ID: 1019613346

View in Genome Browser
Species Human (GRCh38)
Location 7:1947876-1947898
Sequence TTCCTGGAATAGGTGGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 217}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019613346_1019613357 12 Left 1019613346 7:1947876-1947898 CCGTGTCCCACCTATTCCAGGAA 0: 1
1: 0
2: 1
3: 20
4: 217
Right 1019613357 7:1947911-1947933 GCAGGTAGAGGCACATGGATGGG 0: 1
1: 1
2: 1
3: 19
4: 241
1019613346_1019613358 17 Left 1019613346 7:1947876-1947898 CCGTGTCCCACCTATTCCAGGAA 0: 1
1: 0
2: 1
3: 20
4: 217
Right 1019613358 7:1947916-1947938 TAGAGGCACATGGATGGGAGAGG No data
1019613346_1019613356 11 Left 1019613346 7:1947876-1947898 CCGTGTCCCACCTATTCCAGGAA 0: 1
1: 0
2: 1
3: 20
4: 217
Right 1019613356 7:1947910-1947932 AGCAGGTAGAGGCACATGGATGG 0: 1
1: 1
2: 52
3: 155
4: 527
1019613346_1019613352 0 Left 1019613346 7:1947876-1947898 CCGTGTCCCACCTATTCCAGGAA 0: 1
1: 0
2: 1
3: 20
4: 217
Right 1019613352 7:1947899-1947921 AGCAGCTCCCAAGCAGGTAGAGG 0: 1
1: 0
2: 4
3: 15
4: 182
1019613346_1019613354 7 Left 1019613346 7:1947876-1947898 CCGTGTCCCACCTATTCCAGGAA 0: 1
1: 0
2: 1
3: 20
4: 217
Right 1019613354 7:1947906-1947928 CCCAAGCAGGTAGAGGCACATGG 0: 1
1: 0
2: 0
3: 14
4: 246
1019613346_1019613359 18 Left 1019613346 7:1947876-1947898 CCGTGTCCCACCTATTCCAGGAA 0: 1
1: 0
2: 1
3: 20
4: 217
Right 1019613359 7:1947917-1947939 AGAGGCACATGGATGGGAGAGGG No data
1019613346_1019613351 -6 Left 1019613346 7:1947876-1947898 CCGTGTCCCACCTATTCCAGGAA 0: 1
1: 0
2: 1
3: 20
4: 217
Right 1019613351 7:1947893-1947915 CAGGAAAGCAGCTCCCAAGCAGG 0: 1
1: 0
2: 3
3: 43
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019613346 Original CRISPR TTCCTGGAATAGGTGGGACA CGG (reversed) Intronic
901428205 1:9196969-9196991 TCCCTGGGACATGTGGGACACGG - Intergenic
902252024 1:15160173-15160195 TTCCAGGAAAAGGTAGGATAAGG - Intronic
902614696 1:17617448-17617470 TCCCAGGCATTGGTGGGACAGGG + Intronic
903064015 1:20688464-20688486 TTCCTGGAAGAGGTGGAAGGTGG - Intronic
903884235 1:26531649-26531671 TTCCTGGGATTGGTGGGGCAGGG + Intronic
904440737 1:30527878-30527900 TTCCTGGAAGATGAAGGACAGGG - Intergenic
904957336 1:34296063-34296085 GTCTTGAAATAGATGGGACATGG + Intergenic
906113246 1:43338408-43338430 TGCCTGGGATAGGTGGGATTAGG - Intronic
906474400 1:46158450-46158472 TTTCTGGAAGAGGTGGCACTTGG - Intronic
906938156 1:50232606-50232628 TTCCTGGAATAGATGACACTTGG - Intergenic
907650456 1:56289715-56289737 TTCCTGGAAGAGGTGACACCTGG + Intergenic
911804707 1:102191527-102191549 TTCATGGAATATGTGAGAGAGGG + Intergenic
915252032 1:154597472-154597494 TTCCTGGAAGAGGTGAAACTAGG - Intronic
915298964 1:154941329-154941351 GACCTGGGAGAGGTGGGACAGGG + Intergenic
915488590 1:156239132-156239154 TAGCTGGAATGGGTGGGGCATGG - Intronic
917918996 1:179733897-179733919 TTCCTGGGATAGGAGGAACAAGG - Intergenic
919034987 1:192294822-192294844 TTCGTGTATTAGGTGGGAGAAGG + Intergenic
919801087 1:201355029-201355051 TTTCTGGGAAAGGTGGGGCAGGG - Intergenic
920218670 1:204379277-204379299 TTCCTGGAGGAGGTGGCACATGG - Intergenic
921779408 1:219143987-219144009 TTCCTGGAATAACTGGGAAAAGG + Intergenic
924808158 1:247378254-247378276 TCCCTGGAAGAGACGGGACAAGG + Intergenic
1066654696 10:37686980-37687002 TGTCTGGAATAGGTGGGCCTGGG - Intergenic
1069727850 10:70592768-70592790 TTTCTGGACTGAGTGGGACATGG + Intergenic
1070763895 10:79045368-79045390 TTCCTGGAACTGGTGGATCAGGG - Intergenic
1071733804 10:88275239-88275261 TAACTGAAATAAGTGGGACAAGG - Intronic
1073094740 10:100972722-100972744 GTCCTGGAATCGGGGGGACATGG - Intronic
1074415208 10:113261478-113261500 TTCGTGGAATAGATTGAACAAGG + Intergenic
1075631829 10:124005139-124005161 GTAGTGGAGTAGGTGGGACAGGG - Intergenic
1076151887 10:128169099-128169121 TTCCTGGAGAAGGAGAGACAGGG + Intergenic
1076298205 10:129403612-129403634 TTCCTGGAGGAGGTGGCATACGG + Intergenic
1076594269 10:131616200-131616222 TTCCCGGCAGTGGTGGGACACGG - Intergenic
1076915864 10:133422997-133423019 ATCCTGGAGTGGGTGGGGCAGGG + Exonic
1076935998 10:133567835-133567857 ATCCTGGAGCAGGTGGGGCAGGG + Intronic
1077431785 11:2519219-2519241 TTCCCGGCACAGGCGGGACATGG - Intronic
1077887017 11:6394070-6394092 ATCCTGGAGTTGGTGGGATAGGG + Intronic
1078464843 11:11542417-11542439 TTGCTGGAATGGGTGGTACAGGG - Intronic
1078915278 11:15772978-15773000 TTCCTGGAAGAGGTAGCACCTGG + Intergenic
1079149875 11:17888149-17888171 TTCCTGGAAGAGGTGGGGATGGG - Intronic
1080037590 11:27725087-27725109 GTCTTGGAATTGGTGGGAGATGG + Intergenic
1080736293 11:35017978-35018000 GTCCTGGAAGAGCTGGGTCATGG - Intronic
1082760118 11:57119215-57119237 TTCATGGAATAGATAGGCCATGG + Intergenic
1083160217 11:60849920-60849942 CTCCTGGAACATGTGGGAGAAGG - Exonic
1083349761 11:62019136-62019158 TTCCTGGAGGGGGAGGGACATGG + Intergenic
1084274487 11:68044477-68044499 TCCCTGGAAGCGGTGGGCCATGG - Intronic
1084870165 11:72093328-72093350 TTGCTGGAAGCTGTGGGACAGGG + Intronic
1086412823 11:86559256-86559278 TTCCTGGAATTAGGGGGACGTGG - Intronic
1088813390 11:113406285-113406307 TTCCAGGAATGGGAGGGGCAGGG - Intergenic
1089601572 11:119618704-119618726 TTCCTGGAAGAAGTGGCAGATGG - Intergenic
1091872750 12:3908499-3908521 TCCCTGGACCAGGTGGGACTGGG - Intergenic
1092708343 12:11308565-11308587 TTCCTGGAGGAGGTGGGGGACGG + Exonic
1092853265 12:12649734-12649756 TTCCTGAAATAGTGGGGAGAAGG + Intergenic
1094216847 12:27951632-27951654 TTCTTGGAAAATGTGGGACAAGG + Intergenic
1095902178 12:47339300-47339322 TTGCTGGCATAGGTGGGAATGGG + Intergenic
1097152766 12:56991700-56991722 TGACAGGAATAGGTGGGAGAAGG + Intergenic
1100390742 12:94144656-94144678 TTCCTTCAGTAGGTGGGACTTGG - Intergenic
1101915394 12:108892005-108892027 TTCCTGGAAAAGACTGGACAAGG - Intronic
1101962465 12:109260167-109260189 TTGCTGGAAATGGTGGGGCAGGG + Intronic
1101967071 12:109288823-109288845 TTCCTGGAAGAGGTGGCCCTAGG - Intronic
1102538744 12:113602598-113602620 TTCTTGAAAGAGGTGGGAGAAGG - Intergenic
1104794902 12:131510541-131510563 TCCCTGGAGGAGGTGAGACACGG + Intergenic
1106479567 13:30126929-30126951 TGCCTGGAAAAGCAGGGACAGGG - Intergenic
1107758911 13:43655164-43655186 TTCTGGGAATGGGTGGGGCAAGG + Intronic
1108299946 13:49063615-49063637 TTCCTGGAATTTGTGATACAAGG - Intronic
1109300271 13:60583879-60583901 TTCCAGGAATGGGTGAGGCAGGG - Intergenic
1112205864 13:97322753-97322775 TTCCGGGAAGAAGTGGGAGAAGG - Intronic
1112898058 13:104325582-104325604 TGCCTGTAATAGGTGGAAAATGG - Intergenic
1113627203 13:111856108-111856130 TTCCTGCATTGGATGGGACATGG + Intergenic
1113936446 13:113997517-113997539 GTCCTGGGGCAGGTGGGACAGGG + Intronic
1116341743 14:43731896-43731918 TTCCTGAGTTTGGTGGGACAAGG + Intergenic
1116928270 14:50664031-50664053 TTCATGGAAGAGGTAGGACTTGG - Intronic
1117013933 14:51499057-51499079 TTCCTGGCAGAGGTGTGACTTGG + Intronic
1118472808 14:66090708-66090730 TTCCTGTAATAGGTAGGGCAGGG - Intergenic
1118624029 14:67640649-67640671 GTCCTGGTATTGGTGGGAAAGGG - Intronic
1119372160 14:74155837-74155859 TTCCTGGAACAGAAGGGACTGGG + Intronic
1119523144 14:75301250-75301272 TTCCTGGAAAAGTTGGGAGCAGG + Intergenic
1121467688 14:94126574-94126596 TTCCTGGAAGAGGAGGCAAAAGG - Intergenic
1121657741 14:95610136-95610158 TTCCTGGAAGAAGTGGAACCTGG - Intergenic
1122021159 14:98839114-98839136 TTCCTGGAAGAGGTGACACTAGG - Intergenic
1124912232 15:33932995-33933017 TTTCTGGTATATGTGGGAGAAGG + Intronic
1126332009 15:47543218-47543240 ATCCTGGAATAGGAGTGATATGG + Intronic
1126974732 15:54162933-54162955 TTCCCTGAATAGGTGAGACAAGG + Intronic
1127337342 15:58001473-58001495 TCCCTGGAATAGGTGAGCCCAGG + Intronic
1128263203 15:66247128-66247150 TTCCTGGAGGAGGTGGTTCATGG - Intronic
1128478494 15:68017512-68017534 TTCCTGCCCTAGGTGGGACTTGG + Intergenic
1128528007 15:68425551-68425573 TGCCTGGAGGAGGTGGGGCAAGG + Intronic
1129334678 15:74844911-74844933 TCCCTGGAACGGGAGGGACAGGG - Exonic
1130070184 15:80640503-80640525 GCCCTGGAAGAGGTGGGAGAAGG - Intergenic
1130142873 15:81245594-81245616 CTGCTGGCATGGGTGGGACAGGG + Intronic
1131360549 15:91786673-91786695 TACCTGGAATAGGTAGACCACGG - Intergenic
1136280392 16:29205321-29205343 CTCCTGGAACAGGTGGCAGATGG - Intergenic
1136395463 16:29990276-29990298 TACCTGGGAGAGGTGGGACTGGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1141530044 16:84639970-84639992 TTCCTGGAATCCCTGGGATAAGG - Intergenic
1142084761 16:88171279-88171301 CTCCTGGAACAGGTGGCAGATGG - Intergenic
1144798312 17:17907565-17907587 CTCCTGGAATAAGTGGGCCTTGG + Intronic
1145045708 17:19614039-19614061 TTTGGGGGATAGGTGGGACATGG - Intergenic
1148102760 17:45102760-45102782 TGCCTGGACTAGGAGGGAAAGGG + Intronic
1148690869 17:49526130-49526152 TTCCAGGAAGAGGTGGCAAAGGG - Intergenic
1148908408 17:50926457-50926479 CTCCTAGAATAGGAAGGACATGG - Intergenic
1151364730 17:73609861-73609883 TTGCTGGAATGGGAGGGACATGG - Intronic
1153695957 18:7642061-7642083 ATCCTGAAATATTTGGGACAAGG - Intronic
1153850076 18:9085714-9085736 TTTCTGGAGTAGCTGGGACTAGG + Intergenic
1157994159 18:52535060-52535082 GTCTTTGAAAAGGTGGGACATGG + Intronic
1158795248 18:60838260-60838282 CTCCTGAAATAGGTGGGGCTTGG - Intergenic
1159970887 18:74650703-74650725 TTCATGGAAGGGGTGGGCCACGG + Intronic
1160699254 19:498171-498193 TTCCAGGAAGAGGTGGCATAGGG - Intronic
1160895511 19:1400255-1400277 TTCCTGGAGGAGGGGGCACAGGG + Intronic
1161477060 19:4491922-4491944 TTTCTGGAGGGGGTGGGACACGG + Intronic
1161482841 19:4519383-4519405 TTCCTGGAACAGGAGGGTCTGGG - Intergenic
1162268306 19:9594243-9594265 TTCAAGGAATAGGGGGGTCAGGG - Intergenic
1163062303 19:14769380-14769402 TGCCTGGAGTAAGTGGGGCAAGG + Intronic
1165425844 19:35745034-35745056 AACCCGGAATAGGCGGGACATGG + Intronic
1166018221 19:39999865-39999887 TTGCTGAAATAGGTCGGGCATGG - Intronic
1167395004 19:49222727-49222749 TTTCTGGAATTGGAAGGACAGGG + Intergenic
1168105724 19:54164741-54164763 TTCCTGGAGCAGGTGGAACCAGG - Intronic
925866471 2:8232377-8232399 ATGCTGGAACTGGTGGGACAGGG - Intergenic
926161564 2:10493676-10493698 TTCCGGGGAGAGGTGGCACAGGG - Intergenic
927231000 2:20824031-20824053 TTCCTGGAATTTGTGATACAAGG - Intergenic
927521999 2:23704444-23704466 TTCCTGGACTAAGAGGAACAAGG + Intronic
931806928 2:65816467-65816489 TTTCTGGAAGAGGTGGCACTGGG - Intergenic
932800763 2:74740640-74740662 TTCCTGGGAGAGGTGACACATGG - Intergenic
933256336 2:80085258-80085280 TTCCTGCAATCAGTGGGAGAAGG + Intronic
933560851 2:83884286-83884308 TTCTTGGAAGAAGTGGGGCAAGG - Intergenic
933768480 2:85728011-85728033 TTCCTGGAGTAGGTGGATCTGGG - Intergenic
935803871 2:106727711-106727733 TTCATGGAGGAGGTGGGACCAGG + Intergenic
937262587 2:120595922-120595944 TTCCTGGAAGAGGTGGGGAAGGG + Intergenic
937354931 2:121192363-121192385 TTCCTGGAGAAGGTGGGCCTAGG - Intergenic
937390045 2:121478139-121478161 TTCCTGGGATAAGTCGCACATGG - Intronic
940764770 2:157778340-157778362 TTCCTGGAGTTGGAGGGAAAAGG + Exonic
940959274 2:159765102-159765124 TTCCAGGAAAATATGGGACAAGG + Intronic
941850303 2:170173535-170173557 TTCCAGGGAGAGGTGGGACCAGG + Intergenic
943214476 2:185012994-185013016 TTCCTGAAATAGGAAGGAAAGGG - Intergenic
945344407 2:208695935-208695957 TTAATGGAATAGGTGGGAAAGGG - Intronic
947500752 2:230669058-230669080 TTCCTGGGATGGGTGGGCCTGGG - Intergenic
948655799 2:239476043-239476065 TTCCTGGTATATGTGGGAAATGG + Intergenic
948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG + Intergenic
1173263862 20:41460509-41460531 TGGCTGGAACAGTTGGGACAGGG - Intronic
1173467624 20:43295899-43295921 TGCCAGGAATACGTGGGGCAAGG - Intergenic
1176233154 20:64042152-64042174 TTCCTGGAGTTGGGGGGACTTGG - Intronic
1176235627 20:64052256-64052278 GTCCTGGACTAGGTGGGCTATGG + Intronic
1176688021 21:9871597-9871619 TTTCTGGAAGTGGAGGGACAAGG - Intergenic
1180982744 22:19886539-19886561 ATCCTGGCATAGGAGGGAAATGG - Intronic
1180982754 22:19886590-19886612 ATCCTGGCATAGGAGGGAAATGG - Intronic
1182688963 22:32142912-32142934 TTCCTAGAAAAGGTGGGTGAAGG + Intergenic
1183514829 22:38259046-38259068 TTCCTGGAAGAGGAGGGAGGTGG - Intronic
1183525466 22:38319852-38319874 TTCCAGGGATAGGAAGGACAAGG - Intronic
1183732775 22:39627927-39627949 TTCCTGGAAGAGGTGGGGCTGGG + Intronic
949606618 3:5660517-5660539 TTCCTGCAGTAGGAGGGGCAGGG + Intergenic
949635543 3:5978075-5978097 CTCCTGGATTATGTAGGACAAGG + Intergenic
951192116 3:19783205-19783227 TTTTAGGAATAGGTGGAACAAGG + Intergenic
952743453 3:36756619-36756641 TTCCAGGAATGGGTTAGACAAGG - Intergenic
954411206 3:50371977-50371999 TTGCTGGACTAGGCTGGACAGGG + Intronic
954460232 3:50622404-50622426 TTCCTGGAAGAGGTGGCACTGGG - Intronic
955088140 3:55722589-55722611 TCACTGGAATAGTTGGGGCAGGG + Intronic
961820210 3:129572026-129572048 TTCCTGGAGGAGGTGGGATGGGG - Intronic
962353955 3:134677870-134677892 TGCCAGGAATACTTGGGACACGG - Intronic
962366863 3:134792602-134792624 TTCCTGGGAGAGGTGGGATTTGG + Intronic
962508647 3:136076061-136076083 TTCCTGAATTAGGTGGGAGCTGG - Intronic
962560483 3:136601226-136601248 TTCCTAAAATAGTTGGGTCATGG - Intronic
964208713 3:154204046-154204068 TTCCTGGAATAGGTGGGGTAGGG + Intronic
964808692 3:160639439-160639461 TTTCTGGATTTGGTGGGTCAGGG + Intergenic
964970761 3:162557371-162557393 TTCATGGAACAGGTGGCAAAAGG + Intergenic
969319377 4:6402579-6402601 GGCCAGGAGTAGGTGGGACATGG + Intronic
969453667 4:7288871-7288893 TTCCTGGAGGAGGTGGTACCTGG - Intronic
969583219 4:8077432-8077454 TTCCTGGAGGAGGTGGCACTGGG + Intronic
969620507 4:8276542-8276564 TTCCTGTAAGAGGAGGGCCAGGG + Intronic
969688070 4:8688027-8688049 TTCCTGGGATGTGTGGGGCAGGG + Intergenic
972628948 4:40827076-40827098 GTCCTGGACCAGGAGGGACAGGG + Intronic
975983364 4:80183422-80183444 TTCCTGGAGTGGGATGGACAAGG + Intergenic
976727393 4:88228029-88228051 TTCCTGGAGTATATGGGTCAAGG - Intronic
980351390 4:131689437-131689459 TTCCCGGAAGTGGAGGGACAAGG - Intergenic
981667768 4:147249107-147249129 TTCCTTCAATAAGTTGGACAGGG - Intergenic
985888555 5:2698832-2698854 TTCCTAGAGTGGGTGGAACAGGG + Intergenic
989527430 5:42469205-42469227 TCACTGGAATAGGTGGGTCCAGG + Intronic
990790237 5:59469577-59469599 GCTCTGGAATAGGTGGGAGAAGG + Intronic
993000981 5:82380059-82380081 TGCCTGGAGTGGCTGGGACATGG + Intronic
996166311 5:120228399-120228421 TGCCTGGAATGGGTGGGGCGGGG + Intergenic
998953424 5:147414400-147414422 TTACAGAAATAGGTGGGACTGGG + Intronic
999912590 5:156220742-156220764 TTGCAGGAAAAGGTGGGAGAGGG - Intronic
1001210734 5:169807942-169807964 TTCATGGGATAGAAGGGACATGG + Intronic
1001334735 5:170787913-170787935 TTCCTGGTAAAGCTGGGACAAGG + Intronic
1002863565 6:1101370-1101392 TTCGTGGAAGAGGTGGAACTTGG + Intergenic
1003073200 6:2960621-2960643 TTCCTGGAGCAGATGGGAGAGGG + Exonic
1003258126 6:4491470-4491492 CTCATGCAATATGTGGGACATGG + Intergenic
1004521861 6:16368664-16368686 TTCCTTGAATATGTGTGACTTGG - Intronic
1007461607 6:42023135-42023157 TTCCTGGCTGAGGTGGGACAGGG + Intronic
1007617422 6:43188503-43188525 TTTCTGAAATTGGTGGGAAAAGG - Exonic
1008563357 6:52743513-52743535 TTCCTTGAGTGGGTGGGACATGG - Intergenic
1010339381 6:74730723-74730745 TTCATGGAATTGGTGGCAAAGGG + Intergenic
1014949568 6:127538958-127538980 TTCCAGGAATAGCTGGAACCAGG + Intronic
1015461095 6:133492053-133492075 TTTCTGGAATAGTTTGGGCAGGG - Intronic
1016206774 6:141477245-141477267 TTCCTGGAATACATGCGACTTGG - Intergenic
1017468983 6:154721042-154721064 TTCCTGGAATATGGTGGACTGGG - Intergenic
1019025721 6:168961306-168961328 ATCCTGGAAGACCTGGGACAAGG + Intergenic
1019070887 6:169343895-169343917 TTCATGGAAGATGTGGGATAGGG - Intergenic
1019613346 7:1947876-1947898 TTCCTGGAATAGGTGGGACACGG - Intronic
1021405983 7:20267632-20267654 TTGCTGCATGAGGTGGGACATGG + Intergenic
1022392425 7:29955128-29955150 TTCCTAGAAAAGGTTGGAAATGG - Intronic
1026071532 7:67125470-67125492 TGCATGGAATAGGGGGGATATGG - Intronic
1026178758 7:68020524-68020546 GTGCTGGAATAGGCCGGACATGG + Intergenic
1026705362 7:72686796-72686818 TGCATGGAATAGGGGGGATATGG + Intronic
1028896561 7:96048131-96048153 GTCCTGTAAGAGATGGGACAGGG + Intronic
1028922063 7:96320452-96320474 TCCCTAGAGTAGGTGGGACTAGG - Intronic
1029438913 7:100576891-100576913 TAGCTGGACCAGGTGGGACAGGG - Exonic
1030244339 7:107365056-107365078 TTCCTGGAATATGTATGACTTGG + Intronic
1035609266 8:949178-949200 TTCCTGGAGTAGATGGGATCAGG + Intergenic
1036053477 8:5225925-5225947 TTTCTGGAATTTATGGGACAGGG - Intergenic
1036776515 8:11616668-11616690 TTCCTTGGAGAGCTGGGACAGGG - Intergenic
1040852889 8:51920221-51920243 TCCCGGGGATAGGTGGGTCAAGG - Intergenic
1047423553 8:124727034-124727056 TTCCTGCAAAGGGTGGGACTGGG - Intronic
1049242198 8:141543712-141543734 TTCCTGGAAGAGGGGAGAGATGG + Intergenic
1049312512 8:141940817-141940839 GTCCAGGCCTAGGTGGGACAGGG - Intergenic
1049710173 8:144059851-144059873 ATCCTGGAGCAGGTGGGCCAGGG - Exonic
1050416886 9:5427789-5427811 TTTCTGGAAAAGGAGGGACAAGG + Intronic
1050631479 9:7563096-7563118 CTCCTAGAATAGGTAGGCCAAGG + Intergenic
1051537379 9:18175694-18175716 TTCCTGGAGCAGGTAGGACTTGG - Intergenic
1051593050 9:18795902-18795924 TTCTTGCAACAGGTGGAACAAGG - Intronic
1053781325 9:41610273-41610295 TTCCCGGAAGTGGAGGGACAAGG + Intergenic
1054169271 9:61820425-61820447 TTCCCGGAAGTGGAGGGACAAGG + Intergenic
1054668263 9:67760390-67760412 TTCCCGGAAGTGGAGGGACAAGG - Intergenic
1055310597 9:74975688-74975710 TTTCTGGATTAGGAAGGACAAGG + Intergenic
1057565962 9:96166564-96166586 CCCCTGGAAAGGGTGGGACAAGG + Intergenic
1058574300 9:106383437-106383459 TTCCTGGAGCAGATGGGGCATGG - Intergenic
1058985921 9:110208140-110208162 TTCCTGGCAGAGCTGGGACTGGG + Exonic
1059407850 9:114112993-114113015 TTCCTGGAAGAGGTGGCATTGGG + Intergenic
1060196686 9:121628596-121628618 TTCCCGGAAGAGGTGGGACTGGG + Intronic
1061679856 9:132237632-132237654 CTCCTGGAGTAGCTGGGTCAAGG + Intronic
1062041426 9:134405970-134405992 TTCCTGGAGGAGATGGGCCAGGG - Intronic
1062277615 9:135738158-135738180 TTCCTGGAGGAGGTGGGCCTAGG - Intronic
1062535237 9:137018464-137018486 GTCCAGGGAAAGGTGGGACAGGG + Intronic
1185530820 X:816987-817009 TTACTGGGAGAGGTGGGACTGGG + Intergenic
1189323934 X:40101846-40101868 GTACTGGAACAGGTGGGACTCGG + Intronic
1189452874 X:41155849-41155871 TTTCTGGAATAGGATGGTCAAGG - Intronic
1192166106 X:68828672-68828694 TTCCTGGGGTACTTGGGACAGGG + Intergenic
1193211734 X:78814438-78814460 TTCCTGTAATAACTGGAACAAGG + Intergenic
1198222369 X:134614089-134614111 TTCCTGGAGGAGGTGGGCCCTGG - Intronic
1199575063 X:149306121-149306143 TTCCAGTAATGGGGGGGACATGG + Intergenic
1200143710 X:153914760-153914782 TCCCTGGAAGAGGTGGGGCTGGG - Intronic
1200814696 Y:7519155-7519177 TTCCAGGAATTGGTGGAAAAGGG - Intergenic