ID: 1019614662

View in Genome Browser
Species Human (GRCh38)
Location 7:1953813-1953835
Sequence CCCATCACTGCTGGGTGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019614658_1019614662 4 Left 1019614658 7:1953786-1953808 CCAACAGGGTTGAGTCTGAATGC 0: 1
1: 0
2: 2
3: 12
4: 107
Right 1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG No data
1019614657_1019614662 5 Left 1019614657 7:1953785-1953807 CCCAACAGGGTTGAGTCTGAATG 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019614662 Original CRISPR CCCATCACTGCTGGGTGACA CGG Intronic
No off target data available for this crispr