ID: 1019611008

View in Genome Browser
Species Human (GRCh38)
Location 7:1936623-1936645
Sequence CGCACGGATGGACCTACCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019610998_1019611008 21 Left 1019610998 7:1936579-1936601 CCTCTGGGGATGACAGGCAGGGG 0: 1
1: 0
2: 5
3: 40
4: 318
Right 1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG 0: 1
1: 0
2: 0
3: 10
4: 110
1019611002_1019611008 -4 Left 1019611002 7:1936604-1936626 CCTGAGGCTGCCCCAAAGGCGCA 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG 0: 1
1: 0
2: 0
3: 10
4: 110
1019610996_1019611008 22 Left 1019610996 7:1936578-1936600 CCCTCTGGGGATGACAGGCAGGG 0: 1
1: 0
2: 2
3: 41
4: 334
Right 1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019611008 Original CRISPR CGCACGGATGGACCTACCCA CGG Intronic
900901483 1:5519485-5519507 CACAGGGATGGAGCTGCCCAAGG - Intergenic
901388696 1:8928285-8928307 CTTACAGATGGACCCACCCATGG - Intergenic
904375181 1:30076594-30076616 CACAAGGATGGAGCTGCCCAAGG + Intergenic
906363022 1:45180292-45180314 GGCTCGGAGGGTCCTACCCACGG + Intronic
908094428 1:60721867-60721889 CACAGGGATGGAGCTGCCCAAGG + Intergenic
915665392 1:157439795-157439817 TACACGAATGGAGCTACCCAAGG - Intergenic
915885724 1:159718729-159718751 CACAAGTATGGAGCTACCCAAGG + Intergenic
916296697 1:163227966-163227988 CACAGGGATGGAGCTGCCCAAGG - Intronic
918897477 1:190366891-190366913 CACAGGGATGGAGCTGCCCAAGG - Intronic
921465031 1:215477304-215477326 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1073113268 10:101075509-101075531 GGCACAGATGGCCCTAACCAAGG - Intergenic
1074533337 10:114311664-114311686 TACACGGATGGCCCTGCCCAGGG + Intronic
1079038003 11:17037329-17037351 CGCACCTCTGGACCCACCCAGGG + Intergenic
1080873778 11:36259070-36259092 TGCACGGATAGTCCTCCCCAGGG - Intergenic
1082118965 11:48357576-48357598 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1082255333 11:50027573-50027595 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1084385241 11:68839556-68839578 CGCAGGGCTCGACCTTCCCACGG - Intronic
1084556724 11:69880105-69880127 GGCAGGGATGGCCCTGCCCAGGG + Intergenic
1090755516 11:129786540-129786562 CGCACGGGTGGAGCTGCCCAAGG - Intergenic
1094817608 12:34203475-34203497 GGCATGTATGGACCTGCCCAGGG + Intergenic
1098741514 12:74178901-74178923 CGCAGGGGTGGAGCTCCCCAAGG - Intergenic
1100028782 12:90161537-90161559 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1100230264 12:92599991-92600013 CACAGGGATGGAACTGCCCAGGG - Intergenic
1100285707 12:93164627-93164649 AGAACTGAGGGACCTACCCAAGG + Intergenic
1103954383 12:124568031-124568053 CGCAGGGAGGGCCCTACACAGGG + Intergenic
1104053067 12:125209308-125209330 CTCGCGGATGGACCGCCCCAGGG + Intronic
1104543142 12:129685782-129685804 CACAGGAACGGACCTACCCAAGG + Intronic
1105020981 12:132816755-132816777 AGCCCGGATGGACCTGGCCAGGG - Exonic
1108981761 13:56523384-56523406 CACAGGGGTGGAGCTACCCAAGG - Intergenic
1110411105 13:75204678-75204700 CTCAGGGGTGGAGCTACCCAAGG - Intergenic
1110488184 13:76070735-76070757 CACACAAATGGACCAACCCAGGG - Intergenic
1110868369 13:80422630-80422652 CGCAGGGATGGAGCTTCCAAAGG - Intergenic
1113133043 13:107059787-107059809 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1118151488 14:63195225-63195247 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1124556022 15:30726789-30726811 CACAGGGATGGAGCTGCCCAAGG - Intronic
1124675252 15:31678982-31679004 CACAGGGATGGAGCTGCCCAAGG + Intronic
1129329281 15:74818713-74818735 CACAGGGATGGAGCTAGCCAAGG + Exonic
1129620244 15:77137432-77137454 CACAGGGATGGAGCTGCCCAAGG + Intronic
1130409271 15:83631201-83631223 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1137269420 16:46893725-46893747 TGCACGGAAGGTCCTTCCCAGGG - Intronic
1144122139 17:12165555-12165577 CACAGGGATGAAGCTACCCAAGG - Intergenic
1149483148 17:57019563-57019585 CACAGGGATGGAGCTACCCAAGG - Intergenic
1150485663 17:65541710-65541732 CACAGGGAAGGACCCACCCAAGG + Intronic
1151915024 17:77111529-77111551 CACAGGGATGGAGCTGCCCAAGG + Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1159204618 18:65233435-65233457 CACAGGGGTGGAGCTACCCAAGG + Intergenic
1165161781 19:33820667-33820689 CCCGGGGATGGACCCACCCATGG - Intergenic
925291988 2:2754154-2754176 CACAGGGATGGAGCTGCCCAAGG + Intergenic
937620619 2:123980722-123980744 CACAGGGATGGAGCTTCCCAAGG + Intergenic
940484156 2:154275859-154275881 CACAGGAATGGAGCTACCCAAGG + Intronic
941513074 2:166437660-166437682 CACAGGGATGGAGCTATCCAAGG + Intronic
946562161 2:220925936-220925958 CACAAGGATGGAACTGCCCAAGG - Intergenic
948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG + Intergenic
1174372280 20:50099585-50099607 CCCACGCAAGGACCTACCCAGGG + Intronic
1176358681 21:5974136-5974158 CACAGGGGTGGAGCTACCCAAGG + Intergenic
1177085194 21:16694754-16694776 CACAGGGATGGAACTGCCCAAGG - Intergenic
1177765194 21:25449896-25449918 CACAGGGGTGGAGCTACCCAAGG - Intergenic
1179764837 21:43564414-43564436 CACAGGGGTGGAGCTACCCAAGG - Intronic
1181165288 22:20979912-20979934 CCCAGGGAAGGACCTACCCCAGG - Intronic
1182650585 22:31848133-31848155 CACAGGGCTGGAGCTACCCAAGG - Intronic
1184924835 22:47629789-47629811 CCCAAGGAAGGACCTGCCCAGGG - Intergenic
953446691 3:42974494-42974516 CACAGGGATGGAGCTGCCCAAGG + Intronic
957471889 3:80668782-80668804 CACAGGGGTGGAGCTACCCAAGG + Intergenic
957711003 3:83859713-83859735 CACAGGGATGGAGCTGCCCAAGG - Intergenic
958955101 3:100458485-100458507 CACAGGGATGGAGCTGCCCAAGG - Intergenic
959245569 3:103863210-103863232 CACAGGGATGGAGCTGCCCAAGG + Intergenic
959279320 3:104317442-104317464 GGCACTTCTGGACCTACCCAGGG + Intergenic
962458276 3:135585068-135585090 GGCTCGGAGGGTCCTACCCACGG + Intergenic
962509546 3:136084695-136084717 CACAGGGGTGGACCTGCCCAAGG + Intronic
963824101 3:149932706-149932728 CACAGGGATGGAGCTTCCCAAGG - Intronic
965264978 3:166531654-166531676 CACAGGGATGGACCTGTCCAAGG - Intergenic
966972870 3:185061291-185061313 CACAGGGATGGAGCTGCCCAAGG + Intergenic
967260174 3:187634253-187634275 TGCACGGGTGGAGCTGCCCAAGG - Intergenic
972237067 4:37146920-37146942 CACAAGGGTGGATCTACCCAAGG + Intergenic
974742203 4:66021535-66021557 CGCAAGGGTGGAGCCACCCAAGG - Intergenic
974842187 4:67310821-67310843 CACAGGGATGGAGCTACCCAAGG + Intergenic
982987715 4:162232034-162232056 CACAGGGATAGAGCTACCCAAGG - Intergenic
987612386 5:20223162-20223184 CACAGGGATGGAGCTGCCCAAGG + Intronic
988162923 5:27544291-27544313 CACAGGGGTGGAGCTACCCAAGG + Intergenic
989434233 5:41392093-41392115 AGCACTTCTGGACCTACCCAAGG + Intronic
989695928 5:44200638-44200660 CACAGGGATGGAGCTTCCCAAGG + Intergenic
990520264 5:56572939-56572961 CACAGGGATGGAGCTTCCCAAGG - Intronic
994689476 5:102999328-102999350 CACAGGGATGGAGCTGCCCAAGG - Intronic
1003690266 6:8346749-8346771 CACAGGGGTGGAGCTACCCAAGG + Intergenic
1006016505 6:31085600-31085622 CAAAGGGATAGACCTACCCATGG + Intergenic
1009945869 6:70341330-70341352 CACAGGGATGGAGCTACCCAAGG - Intergenic
1012883347 6:104816817-104816839 CACAGGGGTGGAGCTACCCAAGG + Intronic
1015045131 6:128767870-128767892 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1016128383 6:140434431-140434453 CACATGGATGGAGCTGCCCAAGG + Intergenic
1016424228 6:143916597-143916619 CCCAGGGGTGGAGCTACCCAAGG + Intronic
1019611008 7:1936623-1936645 CGCACGGATGGACCTACCCACGG + Intronic
1034694312 7:153040478-153040500 CGCACAGATGAACCTAGCCTAGG - Intergenic
1036644173 8:10601711-10601733 AGCACGGATGGGCTCACCCAGGG + Intergenic
1040741390 8:50580055-50580077 CACAGGGGTGGACCTGCCCAAGG + Intronic
1041984774 8:63909089-63909111 CACAGGGATGGAGCTACCCAAGG - Intergenic
1043694812 8:83204893-83204915 CACAGGGATGGAGCTACCCAAGG + Intergenic
1043998083 8:86843592-86843614 GGCACATCTGGACCTACCCAGGG + Intergenic
1046056197 8:109082048-109082070 CACAGGGATGGATCTGCCCAAGG - Intergenic
1046481196 8:114821136-114821158 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1046831516 8:118751593-118751615 CACAAGGATGGAGCTGCCCAAGG + Intergenic
1050121920 9:2316828-2316850 GGCACTTCTGGACCTACCCAGGG - Intergenic
1050914018 9:11108463-11108485 AGCACATATGGACCCACCCAGGG + Intergenic
1059880321 9:118681811-118681833 TGCACTGATGGACCTAACCAAGG - Intergenic
1059885138 9:118737114-118737136 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1062639691 9:137512321-137512343 GGCATGGATGGACCTCCCCACGG + Intronic
1185504336 X:620183-620205 CCCAGGGCTGGCCCTACCCAAGG + Intergenic
1189079796 X:37958974-37958996 CACAGGGATGGAACTGCCCAAGG - Intronic
1190015196 X:46820404-46820426 AGCACCTATGGACCTACCCAGGG + Intergenic
1190580861 X:51892578-51892600 CGCCTGGATGGACCCACACAGGG + Intronic
1191650329 X:63529945-63529967 GGCACCTCTGGACCTACCCAAGG + Intergenic
1192841990 X:74866159-74866181 CACAGGGATGGAGCTGCCCAAGG + Intronic
1193199025 X:78666074-78666096 CACAGGGGTGGAGCTACCCAAGG + Intergenic
1193467265 X:81865359-81865381 CACAGGGATGGAGCTGCCCAAGG - Intergenic
1194281784 X:91962464-91962486 CACAGGGATGGAGCTGCCCAAGG - Intronic
1194397271 X:93401824-93401846 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1194860289 X:98990962-98990984 CACAAGGATGGAACTGCCCAAGG - Intergenic
1196996336 X:121388102-121388124 CACAGGGATGGAGCTGCCCAAGG + Intergenic
1198927388 X:141814460-141814482 AGCACCTCTGGACCTACCCAGGG - Intergenic
1199420405 X:147637494-147637516 CACAGGGGTGGAACTACCCAAGG + Intergenic
1200599379 Y:5187118-5187140 CACAGGGATGGAGCTGCCCAAGG - Intronic
1201405201 Y:13642969-13642991 AGCACTTCTGGACCTACCCAGGG + Intergenic