ID: 1019613980

View in Genome Browser
Species Human (GRCh38)
Location 7:1950625-1950647
Sequence GCAGCTGGGGGCAGACATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019613980_1019613985 5 Left 1019613980 7:1950625-1950647 CCTCAATGTCTGCCCCCAGCTGC 0: 1
1: 0
2: 2
3: 38
4: 363
Right 1019613985 7:1950653-1950675 TCACCTCCTCCCCTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019613980 Original CRISPR GCAGCTGGGGGCAGACATTG AGG (reversed) Intronic
900415611 1:2533143-2533165 GCTGCTGGGGGCAGCCAAGGTGG - Intergenic
901220828 1:7582947-7582969 GCAGCTAGGGGCAGACAGACAGG - Intronic
901399824 1:9008095-9008117 GCAGTTGGGAGCAGAGATGGTGG - Intronic
901466023 1:9421770-9421792 CCAGCTGGGGGCAGGCAGAGGGG - Intergenic
901728216 1:11259216-11259238 GGATCTGGGGCCAGTCATTGTGG - Intronic
901846940 1:11989300-11989322 GCAGCTGGGGGCCTACATCCAGG + Exonic
902205502 1:14865466-14865488 GCAGCAGATGGCAGACATGGGGG - Intronic
902802712 1:18840267-18840289 GCTGCTGGTGGCATACATGGTGG - Exonic
903215611 1:21841953-21841975 CAAGCTGGGGGCAGGCATGGGGG - Intronic
904012971 1:27400476-27400498 GAAGCTGAAGGCAGGCATTGGGG - Intergenic
904446485 1:30576993-30577015 GCAGGTGGGGGCAGCCCTTGGGG - Intergenic
906648105 1:47490618-47490640 GTAGCTGGGGGCAGAGATTGTGG - Intergenic
907416897 1:54320704-54320726 GGAACTGGGGGCAGACACAGAGG + Intronic
908766869 1:67562116-67562138 GCAGCTGGGGCCAGTGATAGCGG - Intergenic
912746151 1:112247239-112247261 GCAGCTGTGGACAGATACTGGGG + Intergenic
915598556 1:156908636-156908658 GCAGCTGGGGGCAGAGGCGGGGG - Exonic
916025542 1:160830441-160830463 GCAGCTGAGGGCTGAGAATGAGG - Intronic
917527239 1:175799511-175799533 GCAGATTGGTGCAGCCATTGTGG + Intergenic
917976569 1:180243655-180243677 GTAGCTGGGGGAGGAGATTGTGG + Intronic
918276702 1:182959754-182959776 GCAGCTGGAGACAGAGATCGAGG - Intergenic
920450974 1:206060878-206060900 GAAACTGGGGGCAGAGATTGGGG + Intronic
922874778 1:228931896-228931918 GCTGCTGTGGGCAGAAGTTGAGG + Intergenic
923200024 1:231702702-231702724 GCAGATGAGGGCTGACATGGGGG + Intronic
1064346823 10:14540304-14540326 GCCCTTGGGGACAGACATTGAGG - Intronic
1065559323 10:26946303-26946325 CCAGCTTGGGGCTGGCATTGGGG + Intergenic
1066727057 10:38404945-38404967 GCAGCTGAGATCAGACTTTGTGG - Intergenic
1067067200 10:43110807-43110829 GCAGCTGGGAGCAGCCAGGGAGG + Intronic
1067099687 10:43325592-43325614 GATGGTGGGAGCAGACATTGGGG - Intergenic
1069267690 10:66483074-66483096 GTAGCTGGGGGAAGACTTGGAGG + Intronic
1069635271 10:69921237-69921259 GGAGATGGAGGCAGAGATTGGGG - Intronic
1069636060 10:69925702-69925724 GCAGCTAGGTGCAGCCAGTGTGG + Intronic
1070358419 10:75663210-75663232 GAAGCTGCTGGCAGACATAGGGG - Intronic
1071612694 10:87045953-87045975 GGAGCTGGGGCCAGGCATGGTGG - Intergenic
1073065474 10:100756273-100756295 GAAGCTGGGAGCGGACAATGGGG - Intronic
1073152531 10:101321688-101321710 GCTGCTGGGGCCAGGCATCGGGG + Intergenic
1074426182 10:113353555-113353577 GAAGCTGAAGGCAGAGATTGGGG + Intergenic
1075504326 10:123008901-123008923 GCAGCAGGGGGCAGGGATTAAGG + Intergenic
1076302090 10:129436158-129436180 GCATCTGTGTGCAGACACTGTGG + Intergenic
1076691635 10:132226646-132226668 ACAGCTGGGGGCAGGCACTCAGG + Intronic
1077072617 11:682976-682998 GGAGCTGGGGGCAGAAAGGGAGG + Intronic
1077842933 11:5994551-5994573 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1078838916 11:15059273-15059295 GCAGCTGGGGGCAGCAAGAGTGG + Intronic
1079051718 11:17166712-17166734 GAACCTGGAGACAGACATTGGGG - Intronic
1079078191 11:17396554-17396576 GGACCTGGGGGCAGACAGCGAGG - Intronic
1080827566 11:35860923-35860945 GCAGCTGGAGACAGAGATTGAGG - Intergenic
1081471998 11:43383182-43383204 GAAACTGGGGCCAGACATGGTGG - Intronic
1082796480 11:57381508-57381530 GGAGCTGGTGGGAGACAATGGGG + Intergenic
1082801971 11:57421429-57421451 GCAGGTGGGAGCAGAGTTTGGGG - Intronic
1083332200 11:61904154-61904176 GGAGCAAGGGGCAGAAATTGGGG - Intronic
1083424968 11:62578795-62578817 GAAGCTGGAGGCAGAGACTGGGG + Exonic
1083887425 11:65579643-65579665 GCAGCTGGGACCAGAACTTGGGG + Intronic
1085732926 11:79014509-79014531 GCTGCTGAAGGCAGACATTAAGG - Intronic
1086418025 11:86608578-86608600 GCAGCTGCTGGCAGAACTTGTGG + Intronic
1089214841 11:116829277-116829299 GCAGCGGGGGGCACACAGGGTGG + Intergenic
1089973128 11:122710577-122710599 GCTTCTGGAGGCAGAGATTGAGG - Intronic
1090075153 11:123576027-123576049 GGAGCTGGGGGCAGGCAGTGCGG - Intronic
1091396541 12:157006-157028 GCAGCTGAGGGCAGGCAGGGAGG - Exonic
1091450379 12:569087-569109 GGTGCTGGGGGCAGCCAGTGAGG + Intronic
1091747033 12:2999239-2999261 GCAGCTGGGGGCTCAGAATGGGG - Intronic
1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG + Intronic
1092412438 12:8264110-8264132 CCTGCTGGGTGCAGACATGGTGG + Intergenic
1093050367 12:14497702-14497724 GCTTCTGGGGGCAGACGCTGTGG - Exonic
1094604641 12:31939849-31939871 GCAGTTGGGGCCAGGCATGGTGG + Intergenic
1095812192 12:46383299-46383321 GCAGCCGGGCCCCGACATTGCGG - Intergenic
1096070304 12:48771760-48771782 GGAGCTGGAGGCAAACAATGAGG - Exonic
1096191225 12:49621579-49621601 GCAACTGGGGGAAGAATTTGAGG + Intronic
1096634715 12:52950840-52950862 GCAGCTGGAGACAGAGATCGAGG + Exonic
1097381517 12:58900942-58900964 GCAGCTGGTGGCAGCTACTGTGG + Intronic
1097428449 12:59474188-59474210 TCAGATGGTAGCAGACATTGAGG - Intergenic
1097994239 12:65870441-65870463 ACAGCTGGGGGCAGGCGTGGTGG + Intronic
1101238433 12:102813557-102813579 GAAGTTAAGGGCAGACATTGTGG - Intergenic
1101468982 12:104977428-104977450 GCAGCTGGAGACAGAGATTGAGG - Intergenic
1101603587 12:106231481-106231503 GCAGCTGGGAGGAGACATACAGG - Intergenic
1101842132 12:108335387-108335409 GCACCTGGCTGCAGACAATGAGG + Intronic
1101909537 12:108850844-108850866 GCAGTTGGGGGCAGGCATCTGGG + Intronic
1104577335 12:129979905-129979927 GAAGTTGGGGGCAGAGATAGGGG + Intergenic
1104585081 12:130042128-130042150 GCAGCTGGGAGCAGACTCTGCGG - Intergenic
1104832178 12:131760784-131760806 GTTGCTGGGGCCAGACATGGTGG + Intronic
1106013468 13:25846518-25846540 GCAGTTGGGGGGAGATATTGCGG + Intronic
1106565946 13:30884806-30884828 GCAGCAGGGGGCAGACAACATGG - Intergenic
1108498346 13:51046140-51046162 GGAGATGGGGACAGAGATTGGGG + Intergenic
1109801082 13:67379842-67379864 TCAGCTGGGGGCAGTCAGAGAGG + Intergenic
1110995303 13:82100330-82100352 GAAACTGGGGGCAGAGAGTGTGG - Intergenic
1115120089 14:29927914-29927936 GGAGCTGGGGGCGGGCACTGGGG + Intronic
1115662681 14:35512475-35512497 GCAGCTGGAGACAGAGATGGAGG - Intergenic
1117034768 14:51716663-51716685 GCAGTTTGTGGCAGACAGTGAGG - Intronic
1117937264 14:60920124-60920146 GAGGCTGGGGGCGGCCATTGGGG + Intronic
1118348018 14:64953866-64953888 GCAGCTGGTGGCAGACGGTTCGG - Intronic
1119399524 14:74353001-74353023 GCATCTGGGGCCAGGCATGGTGG + Intronic
1119772894 14:77232207-77232229 GCAGGTGTGGGTAAACATTGTGG - Intronic
1119853449 14:77882416-77882438 GCATCTGGAGCCAGACATTTCGG + Intronic
1121730277 14:96182017-96182039 GAAGCTGGGGGGAGACCTGGGGG - Intergenic
1121781423 14:96624737-96624759 GCAGGTGGGGACAGACAGAGTGG + Intergenic
1121857806 14:97286297-97286319 GAAGATGGAGGCAGAGATTGGGG + Intergenic
1122548750 14:102538960-102538982 GCAGCTGGGGCCAGGCCTGGAGG - Intergenic
1122921331 14:104881595-104881617 GCAGCTGGTGACAGCCAGTGTGG + Intronic
1122956383 14:105073442-105073464 GCTGCTGGGGGCAGAAAAAGGGG + Intergenic
1126824113 15:52531890-52531912 GAAGATGAGGGCAGAGATTGGGG - Intergenic
1128221420 15:65971424-65971446 CAAGGTGGGGGCAGAGATTGGGG - Intronic
1129289719 15:74555617-74555639 GCAACTGGGGCCAGGCATGGTGG - Intronic
1129694544 15:77733197-77733219 GCAGCTGAGGGCAGTTACTGTGG + Intronic
1129924353 15:79349678-79349700 GGAGCTGGGAGGAGACAATGAGG - Intronic
1130107368 15:80939075-80939097 CCAGCTGGGGGCAGACAAGCTGG + Intronic
1130209337 15:81908974-81908996 GCTGCTGAGGGCTGACCTTGGGG - Intergenic
1130223842 15:82043792-82043814 GCAGCTCGGGGCAGCCGTCGGGG + Exonic
1131508361 15:93035363-93035385 GCAGCTGGGAAGAGAGATTGGGG + Intronic
1132877083 16:2144722-2144744 GGAGCTGGGGGCGGAGAGTGAGG - Intronic
1133669520 16:8004512-8004534 GAAGCTGGGAGCAGAGATGGGGG + Intergenic
1134564639 16:15240650-15240672 CCAGATGGAGGCAGAGATTGGGG - Intergenic
1134568886 16:15274652-15274674 GCATCTGTGGGCAGACATTTGGG - Intergenic
1134733549 16:16481710-16481732 GCATCTGTGGGCAGACATTTGGG + Intergenic
1134737858 16:16516049-16516071 CCAGATGGAGGCAGAGATTGGGG + Intergenic
1134933951 16:18230572-18230594 GCATCTGTGGGCAGACATTTGGG - Intergenic
1135710988 16:24716877-24716899 GAACCTGGGGGCAGAGGTTGCGG + Intergenic
1135980771 16:27145161-27145183 GCAGCTGGGGCCAGAGGCTGGGG - Intergenic
1136109016 16:28053012-28053034 GCAGAGGGGGGCAGAGAGTGTGG + Intronic
1137024257 16:35457131-35457153 GCAGCTGGGGTCTCACTTTGAGG + Intergenic
1138056220 16:53836798-53836820 AAAGCTGGGGGCAGTCATTTGGG - Intronic
1138251291 16:55503749-55503771 GCAGGCAGGGGCAGACAGTGGGG + Intronic
1140035359 16:71367599-71367621 GCAGCTGATGGCAGACAGTGAGG - Intronic
1140323511 16:73977455-73977477 GCAGCTGGTGGCAGCCATGCTGG - Intergenic
1141995111 16:87631942-87631964 GCAGGTGGGAGAAGACATCGAGG - Intronic
1142228052 16:88886995-88887017 GCAGCTCTGGGAAGACTTTGGGG - Intronic
1142708083 17:1709055-1709077 CCAGCTGGGGGCAGAGACTGTGG + Intronic
1143631683 17:8143612-8143634 GCAGCTGGGGGCACAGATGTGGG + Exonic
1143929000 17:10400746-10400768 GGAGCTGGGGGAAGAAATCGAGG - Exonic
1146053273 17:29568564-29568586 GCTGCTGTGGGCGGGCATTGGGG + Intronic
1146439941 17:32885152-32885174 CCAGGTAGGTGCAGACATTGTGG - Intergenic
1146463848 17:33069922-33069944 GCAGTTGGAGGCAGAAAATGAGG - Intronic
1147659406 17:42109326-42109348 GCAGCTGGGGGCAGCAGTTCTGG + Exonic
1147965248 17:44191202-44191224 GGTGCTGGGGGCAGACATGCAGG - Exonic
1148135549 17:45289463-45289485 GAAGCTGGGGAGAGACAGTGCGG - Intronic
1148244894 17:46024250-46024272 GCAGCTGGGGGCAGAGGGCGGGG - Exonic
1148442223 17:47717304-47717326 GCAGCTGGAGGCAGCCAATGAGG + Intergenic
1148818883 17:50348887-50348909 GCTGCTGGGGGCAGCCTGTGAGG + Intronic
1150316298 17:64171900-64171922 GAACCTGGGGGCAGAGGTTGCGG + Intronic
1152538723 17:80964208-80964230 TCAGGTGCGGGCAGACACTGCGG - Intronic
1153167509 18:2279540-2279562 GGTGCTGGGGGAAGACAGTGAGG + Intergenic
1153907859 18:9678924-9678946 GCAGCTGGAGACAGAGATTGAGG - Intergenic
1154078015 18:11224277-11224299 GCAGCTGGCTGTAGACATGGTGG - Intergenic
1155164338 18:23220458-23220480 GTAGGTGGGGGCAGGCAGTGTGG + Intronic
1155453415 18:25986513-25986535 TGAGCTGGAGGCAGACATTTGGG - Intergenic
1157501802 18:48196004-48196026 GCTGGTGGGAGCAGACATGGTGG + Intronic
1157931994 18:51833435-51833457 GCAGCAGGGGGAAGACAGTGTGG + Intergenic
1159205154 18:65240861-65240883 GCAGCTTGGGGAAAACAGTGCGG - Intergenic
1159609412 18:70509465-70509487 AAAGCTGGGTGCAGACTTTGTGG + Intergenic
1160525254 18:79532096-79532118 GAAGCTAGGGGCAGGCATTGAGG - Intergenic
1160659913 19:293098-293120 GGAGCGGGGGGAAGACAGTGGGG + Intergenic
1160901775 19:1432452-1432474 GCAGCTGGGGGCAGACCAGCAGG - Intronic
1161252745 19:3289913-3289935 GTATCTGGGGTCAGAGATTGAGG + Intronic
1161442887 19:4302434-4302456 GCAGCGGGAGGCGGAGATTGTGG - Intergenic
1161740646 19:6019001-6019023 GCGGCAGGAGGCAGACTTTGTGG - Intronic
1161767648 19:6216169-6216191 CCAGATGGGGGCAGCCCTTGAGG + Intronic
1162042001 19:7976496-7976518 GAAGATGGAGGCAGACACTGGGG + Intronic
1162334708 19:10053146-10053168 ACAGCTGGGGGATGACGTTGGGG - Intergenic
1162930841 19:13956728-13956750 GCTGCTGGAGGCAGCCATGGTGG - Intronic
1163100050 19:15090045-15090067 GAAGATGGAGGCAGAGATTGGGG + Intergenic
1163162451 19:15472608-15472630 GGAGGTGGGGGCAGGCATGGTGG + Intronic
1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG + Exonic
1164697390 19:30256012-30256034 GCAGCTGGCGGCAGCCTCTGTGG + Intronic
1164859679 19:31553145-31553167 GGAGGTGGGGACAGACATTAGGG - Intergenic
1165406886 19:35636576-35636598 TCAGCTGGGTGCAGCCATGGCGG + Intronic
1165795606 19:38517414-38517436 GCGGCTCATGGCAGACATTGGGG + Exonic
1165918750 19:39278511-39278533 GCAGCTGGGGGTAGACCAGGTGG + Intergenic
1166071551 19:40390820-40390842 GCAGCTTGGGGGAGATGTTGAGG + Intergenic
1166660681 19:44644671-44644693 GCCCCTGGAGTCAGACATTGGGG - Intronic
1166784702 19:45360663-45360685 TTAGCTGGGGCCAGACATGGTGG - Intronic
1167090657 19:47341495-47341517 GCCGCTGGGCACAGCCATTGTGG + Exonic
1167291112 19:48625730-48625752 ACAGGTGTGGGCAGACCTTGAGG - Intronic
1167295318 19:48646104-48646126 GAAGCTGGAGGCCGACACTGAGG - Exonic
1167533450 19:50033379-50033401 GCAGCTGGGGCCAGATCTTTAGG + Intronic
1167660772 19:50794810-50794832 GCAGGTGGGCGGAGTCATTGCGG - Exonic
1167979345 19:53260159-53260181 GCAGATGGGGCCAGGCATGGTGG + Intronic
925203233 2:1985889-1985911 GAGGCTGGGGGCACCCATTGAGG - Intronic
925673824 2:6339382-6339404 TCAGCTGAGGGCAGACCTTACGG + Intergenic
927516513 2:23674878-23674900 GCAGATGGGAGCAGACAGAGGGG - Intronic
929542843 2:42835465-42835487 GAGGCAGAGGGCAGACATTGTGG + Intergenic
929543220 2:42838270-42838292 GAGGCAGAGGGCAGACATTGTGG + Intergenic
929594495 2:43167902-43167924 GCTGCTGGGGGCAGGGACTGTGG + Intergenic
929995980 2:46826455-46826477 GTGGCTTGGGGCAGACAGTGAGG + Intronic
930227254 2:48806350-48806372 GGAGGTGGGGGCAAACAATGTGG + Intergenic
931135582 2:59395898-59395920 GCACCTGGGTTCAGACATTAGGG - Intergenic
931567504 2:63629746-63629768 CCAGCTGAGGGTAGACATTTAGG - Intronic
931758907 2:65399189-65399211 GAAGCTGGAGGCAGAGGTTGCGG + Intronic
932759534 2:74430316-74430338 GCAGCTGGGGGAACACATCCAGG - Exonic
933124739 2:78590512-78590534 GAAGATGGAGGCAGAGATTGGGG + Intergenic
934665039 2:96163976-96163998 GCAGCTGGGGGCGGAGGCTGGGG - Intergenic
935184875 2:100722937-100722959 GGAGTTGGGGGCAGACGTGGAGG - Intergenic
937307596 2:120881716-120881738 GCAGGTGGGGGAGGACAGTGCGG + Intronic
937543537 2:122988624-122988646 GGAGCTGGGGCCACACTTTGGGG + Intergenic
939365515 2:141225328-141225350 GCAGCTGGGGGATGACAATATGG + Intronic
941125693 2:161580658-161580680 GCAGCTGGAGGCAGAGATCAAGG + Intronic
941404788 2:165074777-165074799 GCAGCTGGAGGCAGACAGACAGG + Intergenic
942168681 2:173267892-173267914 GCAGCTTAGGGCAGAAATGGTGG + Exonic
943548660 2:189311928-189311950 GCAGCTGGAGACAGAGATCGAGG - Intergenic
943847647 2:192672713-192672735 GCAGCTGGGGGCAGCAGCTGAGG + Intergenic
944576013 2:201091849-201091871 GCAGCTGGGGCCAGGCACAGTGG + Intergenic
945245311 2:207711926-207711948 CCAGCTTGGGGCTGGCATTGGGG - Exonic
945776069 2:214107801-214107823 GCTGCTGGGGGTAGGCAGTGGGG - Intronic
947583338 2:231335486-231335508 GGAGCTGTGGGTAGACTTTGAGG - Intronic
947766812 2:232643229-232643251 CCAGCTTGGGGCACACATAGAGG - Intronic
948330351 2:237159825-237159847 GCAGCTGGGAGCAGGAAGTGAGG + Intergenic
948665300 2:239530824-239530846 TCGGCTGGGGGCAGAGAATGAGG + Intergenic
948672626 2:239578205-239578227 GCAGTTGGGGGTAGAAAATGGGG + Intergenic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
1168916346 20:1491330-1491352 GCAGGTGGGGGCCGACATCGTGG + Exonic
1169031368 20:2410308-2410330 CCAGGTTGGGGAAGACATTGAGG + Intronic
1169225463 20:3853864-3853886 GAACCTGGGGGCAGAGGTTGCGG - Intronic
1170773706 20:19357155-19357177 GAAGGTGGAGGCAGAGATTGGGG + Intronic
1171437362 20:25133786-25133808 GCTGGAGGGGGCAGAGATTGTGG - Intergenic
1172871375 20:38137540-38137562 GCAGCTGGTGGCAGCCATGCTGG + Intronic
1172903807 20:38354370-38354392 GCAGCTGGAGGCAGTAACTGTGG - Exonic
1172908036 20:38383977-38383999 GCAGCTGGGGGCAGGAGGTGAGG - Intergenic
1173844318 20:46178405-46178427 GCAGCTGAGGGTAGACTTTGGGG - Intronic
1173881251 20:46414130-46414152 GCAGCTGGTTGCAGACACTAAGG + Intronic
1173985725 20:47259949-47259971 GCAGCTGGAGGCAGGAATTAGGG - Intronic
1174017424 20:47500167-47500189 GAACCTGGGGGCAGAGGTTGCGG - Intergenic
1174349587 20:49957333-49957355 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1174480268 20:50826296-50826318 GGAGCTGGGGTGAGACAATGGGG + Intronic
1175504766 20:59473734-59473756 GCAACTGGGGACAGAAATTAGGG + Intergenic
1175670019 20:60893913-60893935 GCAGTGGGGGGAAGAAATTGAGG + Intergenic
1176049167 20:63107604-63107626 GGTGCTGGGGTCAGACAATGCGG + Intergenic
1176276538 20:64273680-64273702 TCACCTGGAGGCAGACGTTGTGG + Exonic
1176379913 21:6107260-6107282 GCAGCTTTGTGCAGACACTGGGG - Intergenic
1178484966 21:33013327-33013349 CCAGATGGGGGCAGAGATGGAGG - Intergenic
1178511876 21:33212147-33212169 GCAGCTGGAGGCAGATGTGGGGG - Intergenic
1179025240 21:37674162-37674184 TCAGCTGAGAGCTGACATTGGGG - Intronic
1179418848 21:41219969-41219991 GAAGCTGGGGGCAGTCTTGGGGG - Intronic
1179510937 21:41873110-41873132 GCAGCTGCTGTCAGACCTTGAGG - Intronic
1179726214 21:43342919-43342941 CCACCTGGGGGCTGACAATGGGG + Intergenic
1179743561 21:43430978-43431000 GCAGCTTTGTGCAGACACTGGGG + Intergenic
1179801747 21:43814528-43814550 GGAGCTGGGAGCAGAAATTCAGG - Intergenic
1179903013 21:44403424-44403446 GCAGCTGGCGCCTGACATTGAGG + Intronic
1179991864 21:44952513-44952535 GCAGCTGGGGCCAGACCTGCAGG - Intronic
1180801569 22:18634370-18634392 GGAGCTGGGCGCCGAGATTGAGG + Intergenic
1181006302 22:20015294-20015316 ACAGCTGGGAGCAGACATTGCGG + Intronic
1181220153 22:21360891-21360913 GGAGCTGGGCGCCGAGATTGAGG - Intergenic
1182330697 22:29549768-29549790 GCAGCTAGGAGCAGAGGTTGGGG - Intronic
1182452879 22:30431677-30431699 GCATCTGGTGGTAGACAGTGGGG - Intergenic
1182960968 22:34474843-34474865 GCAGCTGGAGGTAGGCATTCAGG + Intergenic
1183063454 22:35348963-35348985 GCAGCTGGGGGCAGGCACACTGG + Intergenic
1184021912 22:41826689-41826711 GCAGCTTAGGGCAGCCATTGCGG - Intergenic
1185219434 22:49622118-49622140 GCAGCTGGGGGCAGGCCCTGGGG - Intronic
1185421763 22:50738816-50738838 GCAGCCAGGGGCAGATACTGTGG - Intronic
952319142 3:32259528-32259550 GCAGCTGGAGACAGAGATCGAGG + Intronic
952883958 3:38001677-38001699 GCAGGTGGGGGCAGTGAGTGAGG - Intronic
953450461 3:43001176-43001198 TGAGCAGGGCGCAGACATTGTGG + Intronic
954135445 3:48580158-48580180 CCTGCTGGGGGCTGGCATTGGGG - Intronic
955101037 3:55850113-55850135 GAAGTTGGAGGCAGAGATTGTGG - Intronic
955234372 3:57126527-57126549 GCAGCTAGGGGCAGCCATGAAGG + Intronic
955881444 3:63550863-63550885 GTAGCTGGGGGCCCCCATTGTGG - Intronic
957057652 3:75456338-75456360 CCTGCTGGGTGCAGACACTGTGG + Intergenic
960584821 3:119311045-119311067 GGAGCTGGAGGCAGACAGAGGGG - Intronic
961143531 3:124575312-124575334 GCAGCTGGGGGCAAGCAACGGGG - Intronic
961295803 3:125883392-125883414 CCTGCTGGGTGCAGACACTGTGG - Intergenic
962065133 3:131971696-131971718 CCATCTGGGGGCAGTCAATGGGG + Intronic
962421900 3:135236257-135236279 GAAGATGGAGGCAGAGATTGGGG - Intronic
963239035 3:142984549-142984571 GGAGCTGGGGTAAGACACTGAGG + Intronic
964368438 3:155973523-155973545 GCAGATGAAGGCAGAGATTGAGG - Intergenic
964927308 3:161975098-161975120 GCAGCTTGGTGCAGACATGAAGG - Intergenic
965370726 3:167858945-167858967 GCGGCTGGGGGCAGATGTTGAGG + Intergenic
965544707 3:169903645-169903667 GCAGCTGGAGACAGAGATTGAGG - Intergenic
965916942 3:173860788-173860810 GCAGTTAGAGGCAGACACTGTGG - Intronic
968762512 4:2449939-2449961 GCTGCTGAGGGCAAACATCGAGG + Exonic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969309850 4:6346899-6346921 GGTGCTGGGGACAGACAGTGAGG + Intronic
969475517 4:7420533-7420555 GCAGCTGGAGGCAGACCTCATGG + Intronic
969597387 4:8157160-8157182 GCAGTTGGGGGCAGAGACTGGGG - Intronic
969753542 4:9131917-9131939 CCTGCTGGGTGCAGACACTGTGG - Intergenic
969813444 4:9668102-9668124 CCTGCTGGGTGCAGACACTGTGG - Intergenic
972538722 4:40020830-40020852 GCAGCTGGAGACAGAGATCGAGG + Intergenic
972569233 4:40295447-40295469 GGAGCTGGAGGCAGAGATGGAGG - Intergenic
977565896 4:98580266-98580288 GCAGATGGGGGCAGATGATGTGG + Intronic
977942546 4:102874545-102874567 GAAGATGGAGGCAGAGATTGGGG + Intronic
981422966 4:144572286-144572308 GTAGCTGGAGGCAGAGATTGAGG + Intergenic
981725623 4:147844104-147844126 GCAGCTGGGAGCACACACTAAGG - Intronic
982106245 4:152014357-152014379 CCAGCTGGGGGCAGAGATAAGGG - Intergenic
982217058 4:153091663-153091685 GCAGGTGGGGCCAGACACAGTGG + Intergenic
982466568 4:155740164-155740186 ATAGCTGGGGGCAGAGATTTTGG + Intergenic
982496904 4:156105563-156105585 GCCGCTGCGGGCAGACATGAGGG + Intergenic
984539927 4:181024630-181024652 GAAGATGGGGGCAGAGATTGAGG - Intergenic
985003666 4:185511437-185511459 GAAGCTGGAGGCAGAGGTTGCGG - Intronic
985034473 4:185824282-185824304 GCAGATGGAGGCAGAGATTGGGG - Intronic
985144811 4:186885602-186885624 GCTGCTGGGCACAGACATGGTGG + Intergenic
985495786 5:204289-204311 GCACCTGGGGGCTGGCCTTGGGG + Exonic
985968074 5:3352845-3352867 GCAGATGGAGGCAGAGATGGGGG - Intergenic
985993545 5:3583606-3583628 GAAGCTGAAGGCAGAGATTGGGG + Intergenic
986671158 5:10144204-10144226 GGAGATGGAGGCAGAGATTGGGG - Intergenic
987035813 5:14017311-14017333 GTTGCTGGGGGCAGTCATGGAGG - Intergenic
989714819 5:44450690-44450712 ACAACTGTGGGGAGACATTGGGG - Intergenic
992083875 5:73260500-73260522 GCAGATGAAGGCAGATATTGAGG + Intergenic
992800215 5:80289014-80289036 GCAGCTGGAGACAGAGATTGAGG + Intergenic
994149509 5:96432254-96432276 GAAGCTGGGGGGAGAAATGGTGG - Intronic
995864969 5:116680923-116680945 GTAGGTGGGGGAAGACATTGTGG + Intergenic
996452057 5:123636697-123636719 GCAGCTGGAGACAGAGATCGAGG + Intergenic
996762923 5:127003988-127004010 GAGGCTGGGGGCAGCCAGTGAGG + Intronic
998527492 5:142856202-142856224 GGAGCTGTGGGCACACAGTGGGG + Intronic
999277136 5:150338891-150338913 GCAGCTGGGGATAGACAGGGTGG - Intronic
1000197308 5:158972186-158972208 GCAGCTGGGGACACAGATTGAGG - Intronic
1001396391 5:171421708-171421730 TGAGCTGGGGGCATCCATTGGGG + Intronic
1002167933 5:177359585-177359607 GGAACTGGGGGCAGACCTTGGGG - Intronic
1002196161 5:177502757-177502779 GCAGCTGTGTGCAGGCACTGAGG + Intronic
1002522618 5:179800050-179800072 GCAGCTGGAGGATGACATCGTGG - Exonic
1002562233 5:180090378-180090400 GCAGCTGAGGCCAGACCTGGGGG + Intergenic
1002668483 5:180845736-180845758 TTAGCTGAAGGCAGACATTGGGG - Intergenic
1004320296 6:14626700-14626722 GAAGGTGGAGGCAGAGATTGGGG - Intergenic
1004447122 6:15710564-15710586 GGAGATGAAGGCAGACATTGGGG + Intergenic
1004929394 6:20447217-20447239 GCAGCTTGGGACAGATGTTGGGG + Intronic
1005631955 6:27716858-27716880 GAACCTGGAGGCAGACGTTGTGG - Intergenic
1005761213 6:28969810-28969832 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1005942357 6:30570175-30570197 GGAGCTCGGGGCAGAAGTTGGGG + Intergenic
1006184972 6:32176259-32176281 GCAGCTGGAGCCAGAGATGGGGG - Intronic
1006753378 6:36393648-36393670 GCACCTGGGAGCAGAGGTTGCGG + Intronic
1007311300 6:40947999-40948021 GCAGCTGGTTGCAGATTTTGAGG - Intergenic
1008011201 6:46469499-46469521 GCATTTGGGGGAAGAAATTGAGG + Intronic
1008494091 6:52115363-52115385 CCAGCTGTGGCCAGTCATTGGGG + Intergenic
1010250817 6:73705198-73705220 GCAGCTGGGGAGAGAGATTTAGG + Intronic
1011242602 6:85288310-85288332 GCAGCTGGAGATAGAGATTGAGG + Intergenic
1011526659 6:88272840-88272862 GTAGCTGTGGCCAGACACTGAGG - Intergenic
1011607599 6:89119304-89119326 GCTGCTGAGAGCAGGCATTGTGG + Intergenic
1011704342 6:89985935-89985957 ACAGCTGTGGGAAGACAGTGTGG + Intronic
1013175708 6:107675019-107675041 GCCTCTGGGGACAGCCATTGAGG - Intergenic
1013667332 6:112362117-112362139 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1013843131 6:114421643-114421665 GCAGCTGTGGGTATACATTTGGG + Intergenic
1014009241 6:116457997-116458019 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1015344209 6:132136496-132136518 GAACCTGGGGGCAGAGATTGCGG - Intergenic
1015597621 6:134880781-134880803 GCAGCAGCGGGCAGACATCATGG - Intergenic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1017764845 6:157598047-157598069 GCAACAAGGGGCAGACACTGTGG - Intronic
1018746554 6:166766904-166766926 GCAGCTGGGTCCAGACACTGTGG - Intronic
1019215477 6:170440201-170440223 ACAGCTGGGGTCAGACACGGAGG + Intergenic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1021589183 7:22242225-22242247 GGTGCTGGGGGCAGACTTTGGGG - Intronic
1023118069 7:36882150-36882172 GCAGCTGGGGGCTGACCCCGGGG + Intronic
1023854987 7:44177416-44177438 GCAGCTGGGGGTAGGCACAGGGG - Intronic
1024393347 7:48839716-48839738 GCAGCCTGTGGTAGACATTGTGG - Intergenic
1024833783 7:53492702-53492724 GCAGATGAAGGCAGAGATTGGGG + Intergenic
1024957035 7:54933262-54933284 GCAGCTGGTGGCAGAGAGGGAGG + Intergenic
1026462689 7:70628908-70628930 GGAGGGGGTGGCAGACATTGGGG + Intronic
1026827966 7:73595861-73595883 GCAGCTGCGGGATGAGATTGAGG - Exonic
1026922972 7:74170009-74170031 GCAGCTGGGGCCAGTCTTTCGGG - Intergenic
1027240961 7:76328546-76328568 GCAGCTGGGTGCAGAAGCTGTGG - Exonic
1029217701 7:98963303-98963325 GCAGCTGGGTGCGGAGAGTGAGG + Intronic
1029253666 7:99254433-99254455 GCAGCAGGTGGCAGACATAAAGG - Intergenic
1029375336 7:100173994-100174016 GCACCTGGGGGCAGAGAGTGGGG + Exonic
1029443882 7:100602495-100602517 GCAGCAGGGCGCAGGCAGTGAGG - Exonic
1029606763 7:101603730-101603752 CCAGCGGGGGGCAGAGGTTGCGG - Intergenic
1029737410 7:102472490-102472512 GGAGCTGGAGGCAGACGTGGGGG + Exonic
1031200940 7:118684487-118684509 ACAGATGGAGGCAGAGATTGGGG + Intergenic
1032069391 7:128794529-128794551 GCAGCTGGTGGCAGAACTGGAGG + Exonic
1033354186 7:140586154-140586176 GAAGCTGGTGGCAGCCATTGTGG + Intronic
1034474528 7:151274992-151275014 CCAGCTGGGGGCAGAAATGCCGG + Intronic
1035515053 8:225785-225807 GCACATGGTGGCAGACATGGTGG + Intergenic
1035755207 8:2025798-2025820 GCAGCTTGGGCCAGCCATGGTGG - Intergenic
1036066899 8:5390643-5390665 GCATCTTGGGGCAGGCCTTGGGG + Intergenic
1036210459 8:6836282-6836304 GCAGCAGGGGAGAGAGATTGGGG + Intergenic
1036376762 8:8207250-8207272 CCTGCTGGGTGCAGACACTGTGG - Intergenic
1036852773 8:12215888-12215910 CCTGCTGGGTGCAGACACTGTGG + Intergenic
1036874144 8:12458410-12458432 CCTGCTGGGTGCAGACACTGTGG + Intergenic
1037040415 8:14224381-14224403 TGAGCTAGGGGCAGACATAGAGG + Intronic
1037399199 8:18476641-18476663 CCAGCTGGTGGCAGAGATGGTGG - Intergenic
1041255716 8:55978381-55978403 GCAGCTGAGGACCGCCATTGCGG + Intronic
1042159151 8:65874461-65874483 ACTGCTGGGGGAAGACATTAGGG + Intergenic
1042271551 8:66961568-66961590 GCAGCCGGGTGCAGACCCTGCGG - Exonic
1044286948 8:90420718-90420740 CCAGCTGGGGCCAGACATGATGG + Intergenic
1048312667 8:133337669-133337691 GCAGGTGGTGGCAGACACAGTGG + Intergenic
1048871082 8:138799808-138799830 GCTGTTGTGGGCAGTCATTGAGG + Intronic
1048933959 8:139340067-139340089 GAAGCTGGGTGCAGAGATTCCGG - Intergenic
1051061984 9:13055413-13055435 GCAGCTGGGGAATGATATTGAGG + Intergenic
1051671047 9:19511024-19511046 TTAGCTGGGGGGAGTCATTGTGG + Exonic
1051794808 9:20854438-20854460 GCAGCTGGGGAAAGAGTTTGAGG + Intronic
1055030245 9:71766924-71766946 GAAGCTGGGGGAAGTCATTTCGG + Intronic
1055555000 9:77464940-77464962 GAAGATGGAGGCAGAGATTGGGG + Intronic
1056363152 9:85879171-85879193 GCAACTGTGTGCAGAGATTGGGG - Intergenic
1056703728 9:88933760-88933782 GAAGATGGAGGCAGAGATTGGGG + Intergenic
1057699851 9:97355942-97355964 GCACCAGCGGGCAGACAGTGGGG + Intronic
1060348610 9:122838134-122838156 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1060505088 9:124191776-124191798 GCAGCAGGAGGCAGCCAGTGGGG + Intergenic
1060551926 9:124489757-124489779 TCAGCAGGGGACAGCCATTGGGG - Intronic
1061281004 9:129597595-129597617 GCAGCCGGGCGCAGACCTCGGGG + Intergenic
1061511888 9:131066800-131066822 ACAGCTGTGGGCAGCCACTGGGG + Intronic
1062250874 9:135592891-135592913 GCAGCTGAGGGCAGGCTGTGGGG + Intergenic
1062352889 9:136147882-136147904 GCAGCTCGGGGCTGGCATTTTGG - Intergenic
1062402980 9:136380539-136380561 GCAGGTCGGGGCTGACACTGGGG - Intronic
1203780872 EBV:100202-100224 GCAGAGGGGGGCAGAATTTGCGG + Intergenic
1185456721 X:314412-314434 GGAGCCGGGGGCAGGCAGTGGGG + Intronic
1186192988 X:7084212-7084234 GCAGCTGGCTGCAGTTATTGCGG + Intronic
1186566968 X:10673253-10673275 CCTGCTGGGGGCAGAAAGTGAGG + Intronic
1189371947 X:40435649-40435671 GCAGCTGTGGGCGGGCATTACGG + Intergenic
1190491887 X:50990628-50990650 GCAGCTGAGGGCAGAGAGGGAGG - Intergenic
1190501275 X:51081052-51081074 GCAGCTGAGGGCAGAGAGGGAGG + Intergenic
1190911529 X:54776064-54776086 GCTGCTGGGGGCAGAGTTGGAGG - Intronic
1191878598 X:65822198-65822220 CCAGCTTGGGGCTGGCATTGAGG + Intergenic
1192166843 X:68831857-68831879 CAAGCTGAGGGCAGGCATTGTGG + Intronic
1194321988 X:92460254-92460276 GCAGCTGGAGACAGAGATTGAGG + Intronic
1194427432 X:93756826-93756848 GGAGGTGGGGGCAGAGATGGGGG + Intergenic
1195877721 X:109559593-109559615 TCAGCAGGGGCCAGACAGTGGGG - Intergenic
1196020290 X:110984203-110984225 GCAGATGGGTGCAGACATTCTGG + Intronic
1197617897 X:128715093-128715115 GCAGCTGGAGACAGAGATCGAGG + Intergenic
1198214214 X:134542459-134542481 GCAGGTGGGGGTGGACATGGGGG + Intergenic
1199146853 X:144379123-144379145 ACAGCTGGGGGGAGGCAGTGGGG + Intergenic
1200072133 X:153534457-153534479 GCGTCTGGGGACAGGCATTGGGG - Intronic
1200085876 X:153604737-153604759 GCAGCTGGAGACAGAGATCGAGG - Intergenic
1200088596 X:153623986-153624008 GGAGATGGAGGCAGAAATTGAGG + Intergenic