ID: 1019612857

View in Genome Browser
Species Human (GRCh38)
Location 7:1945753-1945775
Sequence CTGGGCCGCAGACCGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019612849_1019612857 5 Left 1019612849 7:1945725-1945747 CCTCAGAGGTGCGGGTAAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1019612857 7:1945753-1945775 CTGGGCCGCAGACCGGGGTTAGG 0: 1
1: 0
2: 1
3: 12
4: 156
1019612847_1019612857 7 Left 1019612847 7:1945723-1945745 CCCCTCAGAGGTGCGGGTAAGGT 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1019612857 7:1945753-1945775 CTGGGCCGCAGACCGGGGTTAGG 0: 1
1: 0
2: 1
3: 12
4: 156
1019612848_1019612857 6 Left 1019612848 7:1945724-1945746 CCCTCAGAGGTGCGGGTAAGGTG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1019612857 7:1945753-1945775 CTGGGCCGCAGACCGGGGTTAGG 0: 1
1: 0
2: 1
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019612857 Original CRISPR CTGGGCCGCAGACCGGGGTT AGG Intronic
901381834 1:8879222-8879244 CTCGGCCCCACTCCGGGGTTGGG + Intronic
902210042 1:14898463-14898485 CTGGTCAGCAGATAGGGGTTGGG + Intronic
903024649 1:20418646-20418668 CTGGGCAGCAGCCAGGGCTTTGG + Intergenic
904007145 1:27369274-27369296 CTGGGCCTCAGGCCGTGGTGTGG - Exonic
905275398 1:36814353-36814375 CTGGGCCACAGCCTGGGGATAGG + Intronic
905731981 1:40304010-40304032 CGGGGACGCAGAGCAGGGTTGGG + Intronic
905920037 1:41713190-41713212 CTGGGGCGCAGATCGGGGGTGGG - Intronic
907091538 1:51729869-51729891 CTGCACCGCAGTCCGGGGATCGG + Intronic
910692782 1:89981861-89981883 CTGGGCCACAGAGCGAGATTCGG - Intergenic
914760358 1:150593653-150593675 CTGGTCTGCAGCCCAGGGTTTGG + Intergenic
916743928 1:167669878-167669900 CTGGGATGCAGACCGGGGGCTGG + Intronic
917826681 1:178829304-178829326 CTGGTCAGCAGCCCGGGGTTTGG - Intronic
919392384 1:197003330-197003352 CTGGTCTGCAGCCAGGGGTTTGG + Intronic
919962070 1:202481222-202481244 CTGGTCTGCAGCCCGGGGGTTGG + Intronic
920281875 1:204849662-204849684 CTGGGCTGCAGACCTGGGTTTGG - Intronic
920964352 1:210689891-210689913 CTGGTCAGCAGACCTGGGTCAGG - Intronic
1062911737 10:1216228-1216250 CGGGGCATCAGACCGAGGTTGGG + Intronic
1064059347 10:12124765-12124787 CTGGGCCACAGAGCGAGATTTGG - Intergenic
1064265908 10:13825337-13825359 CTGGTCTGCGGCCCGGGGTTTGG - Intronic
1065501899 10:26391622-26391644 ATGTGCCGCACACCGAGGTTTGG + Intergenic
1067374428 10:45714355-45714377 CTGGTCTGCAGCCCAGGGTTGGG - Intergenic
1067379252 10:45757904-45757926 CTGGTCTGCAGCCCAGGGTTGGG + Intronic
1067882239 10:50055997-50056019 CTGGTCTGCAGCCCAGGGTTGGG - Intergenic
1067886954 10:50098567-50098589 CTGGTCTGCAGCCCAGGGTTGGG + Intronic
1068227572 10:54126093-54126115 CTGGGCCACAGAGCGAGATTCGG - Intronic
1068676327 10:59773374-59773396 CTGGTCTGCAGCCCGGGGATTGG - Intergenic
1072674379 10:97454507-97454529 CTGGGCAGCAGAGCAGGGTCTGG - Intronic
1077108591 11:852494-852516 CTGGGCACCAGCCCAGGGTTGGG - Intronic
1077499398 11:2902403-2902425 CTGCGCCGGAGTTCGGGGTTCGG - Exonic
1077533841 11:3109694-3109716 CTGGGCGGAACACCAGGGTTGGG + Intronic
1083169512 11:60914574-60914596 CTGGGCCGTGGGTCGGGGTTCGG - Intronic
1083297000 11:61720266-61720288 CGGGGCCACAGGCCTGGGTTTGG + Intronic
1084288966 11:68149560-68149582 CTGAGCAGCAGGCCGGGGTCAGG - Intergenic
1084716980 11:70880320-70880342 CTGGGGAGGAGACCGGGCTTCGG + Intronic
1084892304 11:72242622-72242644 CTGGGCCCTAGGCTGGGGTTTGG - Intronic
1085576125 11:77605405-77605427 CTGGTCTGCAGCCTGGGGTTTGG - Intronic
1089098764 11:115942156-115942178 GTGGGAGGCAGACAGGGGTTAGG + Intergenic
1089563109 11:119355778-119355800 CTGGGGAGCAGACCAGGGGTGGG + Exonic
1090363562 11:126189098-126189120 ATGAGCCCCAGACCAGGGTTTGG - Intergenic
1092248469 12:6877335-6877357 CTGGGCTGGAGACAGGGATTTGG + Intronic
1095184102 12:39180721-39180743 CTGCTCTGCAGCCCGGGGTTTGG + Intergenic
1095986855 12:48004734-48004756 CAGCGCCGCAGCCCCGGGTTTGG - Intergenic
1096386447 12:51197929-51197951 CTGGGCTGGTGGCCGGGGTTGGG + Exonic
1099307926 12:80981586-80981608 CTGGTCTGCAGCCTGGGGTTGGG - Intronic
1102011026 12:109618455-109618477 CTGGGCAGCAGCCTGGGGTGTGG + Intergenic
1104065756 12:125304306-125304328 CTGGTCCACAGCCCAGGGTTTGG + Intronic
1104257392 12:127151670-127151692 ATAGGCCACAGACCAGGGTTGGG + Intergenic
1112767708 13:102763326-102763348 CTGGTCTGCAGCCCGGGGGTTGG - Intergenic
1113932165 13:113974256-113974278 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1113932193 13:113974350-113974372 CTTTCCCGCAGGCCGGGGTTGGG + Intergenic
1114519336 14:23323074-23323096 CTGGGGCTCTGACTGGGGTTGGG + Intronic
1119547925 14:75486638-75486660 CTGGGATGCAGAGTGGGGTTGGG + Intergenic
1121149172 14:91615099-91615121 CTGGTCCTCAGCCCGGGGGTTGG - Intronic
1121497084 14:94400230-94400252 CTGGTCTGCAGACTGGGGATTGG + Intergenic
1122887861 14:104718488-104718510 CTGGGTCTCAGACAGGGGGTGGG + Intronic
1124393110 15:29277682-29277704 CTGGTCCACAGCCTGGGGTTTGG + Intronic
1124999364 15:34754736-34754758 CTCGGGCGCCGTCCGGGGTTCGG + Exonic
1129360510 15:75021166-75021188 CTGGGCCACACACCGGGATCAGG - Exonic
1131174174 15:90199877-90199899 CTAGGCGGCAGATAGGGGTTTGG + Intronic
1133287909 16:4699009-4699031 CTGGCCCTCAGCCCGGGGTTGGG - Intronic
1133700039 16:8300302-8300324 CTGGGCCCCAGAATGGGGTGAGG - Intergenic
1134135168 16:11672749-11672771 CAGGGCAGCAGACGGGGTTTTGG + Intronic
1136556480 16:31010463-31010485 CTGTGCCGGAGGCCGGGGTCTGG + Exonic
1137310658 16:47253878-47253900 CTGGTCTGCAGCCTGGGGTTTGG + Intronic
1137713361 16:50582675-50582697 CTGGGCAGCAGGCCTGGGATGGG - Intronic
1137873441 16:51972549-51972571 GTGGGCAGCAGACCAGGGCTGGG + Intergenic
1146666990 17:34711834-34711856 CTGGGCTGCAGCCCGGTGTTGGG - Intergenic
1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG + Exonic
1151767956 17:76141630-76141652 CTGGGACGGAGCCTGGGGTTGGG + Intergenic
1151772495 17:76173558-76173580 CTGGGCCTCAGACAGGAGTGCGG - Intronic
1152360814 17:79832322-79832344 CTGAGCCGCACCCCGGAGTTCGG + Intergenic
1152360815 17:79832327-79832349 CTGGGCCGAACTCCGGGGTGCGG - Intergenic
1152605010 17:81285243-81285265 CTGGCCAGCAGCACGGGGTTCGG - Intronic
1152704107 17:81833908-81833930 CTGGCCCTCTGACCCGGGTTGGG - Intronic
1156242468 18:35267363-35267385 CTCGGCCACAGGCCGGGGCTCGG - Intronic
1157504407 18:48216556-48216578 CTGGCCCGGAGACCCAGGTTTGG - Intronic
1157507063 18:48234412-48234434 CTGGGGAAAAGACCGGGGTTGGG - Intronic
1162523409 19:11194686-11194708 GTGGGTCCCAGACCTGGGTTGGG - Intronic
1162664121 19:12195290-12195312 CTCGGCCGCAGAGTGGGGCTGGG + Intergenic
1163118868 19:15203904-15203926 CTGGGCCACAGACCGAGACTTGG - Intergenic
1164169956 19:22716324-22716346 CTGGGCCCCAGACCTAGGTGAGG - Intergenic
1165150293 19:33756360-33756382 CTGGGCCACATACCTCGGTTTGG - Intronic
1165365897 19:35364407-35364429 CGGGTCTGCAGCCCGGGGTTGGG + Intergenic
1165824381 19:38697582-38697604 CAGGGGCACAGACCTGGGTTTGG - Intronic
1166317488 19:41997295-41997317 CTGGGCGGCGGCCCGGGGCTTGG - Intronic
1166830919 19:45639258-45639280 CTGGGACCCAGACCGGCGTGGGG - Intronic
1167523441 19:49970300-49970322 CTGGGGCAGAGACCGGGGTGGGG - Intergenic
925918993 2:8626409-8626431 ATGTGCCTCAGACCTGGGTTGGG + Intergenic
926155243 2:10449734-10449756 CTGTGCCTCAGACCTGGTTTTGG - Intergenic
927905058 2:26849437-26849459 GTGGCCCTCGGACCGGGGTTAGG + Intronic
927911603 2:26903777-26903799 CTGGGCCCCGGGCTGGGGTTTGG - Intronic
929218238 2:39437542-39437564 CTGGCCCAGGGACCGGGGTTAGG + Intergenic
929940938 2:46333569-46333591 CTGGGCAGCAGAAAGGGGTGCGG + Intronic
939645056 2:144687144-144687166 CTGGGCAGTAGCCAGGGGTTCGG + Intergenic
946328696 2:218997841-218997863 CTGGGCTCCAGACTGGGGGTGGG - Intergenic
947595564 2:231409597-231409619 CTGGGCTGCAGAGAGGGGATTGG + Intergenic
948800081 2:240429547-240429569 CTGGGCCGCAGCCCCAGGTCTGG + Intergenic
948974876 2:241457914-241457936 ATGGGCCACAGACAGGGGTGAGG + Intronic
949028502 2:241777316-241777338 CTGAGCCGCAGACCGAGGCTGGG - Intronic
1172121676 20:32602444-32602466 GTGTGCCGCAGCCAGGGGTTGGG - Intronic
1176267319 20:64216981-64217003 CTGGGCTGCAGATTGGGGTTGGG + Intronic
1178314371 21:31557087-31557109 CTGGGACCCAGACCTGGGTTTGG - Intronic
1179043203 21:37823131-37823153 CTGGCCTGCAGACTGGGGCTGGG - Intronic
1179926947 21:44540003-44540025 CTGGGGTGCAGACCAGGGTCAGG + Exonic
1179928452 21:44551311-44551333 CTGGGGTGCAGACCAGGGTCAGG + Exonic
1179929614 21:44558568-44558590 CTGGGGTGCAGACCAGGGTCAGG + Exonic
1179932659 21:44580449-44580471 CTGGGGTGCAGACCAGGGTCAGG + Exonic
1179939192 21:44627297-44627319 CTGGGGTGCAGACCAGGGTCAGG - Exonic
1179949596 21:44702321-44702343 CTGGGGTGCAGACCAGGGTCAGG - Intronic
1180699319 22:17773171-17773193 CTGGGCCGCAGGCAGAGGCTTGG + Intronic
950972168 3:17200289-17200311 CTGGTCTGTAGCCCGGGGTTTGG - Intronic
955340915 3:58124371-58124393 CTCGGCCGCTGACCCAGGTTGGG + Exonic
955387011 3:58488294-58488316 CTGGGCTGGAGACAGGGATTTGG + Intergenic
973271077 4:48263860-48263882 CTGGGCCGCTGAGCCGAGTTTGG - Intronic
978810375 4:112842736-112842758 TTGGGCCGCAGACTGGGGACTGG + Intronic
979489502 4:121308994-121309016 CTGGTCCCCAGCCCGGGGGTTGG - Intergenic
982435198 4:155376913-155376935 TTGGGCCGAAGAGCGGTGTTGGG - Exonic
983251855 4:165354497-165354519 CTGGTCCACAGCCCGGGGATTGG + Intergenic
985705142 5:1396141-1396163 CTGGGCTGCAGACCAGGGGCAGG + Intronic
985841748 5:2311202-2311224 CTGGGCCACATTCCGGGGTCAGG - Intergenic
990595464 5:57308649-57308671 CTGGGCAACAGACAGAGGTTGGG + Intergenic
990970702 5:61502633-61502655 CTGGTCCACAGTCCGGGGATGGG - Intronic
998139553 5:139692189-139692211 CAGGGCCCCAGAGTGGGGTTGGG - Intergenic
999304352 5:150509992-150510014 CTGGGCTGCAGACCTGGCTTGGG + Intronic
999653488 5:153790519-153790541 CTGGTCCACAGACTGGTGTTTGG - Intronic
1000859250 5:166436221-166436243 CTGGGCCACAGAGCGAGATTTGG + Intergenic
1003390109 6:5706301-5706323 CTGGTCCACAGCCCGGGGGTGGG + Intronic
1006503047 6:34470049-34470071 CTGGGCTGGAGACTGGGGTCGGG + Intronic
1011706367 6:90005162-90005184 CTGGACGGCAGATCTGGGTTTGG + Intronic
1013412792 6:109896852-109896874 CTGGGCTGAAGACAGGAGTTAGG + Intergenic
1014720512 6:124911933-124911955 ATAGGCCACAGACTGGGGTTGGG + Intergenic
1018923862 6:168193615-168193637 CTGGGCTGGAGACAGGGTTTGGG + Intergenic
1019343176 7:518053-518075 CTGGGCCGGAGCCCGGGGTGGGG - Intronic
1019359326 7:596598-596620 CTGTGCCGCAGAGCGGGGGCCGG - Intronic
1019612857 7:1945753-1945775 CTGGGCCGCAGACCGGGGTTAGG + Intronic
1019670644 7:2276300-2276322 CTGGGCCGCAGTCGGGGATGTGG - Intronic
1022144240 7:27521499-27521521 CTGGTCCTCAGCCCGGGGGTTGG - Intergenic
1029264214 7:99325795-99325817 CGGGCGCGCAGTCCGGGGTTAGG - Intergenic
1031945219 7:127832727-127832749 CCGGTCCGCAGTCCGGGGCTTGG - Intronic
1033326512 7:140383566-140383588 CTGGGGGGCAGACAGGGGTTAGG - Intronic
1034203042 7:149294388-149294410 CTGGGCCGCAGAGAGGAGTCTGG + Intronic
1034815727 7:154170487-154170509 CTGAGCCCCAGCCCAGGGTTGGG - Intronic
1035564846 8:634779-634801 CTGGGCTGCTCAGCGGGGTTTGG - Intronic
1037260411 8:17001705-17001727 CTGGGGCGCAGATGGGGGTGGGG + Intronic
1037705038 8:21311107-21311129 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037705141 8:21311501-21311523 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037705317 8:21312240-21312262 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037705390 8:21312568-21312590 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037705413 8:21312656-21312678 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037705473 8:21312874-21312896 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037705485 8:21312918-21312940 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037705509 8:21313005-21313027 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037705532 8:21313093-21313115 CTGGGATGCAGTCCGGGGCTGGG + Intergenic
1037940751 8:22949109-22949131 CTGGGCCCCAGGCCGGCCTTTGG - Intronic
1038455504 8:27669870-27669892 CTGTGCCGCAGAACTGGGTACGG + Intronic
1042378294 8:68081381-68081403 CTGGTCCGCAGCCTGGGATTGGG + Intronic
1043572291 8:81618616-81618638 CTGGCCTGCAGACTGGGGTGAGG - Intergenic
1046524514 8:115367528-115367550 CTGGGCCACAGTCCGGGGGCTGG - Intergenic
1049587229 8:143437727-143437749 CTGGGCCGAAAACCTGGGTGGGG + Exonic
1049649919 8:143761114-143761136 CTGGGGCGCAGATCGGGGTAGGG + Intergenic
1051000953 9:12280986-12281008 CTGGTCCACAGCCTGGGGTTTGG + Intergenic
1055409944 9:76018333-76018355 CTGGTCCGCAGCCCGGGGCTTGG - Intronic
1059750346 9:117241719-117241741 CTGGTCCACAGCCCTGGGTTTGG + Intronic
1062033041 9:134370686-134370708 CTGGGCTGCAGACTGGGGCCAGG + Intronic
1062525077 9:136974907-136974929 CTGGGCCGCAGGCAGGGGGATGG + Intergenic
1062596981 9:137303913-137303935 CTGGACCTCAGACCAGGGCTGGG + Intergenic
1186608923 X:11119688-11119710 CTGGGCCTCAGGCCTGGGGTGGG + Intronic
1191101335 X:56731544-56731566 CTGGGCGACAGACCGGGACTCGG + Intergenic
1192198361 X:69047393-69047415 CTGAGCCCCAGACCAGGGTCAGG - Intergenic
1196334719 X:114518451-114518473 CTGGGCTGGTGACAGGGGTTAGG - Intergenic