATCAGCTCTTCCCTAAACCTGG - Intronic
954107421 3:48416739-48416761 CAGCAGCTCGCCCCACAACCAGG - Intronic
958616500 3:96499775-96499797 CATCTGCTCACCCTTGAATCTGG + Intergenic
962376884 3:134866067-134866089 CCTCTGCTCACCCCTCACTCTGG - Intronic
968739582 4:2320700-2320722 CCTCAGCTCGCACCTCCAGCTGG - Intronic
981268134 4:142811787-142811809 CATCAGCTCCCCACTCCATGAGG + Intronic
999799196 5:155017574-155017596 CATCATCTCTACCCCCAATCTGG + Exonic
1002182653 5:177438997-177439019 CATCAGCTCGCCCCTGAGGCTGG + Intronic
1002332778 5:178455807-178455829 CCTCAGCTCGCCCGCCCATCAGG + Intronic
1004302920 6:14474845-14474867 CATCAACTCCCCCTTCCATCAGG - Intergenic
1005535301 6:26749355-26749377 GAGAAGCTCGGCCCTCAATCTGG - Intergenic
1019610702 7:1935363-1935385 CATCAGCTCGCCCCTCAATCTGG + Intronic
1027057335 7:75058728-75058750 CACCAGCTCGCCCACCAAGCTGG - Exonic
1029651677 7:101897473-101897495 CAACATCTCGCCCTTCACTCAGG - Intronic
1031739538 7:125412234-125412256 CATTAGCTCAGCCCTCATTCAGG - Intergenic
1036750116 8:11438338-11438360 CATCAGCTCTCACATCAAACAGG + Intronic
1048819740 8:138369729-138369751 CATTTGCTTGCCCCTCCATCCGG - Intronic
1056143461 9:83707279-83707301 CATCAGCCCGTCCCACAAACAGG + Intronic
1057128827 9:92639412-92639434 CATCAGCTCTCCCGCCGATCTGG - Intronic
1058673321 9:107379334-107379356 CTTCAAGTCACCCCTCAATCTGG - Intergenic
1187919046 X:24183149-24183171 CCTCAGCTGGCCCCTCAATGCGG - Intronic