ID: 1019610798

View in Genome Browser
Species Human (GRCh38)
Location 7:1935806-1935828
Sequence GGCTCATCTGTGGTGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 272}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019610798_1019610818 28 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610818 7:1935857-1935879 CAGCCGGGTGGCTCTAACACAGG 0: 1
1: 0
2: 0
3: 8
4: 84
1019610798_1019610804 -5 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610804 7:1935824-1935846 GAGCCTGCAGACACCCCCAAGGG 0: 1
1: 0
2: 1
3: 19
4: 160
1019610798_1019610816 13 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610816 7:1935842-1935864 AAGGGAGGGGGCTGGCAGCCGGG 0: 1
1: 0
2: 11
3: 81
4: 719
1019610798_1019610817 16 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610817 7:1935845-1935867 GGAGGGGGCTGGCAGCCGGGTGG 0: 1
1: 0
2: 11
3: 92
4: 1043
1019610798_1019610810 5 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610810 7:1935834-1935856 ACACCCCCAAGGGAGGGGGCTGG No data
1019610798_1019610815 12 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610815 7:1935841-1935863 CAAGGGAGGGGGCTGGCAGCCGG 0: 1
1: 0
2: 10
3: 100
4: 2039
1019610798_1019610808 0 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610808 7:1935829-1935851 TGCAGACACCCCCAAGGGAGGGG 0: 1
1: 0
2: 1
3: 31
4: 202
1019610798_1019610806 -2 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610806 7:1935827-1935849 CCTGCAGACACCCCCAAGGGAGG No data
1019610798_1019610803 -6 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610803 7:1935823-1935845 TGAGCCTGCAGACACCCCCAAGG 0: 1
1: 0
2: 2
3: 15
4: 201
1019610798_1019610807 -1 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610807 7:1935828-1935850 CTGCAGACACCCCCAAGGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 233
1019610798_1019610809 1 Left 1019610798 7:1935806-1935828 CCAGGCCCCACCACAGATGAGCC 0: 1
1: 0
2: 3
3: 28
4: 272
Right 1019610809 7:1935830-1935852 GCAGACACCCCCAAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019610798 Original CRISPR GGCTCATCTGTGGTGGGGCC TGG (reversed) Intronic
900075339 1:811582-811604 TGCCCATAGGTGGTGGGGCCAGG + Intergenic
900653712 1:3744706-3744728 GGCTCACCTTTGGTGTGTCCAGG - Intergenic
900931615 1:5741706-5741728 GGCTCATCTGGGGAAGGGGCTGG - Intergenic
901640446 1:10690495-10690517 GCCTCAACTGTGGGGAGGCCAGG - Intronic
902168563 1:14592503-14592525 GGTTGATCAGGGGTGGGGCCTGG + Intergenic
902393415 1:16119173-16119195 GGCAACTCTGTGGTGGGGGCAGG + Intergenic
902521548 1:17020605-17020627 GCATCTTCAGTGGTGGGGCCTGG - Intronic
903156678 1:21449318-21449340 GGTTCATCTGTGCTGGTGACTGG + Intronic
904132130 1:28282840-28282862 GGCTAATCGGTGGGGGAGCCAGG + Intergenic
904181594 1:28669596-28669618 CGCTCATCTGTGGGGAGACCTGG - Intronic
905243275 1:36595257-36595279 CGCTCTTCTGTAGTGGGGCTGGG + Intergenic
906105006 1:43286323-43286345 CGCTCTCCTGGGGTGGGGCCAGG + Intergenic
907240192 1:53076988-53077010 GGACCACCTGTGGTGGGGCACGG + Intronic
908409819 1:63852219-63852241 AGCTCATCAGTGGTGCTGCCTGG + Intronic
908480666 1:64535825-64535847 GACTCATCTGTGGTGGTGGGGGG + Intronic
909397951 1:75192014-75192036 GGCTCATCAGTGGTGGAGATAGG - Intergenic
909743517 1:79063529-79063551 AGCTCATCTGGTGTGTGGCCTGG - Intergenic
911125176 1:94334636-94334658 GGCTCTTCTCTGGAGGGCCCGGG - Intergenic
912174452 1:107140033-107140055 GGCGCTTCTGTGGAGGAGCCGGG + Intronic
913601339 1:120424303-120424325 GGTTCATCTGTGCTGGTGACTGG + Intergenic
913992895 1:143631349-143631371 GGTTCATCTGTGCTGGTGACTGG - Intergenic
914085706 1:144452292-144452314 GGTTCATCTGTGCTGGTGACTGG - Intronic
914191602 1:145416273-145416295 GGTTCATCTGTGCTGGTGACTGG - Intergenic
914589530 1:149094275-149094297 GGTTCATCTGTGCTGGTGACTGG - Intronic
916210047 1:162353038-162353060 TGCTTGTCTGTGGTGGGGGCGGG - Intronic
916247680 1:162705171-162705193 AGCTCATCTCTGGTGGATCCAGG + Intronic
918244042 1:182643457-182643479 GGCTGTTCTGGGGTGGGACCTGG + Intergenic
918574553 1:186041658-186041680 GGCTCTTCTGTGATGGGATCGGG - Intronic
918727307 1:187942117-187942139 GGCACATCTCAGGTGGGACCCGG - Intergenic
921292395 1:213670734-213670756 TGTTCATCGGTGGTGGGGACAGG + Intergenic
921922307 1:220683584-220683606 AGCTCAGCTGTGGTGGGGCTGGG - Intergenic
922271179 1:224036459-224036481 TGCCCATAGGTGGTGGGGCCAGG + Intergenic
922576741 1:226665868-226665890 GAAGCACCTGTGGTGGGGCCAGG + Intronic
1062934651 10:1376846-1376868 GGCTCAGCTTTGGTGGGGCAGGG + Intronic
1063415670 10:5870783-5870805 GGTTCACCTGTGGTGAAGCCAGG + Intronic
1063978908 10:11438059-11438081 GGCACGTCTGTGGTGGAGCCAGG - Intergenic
1065117651 10:22498033-22498055 GCTCCATCGGTGGTGGGGCCAGG - Intergenic
1067437920 10:46291934-46291956 GCCTCAGCTGTGCTGGGGTCAGG + Intronic
1067756283 10:49008278-49008300 CCCTCTGCTGTGGTGGGGCCAGG - Intergenic
1072784323 10:98269516-98269538 GGCCCAGCTGGGGTGGGGCAGGG - Intergenic
1073287541 10:102397783-102397805 AGCTCATATGTGGCAGGGCCAGG - Intronic
1074428959 10:113376591-113376613 GGCTCATGTGTTGTGGTGACTGG + Intergenic
1074531271 10:114300479-114300501 GGCTCATCTGGGGTGGGACCTGG + Exonic
1074776659 10:116772210-116772232 GGATCATCAGTGCTGGGGCAGGG + Intergenic
1075622750 10:123939801-123939823 GGCACATCTGGGGTGCGCCCAGG - Intronic
1075900564 10:126039809-126039831 GGCAAATCTGTGCTGGGGACTGG - Intronic
1075979138 10:126722221-126722243 GGGTCATGAGTGGTGGGGCAGGG + Intergenic
1076429054 10:130388899-130388921 GTCTCACCTGTGGTGGGGAGAGG - Intergenic
1076603472 10:131674348-131674370 AGCTCATGTGTGGTGGAGCCAGG - Intergenic
1076664236 10:132077013-132077035 GGCTGGTCTGTGGTGGCCCCAGG + Intergenic
1077196884 11:1285380-1285402 GGCCCATCCATGGTGGGGGCCGG + Intronic
1077216915 11:1398802-1398824 TGCTCATCTGTGATGGGGCCTGG + Intronic
1077230825 11:1457506-1457528 GGCCCATGTGTGGTGGGGGCAGG + Intronic
1078010681 11:7570785-7570807 GGCTCATGAGTGGTAGAGCCAGG - Intronic
1081107018 11:39083283-39083305 GGCTGTTCTCTGCTGGGGCCTGG - Intergenic
1081620306 11:44615367-44615389 GGCTCAGGTGAGGTGGGGCGGGG + Exonic
1081672018 11:44947720-44947742 AGCTCATCAGTGGTAGAGCCAGG - Intronic
1082794581 11:57370032-57370054 GGGTCCTCTGTGGGGAGGCCTGG - Exonic
1085053180 11:73390159-73390181 TGCCCAGCTGTGATGGGGCCAGG + Intronic
1087822249 11:102725676-102725698 GTTTCATTTGTGGAGGGGCCAGG + Intronic
1089289357 11:117428506-117428528 GGCTCAGCAGGGGTGGGGCCGGG + Exonic
1091782406 12:3222277-3222299 GCCTCATCTGTGACGGAGCCAGG - Intronic
1091858385 12:3757025-3757047 GCCTCCTCTGGGGTGGGGCAGGG + Intronic
1092262317 12:6959349-6959371 GGCTCAGCTGAGGGTGGGCCTGG + Intronic
1096082886 12:48844567-48844589 GGTTCATCTGTGGCCGGGCGCGG - Intronic
1096615018 12:52827289-52827311 GTCTCAGCTCTTGTGGGGCCAGG - Intronic
1097878602 12:64667063-64667085 GGCTCAGCTGGGCTGGGGGCAGG + Intronic
1103322370 12:120099666-120099688 GGCTCATCTGTGCAGGTGGCAGG + Intronic
1104946053 12:132415314-132415336 GGCTCAAGGCTGGTGGGGCCAGG + Intergenic
1104958549 12:132477433-132477455 GCCTCAGCTGTGGTGGGGGAGGG - Intergenic
1106469046 13:30038615-30038637 GAATCATCTGTGATGGGTCCAGG - Intergenic
1106583772 13:31039240-31039262 TGTGCCTCTGTGGTGGGGCCTGG + Intergenic
1111709280 13:91791248-91791270 GGCTCATATTGGGTGGTGCCAGG + Intronic
1111959022 13:94789396-94789418 GGCTAAGAAGTGGTGGGGCCAGG - Intergenic
1112362018 13:98727014-98727036 TTCTTATCTGAGGTGGGGCCTGG + Intronic
1112845801 13:103641836-103641858 GGCTCATCAGTGGCAGAGCCAGG + Intergenic
1113357513 13:109596268-109596290 GGTTCATCTGTGTTAGGGCATGG + Intergenic
1113812272 13:113150005-113150027 GCCTGAGCTGGGGTGGGGCCTGG - Intergenic
1114658234 14:24328960-24328982 GGCTCACTGGTGGTGGGGGCAGG + Intronic
1116250824 14:42481262-42481284 GGGTCATCTCTTGTGTGGCCTGG + Intergenic
1116326530 14:43538060-43538082 GGCTCATGTGTGGTGGGATTGGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122036165 14:98950710-98950732 GGCTCACCTGTGAGGGGGGCAGG - Intergenic
1122122379 14:99561401-99561423 GGCTCAGCAGGGGTGGGGCCTGG + Intronic
1122402431 14:101475409-101475431 GGCTGTTCTGTGGGGGGACCTGG - Intergenic
1127850118 15:62904862-62904884 GGCTCCTCTGAGGCGGTGCCAGG + Intergenic
1128061956 15:64740954-64740976 TGGTAATCTGTGGTGGTGCCGGG - Exonic
1128253616 15:66180904-66180926 GGCTCTTCTGTTGTGGGCACAGG - Intronic
1128386615 15:67153734-67153756 GGCTAATCTTTGTTGGGGCTAGG - Intronic
1128665231 15:69532672-69532694 GACTCATCTGTCCTGTGGCCAGG + Intergenic
1129738769 15:77979853-77979875 GGCACAGCTGAGGTGGGGCAGGG + Intergenic
1129769572 15:78194459-78194481 GGCACATCTGGGGAGGGGCAAGG + Intronic
1129847186 15:78773327-78773349 GGCACAGCTGAGGTGGGGCAGGG - Intronic
1130253628 15:82315903-82315925 GGGTCATCTGTGGAAGGGCAAGG - Intergenic
1130254710 15:82320561-82320583 GGCACAGCTGGGGTGGGGCAGGG + Intergenic
1130600263 15:85269445-85269467 GGCACAGCTGGGGTGGGGCAGGG - Intergenic
1132118545 15:99157080-99157102 GGCTCAGCTGTGGTGGTGCTAGG + Intronic
1132665981 16:1081553-1081575 GGCTCAGCGGGGCTGGGGCCGGG - Intergenic
1132675145 16:1118344-1118366 TGCCCACCTGTGGGGGGGCCAGG + Intergenic
1132931602 16:2461614-2461636 GGCTCATCCTTGGTGGGGTCGGG + Intronic
1133017861 16:2952934-2952956 CGCTGAGCTGTGATGGGGCCGGG - Intergenic
1133233008 16:4375138-4375160 GGCTCACTTGAGCTGGGGCCTGG + Intronic
1133704860 16:8344075-8344097 GGTTTATATGTGGTGGTGCCAGG - Intergenic
1134829420 16:17311263-17311285 AGCCCATCTGAGGTGGGGCCTGG - Intronic
1135043548 16:19136209-19136231 GGTTCAGCTCTGCTGGGGCCAGG - Intronic
1135696161 16:24588561-24588583 AGGTCATCTGGGGTGGGGCTAGG - Intergenic
1136316003 16:29455037-29455059 GGGGCGTCTGTGGTGGGGACGGG + Intronic
1136430580 16:30194379-30194401 GGGGCGTCTGTGGTGGGGACGGG + Intronic
1138420981 16:56898923-56898945 GGCTGGTCTGGGGTGAGGCCTGG - Intronic
1141858831 16:86703058-86703080 GGCTCATCTATGTTGGAGCATGG - Intergenic
1141896855 16:86963924-86963946 AGCTGATCTGGGGTGGGGCCGGG - Intergenic
1142745963 17:1958369-1958391 GGCTCATGGGAGGTGGGGACGGG - Intronic
1142755618 17:2014925-2014947 GCCAGAGCTGTGGTGGGGCCAGG + Intronic
1142766029 17:2064857-2064879 GGCTCATCTCTAGTTGGCCCAGG + Intronic
1142809264 17:2387581-2387603 GGCTCAGCTTAGGTGGGCCCAGG + Exonic
1143125632 17:4639649-4639671 GGCTCAGCCCCGGTGGGGCCTGG + Intronic
1143402845 17:6657174-6657196 GGCTCAGCCCCGGTGGGGCCTGG - Intergenic
1143584778 17:7845616-7845638 GCCTGAGCTGTGCTGGGGCCTGG + Exonic
1144288997 17:13807374-13807396 GGCTTTCCTGTGATGGGGCCAGG - Intergenic
1145941501 17:28745458-28745480 GGGTCAGCTGTGGGGGGGTCGGG - Intronic
1146602481 17:34230106-34230128 AGTTCATATGGGGTGGGGCCAGG + Intergenic
1146671364 17:34740413-34740435 GGCTAGTATGTGGTGGGGCCAGG + Intergenic
1149519531 17:57308092-57308114 AGCTAATCAATGGTGGGGCCAGG - Intronic
1149583225 17:57766335-57766357 GGTGCATGTGTGTTGGGGCCAGG + Intergenic
1151170215 17:72239403-72239425 GGCACAGCTGGGGTGGGGTCAGG + Intergenic
1151396709 17:73827624-73827646 GGCCCTTCACTGGTGGGGCCAGG + Intergenic
1151419742 17:73989281-73989303 GGCTCTGCTGGGGTGGGGCAGGG + Intergenic
1151445283 17:74159725-74159747 GGGTCATCTGTGGTGGAGGGGGG - Intergenic
1151498417 17:74473492-74473514 GGCTCATCTGAGGAGGAGCTGGG + Intronic
1151856481 17:76725972-76725994 GGCTCCTCCGGGGTGGGGGCAGG + Intronic
1152588222 17:81198547-81198569 GGCTGCTCAATGGTGGGGCCAGG - Intronic
1154390332 18:13931404-13931426 GGCTCAAGTGGGGTGGGACCTGG + Intergenic
1156394572 18:36687448-36687470 GGCTCAGCAGTGGTGGTGCAGGG - Intronic
1158621160 18:59033650-59033672 GGTAAGTCTGTGGTGGGGCCTGG + Intergenic
1160072850 18:75643483-75643505 GGCTCTTCCTTGGTGGTGCCAGG + Intergenic
1160588296 18:79925229-79925251 GGCTCAGCAGTGCGGGGGCCTGG - Intronic
1160910501 19:1471736-1471758 GTGTCATCCGTGGTGGGGCTGGG - Exonic
1161027693 19:2044229-2044251 GCCACATGTGAGGTGGGGCCTGG - Intronic
1161160463 19:2758823-2758845 GGTGCATGTGTGCTGGGGCCTGG - Intronic
1161161877 19:2766297-2766319 GGTGCATCTGCGCTGGGGCCTGG + Intronic
1161435003 19:4258011-4258033 GGCTGAGCAGTGGTGGAGCCGGG - Intronic
1161850924 19:6737615-6737637 GGCTCATCGGTGGGCGGGCTTGG - Intergenic
1162558422 19:11401968-11401990 GGCTCAGCTGGGGTGGGGCTGGG + Intronic
1162791444 19:13065123-13065145 GGCCCCTCTGTGCTGGGGCAAGG + Intronic
1163032594 19:14554080-14554102 GGCCCATGTGTGGTGGGGTATGG + Intronic
1163678161 19:18665845-18665867 GGCACACCTGGGCTGGGGCCTGG - Intronic
1163863535 19:19754810-19754832 GGCTCATGGGTAGTGGGGCCTGG - Intergenic
1164596344 19:29532988-29533010 AGGTCATCTGTGGCTGGGCCTGG - Intronic
1165324746 19:35107957-35107979 GATTCATCTGTGGCGGGGCCTGG + Intergenic
1166663307 19:44661510-44661532 GTCTGGTCTGTGATGGGGCCAGG + Intronic
1166705641 19:44906513-44906535 GGCTAACCTGGGGTGAGGCCGGG + Intronic
1166916016 19:46196566-46196588 GGCTCAGCTGGGGTCGGGCAGGG - Intergenic
1168289845 19:55352308-55352330 GGCTCATCTAGGGTGTGTCCTGG + Exonic
1168296287 19:55378672-55378694 GGTGCATCTGGGGTGGGGGCGGG - Intergenic
925507858 2:4588905-4588927 GACTCAGCTGTGGTGGGGGAAGG + Intergenic
925738361 2:6983789-6983811 AGCACATCTGTGGTGATGCCAGG - Intronic
926109473 2:10172836-10172858 GGCCCATCTGAGCAGGGGCCCGG + Intronic
926234143 2:11026641-11026663 GGCAGATCTGGGGTGGGGCTTGG + Intergenic
927091413 2:19715476-19715498 GGCCAATCTGTGGTGGGTGCAGG + Intergenic
928173946 2:29021806-29021828 GCCCCATCTGTGGTGGGGTGGGG - Intronic
928198099 2:29229186-29229208 GGCCCATCTTCAGTGGGGCCTGG + Intronic
928291881 2:30046319-30046341 GGCTTCTCTGTGGTGGGAACAGG - Intergenic
929408811 2:41673269-41673291 GGCTCATCTGTGGTAGAGGCAGG - Intergenic
931398054 2:61905644-61905666 GGCTCAGCTGTTGCGGGGCGGGG + Exonic
931691626 2:64838860-64838882 GGCTCTTCTGGGGTGGGGTGGGG - Intergenic
931695987 2:64870949-64870971 GGTTGATCTGAGGTGGGACCAGG + Intergenic
931832343 2:66065816-66065838 GGCTGGTCAGTGGTGGAGCCAGG - Intergenic
932218939 2:69985424-69985446 GGCTCACATGTGATGGGCCCTGG + Intergenic
932494930 2:72141503-72141525 GGCCCAGGTGTGCTGGGGCCTGG - Intronic
933749619 2:85594957-85594979 AACTGATCTGTGGTGGGGCCTGG - Intergenic
933781968 2:85808872-85808894 GGCCCCTCTGTGGTAGGGCAGGG - Intergenic
934941831 2:98508351-98508373 GGCTCCTCTATGGTGGAGGCGGG - Intronic
937226704 2:120374535-120374557 GGCTACTCTGTGCTGGGGACAGG - Intergenic
937842253 2:126535599-126535621 GACTCAACTGTGGCAGGGCCAGG - Intergenic
941407204 2:165105453-165105475 GGCTCCTCTGTGGTGGAAGCAGG - Intronic
941749324 2:169118689-169118711 ACCCCATCTGTGGTGGGGGCTGG + Intergenic
944229132 2:197375929-197375951 GGGGCATCTGTGATTGGGCCAGG - Intergenic
944568247 2:201013686-201013708 GGCCCAGATGTGGTGGGACCTGG - Intronic
946228766 2:218279006-218279028 TGCTCCTCTGTGGTTGGGCAGGG - Intronic
947821996 2:233078573-233078595 GGCCCCTCTGTGGCTGGGCCTGG + Intronic
948724388 2:239922804-239922826 TGCACACCTGTGATGGGGCCGGG - Intronic
948796560 2:240405839-240405861 GCCTCATGTGTGTTGGGGGCGGG - Intergenic
949082383 2:242113213-242113235 TGCCCATAGGTGGTGGGGCCAGG - Intergenic
1168969186 20:1919228-1919250 GGCATTTCTGTGGTGGAGCCTGG - Intronic
1170105506 20:12750799-12750821 GGCTCCTCTCTGGTGGGAGCAGG - Intergenic
1172010991 20:31845496-31845518 GGCTCAGTTGTGGGGGCGCCAGG + Exonic
1172433747 20:34913946-34913968 GGGTCAGCTGAGGTGGGACCAGG - Intronic
1172645746 20:36468265-36468287 GGCCCCTCTCTGGTGGGGGCTGG - Intronic
1172955177 20:38751767-38751789 AGCTGCTCTGGGGTGGGGCCTGG - Intronic
1173653879 20:44685472-44685494 GTCCCAACTCTGGTGGGGCCTGG + Intergenic
1175531382 20:59675816-59675838 GGGTCAGCTGGGGAGGGGCCTGG - Intronic
1177305594 21:19311136-19311158 GGCTCTCCTGTGGTGGGGTGTGG + Intergenic
1178586319 21:33874207-33874229 GGGTGGTCTGTGGTGGGGCAGGG + Intronic
1179561344 21:42218162-42218184 GGCTCATCTGAGGTGTGGTTGGG + Intronic
1179767616 21:43584821-43584843 TGCTCACCTGAGGTGGGACCGGG + Intronic
1179948849 21:44698391-44698413 GACTAATGTGTGTTGGGGCCTGG - Intronic
1179951719 21:44712121-44712143 GGCTCTGCTGTGGTGGGGAGGGG + Intergenic
1180960382 22:19759725-19759747 GCCTCAGCTGCTGTGGGGCCCGG + Intronic
1180971713 22:19819404-19819426 AGCTCATCTGAGGAGGGGCCTGG + Intronic
1182074828 22:27488384-27488406 GGCTCACCTGGGTGGGGGCCGGG + Intergenic
1183217354 22:36489657-36489679 GGCCCATCTGAGGAGGGGCTTGG + Exonic
1183403583 22:37618929-37618951 TGCTCTTGTGTGGTGGGGACAGG - Intronic
1184033437 22:41907722-41907744 GGGTCACCTGGGGTGGGACCTGG + Intergenic
1184114817 22:42416351-42416373 AGATCATGAGTGGTGGGGCCAGG + Intronic
1185275326 22:49948146-49948168 GGCTCAGCTGCAGTGGGCCCAGG - Intergenic
949954553 3:9256944-9256966 AGCTTATCAGTGGTGGAGCCAGG - Intronic
950097163 3:10337083-10337105 GGCACAGCTGGGGTGGGGACTGG - Intronic
950423316 3:12911181-12911203 GGCTCAACTGCTGTGTGGCCTGG - Intronic
950653510 3:14422552-14422574 GGCCAAGCTGGGGTGGGGCCTGG - Intronic
952303694 3:32126821-32126843 GGCACTTCTGTGGTGGGATCAGG - Intronic
953205795 3:40827791-40827813 AGCTAATGAGTGGTGGGGCCAGG + Intergenic
955110797 3:55947647-55947669 TGCACATCTGTCGTGGTGCCTGG - Intronic
955254063 3:57311600-57311622 GTCACAACTGTGGTGGGGGCTGG + Intronic
956794692 3:72707088-72707110 GGCTCAGCTGCAGAGGGGCCTGG - Intergenic
961430025 3:126874890-126874912 GGAGCATGTGAGGTGGGGCCAGG - Intronic
961531752 3:127544355-127544377 GGCTCAACTGTCCTGAGGCCGGG + Intergenic
962903416 3:139780339-139780361 GGCTCAGATGGGGTGGGGGCTGG - Intergenic
962918969 3:139934832-139934854 GGGTCATCTGGGGTGGCGCGAGG - Intergenic
963914180 3:150842375-150842397 GGCGCTTCTGTGGTGGAGCATGG - Intergenic
967254619 3:187577008-187577030 TGCACATCTGCGCTGGGGCCTGG + Intergenic
967871292 3:194231983-194232005 GACTCATCTGTGTTGCAGCCGGG - Intergenic
968736393 4:2298946-2298968 TGCTCCTCTGTGGTGGGGCCGGG - Intronic
969048919 4:4358785-4358807 GGCTCATCTGGGCTGAGGCTGGG - Intronic
969423520 4:7110743-7110765 GGCACCACTGTGGAGGGGCCTGG + Intergenic
969612919 4:8237041-8237063 CGCGCATCTGTGGGGGGACCTGG + Intronic
974989020 4:69062171-69062193 AACTCATCTGAGGTGGGACCAGG + Intronic
977313294 4:95413380-95413402 GGCCCACCCATGGTGGGGCCTGG + Intronic
981944976 4:150330879-150330901 GGCTCATCTATGGTTGGACTGGG + Intronic
983392525 4:167151131-167151153 AGCTCATCTTGGGTGTGGCCTGG - Intronic
985608743 5:873955-873977 GGCTTGTCTGGGGTGGGTCCAGG - Intronic
990241959 5:53824930-53824952 GGGGCATCTGAGTTGGGGCCAGG + Intergenic
996313813 5:122138412-122138434 GTCTCATTGGTGGTGAGGCCAGG - Intronic
996449863 5:123608772-123608794 AGTTGGTCTGTGGTGGGGCCTGG + Intronic
999210312 5:149882444-149882466 GGCTCCTCTGTGATGGGTCCTGG - Intronic
1000303149 5:159973131-159973153 GGCTCTTCTGGGGTGGAGACTGG - Intergenic
1000386823 5:160682503-160682525 GACTCATCTGTGCTGGGAGCTGG - Intronic
1002171883 5:177379278-177379300 GCCTGCTCTGTGCTGGGGCCAGG + Intronic
1002926201 6:1606994-1607016 TGCTTTTCTATGGTGGGGCCAGG + Intergenic
1004390605 6:15206500-15206522 GGCTCTTCTGTGGGGGTACCAGG - Intergenic
1004698018 6:18052123-18052145 TGGTCATCTGAGGTGGTGCCTGG - Intergenic
1004851878 6:19707865-19707887 GGCTCATTTTTTGTGGGGTCTGG - Intergenic
1005882537 6:30072056-30072078 GCATCATCTGGGGTGGGGCATGG + Intronic
1006867313 6:37219317-37219339 GATTGGTCTGTGGTGGGGCCTGG - Intronic
1007175351 6:39892606-39892628 GGCTCATTTGTGGGGAGGACAGG + Intronic
1007737833 6:43992947-43992969 AGCACATGGGTGGTGGGGCCAGG - Intergenic
1008102118 6:47402738-47402760 TGCTGATCTGTAGTGAGGCCAGG - Intergenic
1012987005 6:105885750-105885772 AGCTGATTTGTGGTGGGGCCTGG + Intergenic
1018109790 6:160524028-160524050 GGCTCTGCTCTGGTGTGGCCTGG + Intergenic
1019217439 6:170452743-170452765 GGCTCTTCCTTGATGGGGCCTGG + Intergenic
1019437791 7:1030861-1030883 TGCTGCTCTGTGTTGGGGCCCGG - Intronic
1019491846 7:1317885-1317907 GGCTGAGCTGAGGAGGGGCCTGG - Intergenic
1019610798 7:1935806-1935828 GGCTCATCTGTGGTGGGGCCTGG - Intronic
1019933682 7:4240573-4240595 GGCTCCTCTCTGCTGGGACCTGG - Intronic
1020256191 7:6504152-6504174 GGCTAAACTGAGGCGGGGCCCGG + Intronic
1020403596 7:7805257-7805279 GGCTCCAGGGTGGTGGGGCCAGG - Intronic
1022014285 7:26335611-26335633 GACACATCTGTGGTGGTGCCAGG - Intronic
1023256968 7:38322254-38322276 GCCTCATCTGTAGTGGGACCGGG + Intergenic
1023532768 7:41175570-41175592 GGCGGAGCAGTGGTGGGGCCAGG - Intergenic
1024303649 7:47907705-47907727 GGCACATCTGAGGTGGGAGCTGG - Intronic
1025610688 7:63073376-63073398 GGCTCAGCTGTGGTGGGAGGGGG + Intergenic
1026458196 7:70591164-70591186 GACCCATCTGGGGTGGGGGCAGG - Intronic
1028563714 7:92204768-92204790 TGCTCATCTGCTGTGCGGCCCGG + Intronic
1032943645 7:136824864-136824886 CGCTGAGCTGGGGTGGGGCCTGG - Intergenic
1035540305 8:429939-429961 TGCCCATAGGTGGTGGGGCCAGG - Intronic
1037805273 8:22055233-22055255 AGCTCTCCTGGGGTGGGGCCTGG + Intronic
1039435708 8:37557822-37557844 GGCTAGTGAGTGGTGGGGCCAGG - Intergenic
1040721771 8:50333154-50333176 AGCTGTTCTGTGATGGGGCCAGG - Intronic
1041605808 8:59781154-59781176 GGGTCATCTGTAGGGGGACCAGG - Intergenic
1042784866 8:72536609-72536631 GGCTCCTGAGTGGTGGTGCCAGG - Intergenic
1044719271 8:95130100-95130122 GGCTCCTGTGTGGAGGGGCCAGG + Intergenic
1045105139 8:98885226-98885248 TGCACATCTGTGCTGGGGCAAGG - Intronic
1046395537 8:113633872-113633894 GGGTCAGCTGTGATGGAGCCTGG - Intergenic
1047206000 8:122803296-122803318 GGCACCTCTGAGGCGGGGCCGGG - Intronic
1047435497 8:124832433-124832455 GGCTCATTTGTGCTGGGGGTTGG + Intergenic
1049164137 8:141116277-141116299 GGCTCATCTGCGGTGGGGAAAGG + Intergenic
1049398855 8:142415853-142415875 TTCCCATCTGTGGTGGGGACAGG + Intergenic
1049790090 8:144468467-144468489 GGCTTATCTGAGGCAGGGCCTGG + Intronic
1049967930 9:796104-796126 AGCCCCTCTGAGGTGGGGCCTGG - Intergenic
1050449319 9:5763240-5763262 GGCTGAGCTGTGGTGGTGCAGGG + Exonic
1053391726 9:37740869-37740891 GGCTCACCTGACGGGGGGCCTGG - Exonic
1057461129 9:95263167-95263189 GGCCCAGCAGAGGTGGGGCCTGG + Intronic
1060051635 9:120382567-120382589 GGCTCACTAGAGGTGGGGCCAGG + Intergenic
1060402403 9:123356364-123356386 GGCCCATGTCTGGAGGGGCCTGG + Intronic
1061476726 9:130872583-130872605 AGGTCATTTGAGGTGGGGCCAGG + Intronic
1061785080 9:133023082-133023104 GGCCCTTCTGTGATGGGGCTTGG - Intergenic
1061938200 9:133870289-133870311 CGCTCAGCTGTCTTGGGGCCTGG - Intronic
1062053061 9:134457284-134457306 GTGTCCTGTGTGGTGGGGCCGGG + Intergenic
1062053101 9:134457432-134457454 GTGTCCTGTGTGGTGGGGCCGGG + Intergenic
1062053127 9:134457505-134457527 GGGTCCTGTGGGGTGGGGCCGGG + Intergenic
1062532157 9:137006757-137006779 GGCTCATCAGCGGTGGAGCCTGG - Intergenic
1187152950 X:16697935-16697957 GCCTCTTCTGTGCCGGGGCCTGG - Intronic
1187445256 X:19355508-19355530 AGGACACCTGTGGTGGGGCCGGG + Intronic
1189164432 X:38846714-38846736 AGCTCATCTGTGGTGGGTTTTGG + Intergenic
1190117736 X:47637184-47637206 GGGAAATCTGTGGTGGGGCCGGG - Intronic
1190155017 X:47983333-47983355 GGGTCCTCTGTGGTGGGTTCAGG + Exonic
1190213983 X:48468235-48468257 GGCTCATCTGCGCTGGGGTCCGG - Intronic
1192338290 X:70239990-70240012 CCCTCTTCTTTGGTGGGGCCAGG - Intronic
1192800046 X:74457133-74457155 GGTTGGTCTGGGGTGGGGCCAGG - Intronic
1194344954 X:92751534-92751556 GGCGCATCTGTAGTGGAGCATGG - Intergenic
1195967366 X:110440551-110440573 AGCTCCTCTGTGGTGAGGCAGGG + Intronic
1198016627 X:132618098-132618120 AGCTAATATGTGGTGGAGCCAGG + Intergenic
1198146704 X:133864523-133864545 GGCTGAGCAGTGATGGGGCCAGG - Intronic
1200130759 X:153843428-153843450 GGCTCATCTGTGTTGTGGCATGG + Intergenic
1200653295 Y:5868176-5868198 GGCGCATCTGTAGTGGAGCATGG - Intergenic