ID: 1019616316

View in Genome Browser
Species Human (GRCh38)
Location 7:1964226-1964248
Sequence AGTCAAGAAGCCCCTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019616316_1019616322 23 Left 1019616316 7:1964226-1964248 CCTTCTGCAGGGGCTTCTTGACT 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1019616322 7:1964272-1964294 CCCCTTTTAAAATGATATTATGG 0: 1
1: 0
2: 1
3: 25
4: 281
1019616316_1019616319 -9 Left 1019616316 7:1964226-1964248 CCTTCTGCAGGGGCTTCTTGACT 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1019616319 7:1964240-1964262 TTCTTGACTTAGGGAGACGCTGG 0: 1
1: 0
2: 0
3: 5
4: 68
1019616316_1019616320 0 Left 1019616316 7:1964226-1964248 CCTTCTGCAGGGGCTTCTTGACT 0: 1
1: 0
2: 1
3: 25
4: 226
Right 1019616320 7:1964249-1964271 TAGGGAGACGCTGGATGAAAAGG 0: 1
1: 0
2: 2
3: 22
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019616316 Original CRISPR AGTCAAGAAGCCCCTGCAGA AGG (reversed) Intronic
900480685 1:2897588-2897610 GGTGACGAAGCCCCTGCTGAGGG - Intergenic
902655816 1:17867368-17867390 AGTCAGAGAGCCTCTGCAGATGG + Intergenic
902955516 1:19922214-19922236 AGACAGGAAGCCCCTCCTGATGG - Intronic
911452889 1:98087501-98087523 AGGGAAGAAGCCCATGGAGAAGG + Intergenic
912533756 1:110347220-110347242 TGGTAAGAAGCCCCTGGAGACGG - Intergenic
912706489 1:111918915-111918937 TGTGTAGAAGCCCCTGTAGAGGG + Intronic
916698209 1:167262658-167262680 AGTCACAAAGCCCCTGGGGATGG + Intronic
918653805 1:186999255-186999277 AGTCAAGATGCCTCACCAGATGG - Intergenic
919026708 1:192180931-192180953 AGTCAAGAAGCCATTACAGTTGG - Intronic
919787714 1:201270367-201270389 AGTGGAGAAGCCCCTTTAGATGG + Intergenic
919854192 1:201694469-201694491 GGGCAAGAAGCCCCAGCAGCTGG - Intronic
921183524 1:212650935-212650957 AGTCTAGAGGCCCCTGTAGAAGG + Intergenic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
921933834 1:220777800-220777822 AGTCAAGAAGCATCTGCACACGG - Intronic
922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG + Intergenic
923142783 1:231175330-231175352 AGGCAGGAAGACCCTGCAGGGGG + Intronic
923868895 1:237969752-237969774 AGGCAAGAAACTCCTGGAGAGGG + Intergenic
1065138838 10:22700953-22700975 AGTATAGAAGCACCTGAAGAAGG + Intronic
1065245467 10:23751765-23751787 TCACAAGAAGCCCCTGCAGATGG - Intronic
1066704589 10:38164375-38164397 AATCAAGAGGCCTCTGGAGAGGG - Intergenic
1066792587 10:39082195-39082217 ACTCAAAAAGCCCCTGTTGAAGG - Intergenic
1066985987 10:42466823-42466845 AATCAAGAGGCCTCTGGAGAGGG + Intergenic
1067336832 10:45373636-45373658 AGTGAAGAAGCCCGCGCTGAAGG + Intergenic
1068197855 10:53742023-53742045 AGTCAAGGAGCATCTGCATATGG - Intergenic
1069598418 10:69687532-69687554 AGTTAAGAAGCCCCAGGACATGG - Intronic
1072168809 10:92839864-92839886 TCTAAAGAAGGCCCTGCAGAGGG + Intronic
1072203390 10:93180898-93180920 AGTCCAGAAGCCTCTGAAGCCGG - Intergenic
1072625060 10:97105961-97105983 AGGCAAGAAGGTCCCGCAGATGG + Intronic
1074340978 10:112629527-112629549 AGACAAGAAGCCCCTTCCTAAGG - Intronic
1075301755 10:121331018-121331040 AGTCAAGTGGCCCATGGAGAGGG + Intergenic
1076440075 10:130475500-130475522 TGTGAAGAAGCCCCTGTGGATGG - Intergenic
1077747597 11:4924440-4924462 AGTAAGGAAGCATCTGCAGATGG + Intronic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1081707603 11:45193863-45193885 AGCCAAGAACCCCCAGCAGCTGG - Intronic
1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG + Intronic
1083620342 11:64046239-64046261 AGTGAGGAAGCCCCAGAAGAGGG + Intronic
1083911362 11:65712169-65712191 CCTCACGAAGCCCCTGTAGAGGG - Exonic
1084029073 11:66470354-66470376 ACTCCAGAAGCCCCTCTAGATGG - Intronic
1084769475 11:71333547-71333569 ATACAAGAAGCCCCCCCAGAAGG + Intergenic
1088877030 11:113944585-113944607 AACCAAGAAGGCCATGCAGATGG - Exonic
1091227045 11:133963811-133963833 GCTCAAGAAGCACCAGCAGAAGG + Intergenic
1091389576 12:117844-117866 AGGCCAGAAGCCCCTGCAGGAGG - Intronic
1092030102 12:5276781-5276803 AAACAAGCAGCCCCTGCAGGTGG - Intergenic
1092317154 12:7429735-7429757 AGTTAAGAAGACCCTGAAGGAGG - Intronic
1093124072 12:15307278-15307300 AGTCATGAGGCCCCTGTACAAGG - Intronic
1093810501 12:23486573-23486595 AGTGAGGGAGCCCCTGAAGATGG - Intergenic
1093961962 12:25283916-25283938 AGTCACTAAGCCCCTACTGAAGG - Intergenic
1094424363 12:30303011-30303033 AAGCAAGAAGCCCCAGGAGAAGG + Intergenic
1096217319 12:49805078-49805100 TGTCAAGAGACCCCAGCAGAAGG - Intronic
1096317762 12:50583472-50583494 AGACAAGCAGCACCTGCAGATGG - Intronic
1096542351 12:52314837-52314859 GGTCAAGAGACCCCTGCTGATGG + Intronic
1097175412 12:57139533-57139555 AGTAAAGAAAGCCATGCAGAAGG + Intronic
1098135333 12:67396035-67396057 AGCAAAGAAGCCCCACCAGAAGG - Intergenic
1100728333 12:97434675-97434697 TTTCAAGATGCCCCTACAGAAGG - Intergenic
1103339961 12:120215979-120216001 AGGAAAGAAGCCACTCCAGAAGG - Intronic
1104088743 12:125496748-125496770 AGTTCAGAATCCCCTCCAGAAGG + Intronic
1104151677 12:126090475-126090497 AGCCACCAAGCCCCTGCAGTGGG - Intergenic
1104617314 12:130281478-130281500 GTTCAAGGAGCCCCTCCAGAGGG - Intergenic
1106359058 13:29012962-29012984 GGCCAAGTAGCCACTGCAGAAGG + Intronic
1108514534 13:51187731-51187753 ACTCCAGAAGCCCCTCCATAAGG - Intergenic
1113334998 13:109369342-109369364 AGTAAAGAAGCCCCTGCCAGTGG + Intergenic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1119260038 14:73232538-73232560 AGACAAGAAGGCCATCCAGAGGG - Intergenic
1119521159 14:75286515-75286537 GGGCAAGAGGCCCCGGCAGAGGG - Intergenic
1119542005 14:75445349-75445371 AGTCAATGAGCCCCAGCATATGG - Intronic
1122453291 14:101829408-101829430 AGGCAAGAAGGCCAAGCAGAAGG + Intronic
1122785955 14:104163332-104163354 GGGCAAGAAGCCCGGGCAGAGGG - Intronic
1202868633 14_GL000225v1_random:138781-138803 TGTCAAAAAGCCCCTGTAGACGG - Intergenic
1123999441 15:25742526-25742548 AGTCAAAAAGCCTCGGTAGATGG + Intronic
1124364819 15:29063982-29064004 ATTCAGGAGGGCCCTGCAGAGGG - Intronic
1125253600 15:37735797-37735819 ATTCAGGAATCTCCTGCAGAAGG + Intergenic
1127367897 15:58308875-58308897 AGTCAAGGAGCCTCTGTACATGG + Intronic
1128663504 15:69521334-69521356 AGTCTGGAGGCTCCTGCAGAAGG + Intergenic
1129846692 15:78771115-78771137 AGACACTAAGCCCCTGCAGGTGG + Intronic
1130944135 15:88538382-88538404 AGTCATAAAGCCCCTGCACCTGG + Intronic
1130945195 15:88545970-88545992 AGTCATAAAGCCCCTGCACCTGG + Intronic
1132181273 15:99754487-99754509 AGTGAAGTGGCCCCTGCAGCAGG - Intergenic
1134762085 16:16723409-16723431 AGTCATAAAGACCCTGCCGATGG + Intergenic
1134983975 16:18635761-18635783 AGTCATAAAGACCCTGCCGATGG - Intergenic
1136358860 16:29764641-29764663 CAGCAAGAAGCCCCTGAAGAAGG - Intergenic
1137597653 16:49735481-49735503 AGTCAAGGTCTCCCTGCAGAAGG - Intronic
1138222090 16:55260586-55260608 ATTCAAGAAGGGCCTGGAGATGG + Intergenic
1139235481 16:65334074-65334096 AATGAAGAAGCCCCAGCTGATGG + Intergenic
1140408944 16:74729885-74729907 AGTCAGGCAGCCACTGCAGGTGG + Intronic
1140415031 16:74768445-74768467 AGTGTAGAAGCCCCTGCAGGTGG + Intronic
1140781886 16:78304408-78304430 ATTCTAGAAGCCTCTGCAGAAGG - Intronic
1141608911 16:85170374-85170396 GTCCAAGAGGCCCCTGCAGACGG + Intergenic
1142218827 16:88842864-88842886 AGGCCAGAAGCACCTGCAGAAGG - Intronic
1142286317 16:89172957-89172979 ACTCAGGAAGCCCCTTCAGTGGG - Intronic
1143632227 17:8145958-8145980 AGACAAGAAGCCCCCGGAGTCGG - Exonic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1144634720 17:16897741-16897763 AGTGATGGAGCCCCTGCAGTGGG - Intergenic
1144766151 17:17733859-17733881 AATGCAGAAGCCTCTGCAGAAGG + Intronic
1145826291 17:27879587-27879609 CTCCAAGAAGCCCCTGCAGGAGG - Intronic
1146164718 17:30578578-30578600 AGTGATGGAGCCCCTGCAGTGGG - Intergenic
1148029448 17:44609361-44609383 AGTCAAGTAGCACCTGCATGTGG + Intergenic
1148086703 17:44997953-44997975 AGCCCAGAGGCCCCTGCAGGGGG + Intergenic
1148344091 17:46891776-46891798 GTTCCTGAAGCCCCTGCAGAGGG - Intergenic
1150288245 17:63966150-63966172 AGCCAAGAAGGCCCAGCTGAAGG + Exonic
1151259404 17:72904853-72904875 AGTAAAGAAATCCCTGCTGATGG - Intronic
1152200828 17:78944924-78944946 TGTCAAGATGCCCCCGCAAAAGG - Intergenic
1152461879 17:80445911-80445933 TGGCAGGAGGCCCCTGCAGATGG - Intergenic
1152502204 17:80719655-80719677 ATTCAAGAACCCCCTTCAGGAGG - Intronic
1152556533 17:81055864-81055886 TGTCATGAAAACCCTGCAGACGG - Intronic
1152566778 17:81103807-81103829 AGTCCAGGGGCCCCTGCTGAGGG + Intronic
1153272129 18:3333209-3333231 AGTCAAGAAACTCCCTCAGAGGG - Intergenic
1153747904 18:8199082-8199104 AATCAAGAGGACCATGCAGATGG - Intronic
1157709929 18:49843220-49843242 AAGTAAGCAGCCCCTGCAGAAGG - Exonic
1159082444 18:63751028-63751050 AGGCAAAAAGCCCCTGAAGAGGG - Intergenic
1160458952 18:79022859-79022881 TTACAAGAAGTCCCTGCAGACGG - Intergenic
1160754882 19:751860-751882 AGACAAGGAGGCCATGCAGAAGG - Intronic
1160981350 19:1817989-1818011 TGCCAAGAGGCCTCTGCAGAGGG - Intronic
1161975621 19:7606527-7606549 TCTCCAGCAGCCCCTGCAGACGG + Exonic
1162159117 19:8698596-8698618 GGTGAACAAGCCCCTGCAGCGGG - Exonic
1163152902 19:15425337-15425359 AGCCAAGCGGCCCCTGCAGGAGG - Exonic
1166642619 19:44506945-44506967 AGTAAAAAAGGCCCTGAAGAGGG - Intronic
925332136 2:3066792-3066814 AGTCAAGGAGAGCCTGCAGTCGG + Intergenic
926473651 2:13293873-13293895 AGCCATGAGGCCACTGCAGAGGG + Intergenic
927431031 2:23026237-23026259 AATCAAGAATCCGCTTCAGATGG + Intergenic
927578179 2:24217817-24217839 TGCTAAGAAGCCCTTGCAGAGGG + Intronic
933574992 2:84057191-84057213 GGCCAAGAAACCCCTGCAGAAGG - Intergenic
934762428 2:96864055-96864077 CGTCAAGAAGCACCCGCTGATGG - Exonic
936005682 2:108884925-108884947 ATTCCAGAAGCCACTGCTGATGG - Intronic
937592226 2:123628667-123628689 ACTCAACCAACCCCTGCAGATGG + Intergenic
937936335 2:127248588-127248610 GGTCAAGAAGTCCCTGAGGAGGG + Intergenic
939648262 2:144729112-144729134 AGTAAAGAAACACCTGAAGAAGG - Intergenic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
942413337 2:175734018-175734040 AGTAACCATGCCCCTGCAGAGGG + Intergenic
946053805 2:216884371-216884393 AGTTTAGAAGTCCCTGGAGAAGG + Intergenic
1169157187 20:3341556-3341578 AGTCAAGGAGGCCTTTCAGATGG - Intronic
1169931353 20:10836470-10836492 ATTCAAGAAACCTGTGCAGAAGG + Intergenic
1172223610 20:33289954-33289976 AGTCAAGATCCCCCTGGACATGG + Exonic
1172517732 20:35546951-35546973 AGGCAAGGAGCCGGTGCAGAGGG + Intronic
1173350223 20:42238264-42238286 AGTTAAGAAGCCACAGAAGAAGG + Intronic
1173373549 20:42461549-42461571 AGAGGAGAAGCCACTGCAGAAGG + Intronic
1173980171 20:47217890-47217912 AGGCAAGAAGCCCCAGTAAATGG - Intronic
1175402209 20:58707219-58707241 ACCCAGGATGCCCCTGCAGAGGG - Intronic
1175740200 20:61414745-61414767 ACTCAGGAAGTCCCTCCAGATGG + Intronic
1175923475 20:62460952-62460974 GGTCAGGAAGCCCCAGCTGACGG + Intergenic
1175943623 20:62549015-62549037 ACTCAAGAAGCCTCTGCACTGGG + Intergenic
1176086639 20:63298228-63298250 TGGCACGCAGCCCCTGCAGAAGG + Intronic
1178600175 21:33987903-33987925 AATCCAGCAGCCTCTGCAGAGGG - Intergenic
1178640662 21:34342748-34342770 TGGCAGGAAGCCACTGCAGAGGG + Intergenic
1179983656 21:44909452-44909474 ATTCAAGAAGCCCAAGGAGACGG + Intronic
1181076150 22:20378312-20378334 AGTCAAGAATCCCCTGAAGAAGG + Intronic
1181865716 22:25853386-25853408 AGTTAGGAGGGCCCTGCAGAAGG - Intronic
1182432055 22:30304968-30304990 AGTCAATAAGCCTCTTCAGAGGG + Intronic
1184460479 22:44635015-44635037 ACTCAGGAAGCCTCTGCAGAAGG - Intergenic
949933915 3:9101872-9101894 ATTCCAGAAGCCCCTGCACGTGG - Intronic
950533405 3:13566170-13566192 AAAAAAGAAGCCCCTGGAGATGG - Intronic
950717572 3:14860525-14860547 AGTCGTGGAGCCCATGCAGATGG - Intronic
950906594 3:16544548-16544570 AGTCAGGGAGCCCTTGCTGATGG - Intergenic
951439191 3:22703779-22703801 AGTCAAGAAACCACTGAAGAAGG + Intergenic
952805750 3:37349788-37349810 AGACAAGAAACAACTGCAGATGG - Intronic
953121031 3:40042326-40042348 AGTCAATTAGCCCCTGTAGTGGG - Intronic
953245117 3:41183848-41183870 AATCAGGAAGCACCTGAAGATGG + Intergenic
954767374 3:52930846-52930868 TGTAAAGCAGCCCCTGCAGTCGG - Intronic
954862778 3:53704195-53704217 AGTCAAGAAGCCTCTCCACCAGG - Intronic
954878829 3:53820510-53820532 AGCACAGAAGCCCCTGCGGAAGG - Exonic
959064360 3:101641797-101641819 AGTCTAAAAGCCCCTGCACCTGG + Intergenic
959151240 3:102610780-102610802 AATCAGAAATCCCCTGCAGAGGG + Intergenic
959671567 3:108983744-108983766 AGTCAAGGAGACCCTAAAGAAGG + Intronic
960215324 3:115027518-115027540 AGTCAAGAAGCCTTTGGACATGG - Intronic
962744051 3:138384343-138384365 AGTTAAGAAGCTCCTGATGATGG + Intronic
963448012 3:145439834-145439856 AGTCAAGAAGCCCCTGTGCCAGG + Intergenic
963918075 3:150878776-150878798 AGTCAAGAGGCCACAGCACAAGG - Intronic
964838670 3:160969692-160969714 TGTCAACAAGTCCCTGGAGAGGG - Intronic
966875106 3:184317027-184317049 TGTTAGGAAGCCTCTGCAGAGGG + Intronic
971071167 4:23093859-23093881 AATAAAGAGGCCCCTGCAAATGG - Intergenic
972713248 4:41619739-41619761 AGTCAAGCAGTCTCCGCAGAAGG - Intronic
973646190 4:52953514-52953536 AGTCATGCAGCCCCTGAAGGTGG + Intronic
974345973 4:60681842-60681864 AAACAAACAGCCCCTGCAGAAGG - Intergenic
975802247 4:78072993-78073015 AGGAAAGAAGCCCTTACAGAAGG + Intronic
977610996 4:99031136-99031158 AGTAAAGAAGACCATTCAGATGG + Intronic
977944925 4:102901674-102901696 AGTCAAGAACCACTTGCACACGG - Intronic
978013521 4:103716908-103716930 AGTCAGTAAGTCCATGCAGAAGG + Intronic
979200113 4:117967604-117967626 AGTCAAGAAGCTCCTAAAGTGGG + Intergenic
983665888 4:170182148-170182170 AGTCAAGAGTCACCTGCAGAGGG - Intergenic
983671887 4:170247110-170247132 AGTCATGAAACTCCAGCAGAAGG - Intergenic
985908387 5:2860224-2860246 AGTCCAGATGCCCCTGAAGGAGG - Intergenic
986255911 5:6101430-6101452 AGTCAGGATGCCCATGGAGAGGG - Intergenic
986510483 5:8501426-8501448 AGGCAAGAAGCACCTGCTGCTGG - Intergenic
987224739 5:15828575-15828597 AGTCAAGAAGCCATCTCAGAAGG - Intronic
988952436 5:36277052-36277074 TGGCAACAAACCCCTGCAGAGGG + Intronic
989267945 5:39499354-39499376 AGTCAAGAAGCTGAGGCAGAAGG + Intergenic
993930623 5:93934620-93934642 AGTGAAGAAACCTTTGCAGAGGG - Intronic
997031239 5:130131326-130131348 AGTCAGGAGGCTACTGCAGAAGG - Intronic
1000156935 5:158561545-158561567 AGTCCAGAAGCCAGTGAAGAGGG - Intergenic
1000981870 5:167824928-167824950 AGTCAACAGGCGCCTGCAAAGGG + Intronic
1002522273 5:179798401-179798423 AGACAAGGAGGCCCTGCAGGAGG - Exonic
1004081981 6:12404007-12404029 AATCACGAATCCCCTGAAGATGG - Intergenic
1004992897 6:21159061-21159083 GGTCAAGAAGCCCCAGAGGAAGG - Intronic
1006034527 6:31201222-31201244 ATTCAAGAGGCTCCTGCACAGGG + Intronic
1007238504 6:40408361-40408383 AACCAAGAAGCCCCTGCCGAGGG - Intronic
1007325827 6:41058903-41058925 AGTCCAGAAGGCCCTGCTGAGGG + Intronic
1008267004 6:49439962-49439984 AGTTAATAAACCCCTGCAGTAGG + Intronic
1013213241 6:108005124-108005146 TGTCAAGAAGCAGCTGGAGAAGG - Intergenic
1014171738 6:118286467-118286489 AGCCAAGAAACCGATGCAGAAGG + Intronic
1014336688 6:120146567-120146589 AGTCAAGGAGCATCTGCAGTTGG + Intergenic
1017979298 6:159385571-159385593 AGCCCAGAAGCAACTGCAGAGGG - Intergenic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1022510254 7:30930772-30930794 AGTCCAGAAGACCCTGCAGCTGG - Intergenic
1023837965 7:44079600-44079622 AGTGGGGAAGCCCCTGCAGCTGG + Exonic
1024306660 7:47934980-47935002 AGTCAATGAGCTCCCGCAGAGGG + Intronic
1028425325 7:90680601-90680623 AGTTATGAAGAGCCTGCAGAGGG - Intronic
1028752120 7:94393901-94393923 AGACAAGGAGCCCATGGAGAAGG + Intergenic
1030381385 7:108815299-108815321 AGATAAGAATTCCCTGCAGAGGG - Intergenic
1030709634 7:112735267-112735289 AGGCAAGAAGCCCATGCTCATGG - Intergenic
1030837512 7:114307918-114307940 AGTAAAGCAGCTCCTGCAGCTGG - Intronic
1031951922 7:127901496-127901518 AGTGAAGAAGCCTCTGCACAGGG + Intronic
1034051920 7:147992791-147992813 AGTCAAGAAAACCCTGAAGGAGG - Intronic
1035443328 7:158921990-158922012 AGTGCTGAAGCCCCTGCAGCTGG + Intronic
1035851978 8:2929483-2929505 AGTCCCAGAGCCCCTGCAGATGG + Intergenic
1036221378 8:6923790-6923812 AGGTAAGAAGACCCAGCAGAAGG + Intergenic
1036692355 8:10951885-10951907 CGGGAAGAGGCCCCTGCAGAAGG + Intronic
1037459579 8:19095446-19095468 GGTCCAGCAGCTCCTGCAGATGG + Intergenic
1037668228 8:20990672-20990694 AGTCAAAAAGCTTCTGCACAGGG - Intergenic
1038368043 8:26956926-26956948 AGTCAAGAAGCCTCTGTACGTGG + Intergenic
1038394623 8:27237701-27237723 AGCCAAGATCCTCCTGCAGATGG - Intronic
1038669554 8:29571612-29571634 AGTCAAGAAGAACTTGTAGAGGG + Intergenic
1040905153 8:52461422-52461444 ACTCCGGCAGCCCCTGCAGAAGG - Intergenic
1041671627 8:60497475-60497497 AATCAAGAAGCTGGTGCAGATGG + Intergenic
1046697512 8:117358464-117358486 AAGAAAGAAGCCACTGCAGAAGG + Intergenic
1046770340 8:118111612-118111634 AGTCTTGGAGCCGCTGCAGAAGG - Exonic
1047085625 8:121512339-121512361 AGTCAAGATGTCCCTGATGAAGG + Intergenic
1047488091 8:125350920-125350942 AGTTAGGAAGCAACTGCAGAGGG + Intronic
1048321069 8:133400550-133400572 AGTCAGGATGCTCCTGCAGGGGG - Intergenic
1048899266 8:139022172-139022194 AGCCCAGAGGCTCCTGCAGAGGG - Intergenic
1049036381 8:140079490-140079512 AGAAAAGAGGCACCTGCAGAAGG + Intronic
1049070226 8:140350061-140350083 AGTCAAGAAGCACCTTTTGAGGG + Intronic
1049123512 8:140763175-140763197 AGTCAAGAAGCTCCTGAAAGGGG + Intronic
1049259149 8:141629514-141629536 AGTCCAGCAGGCCCTGCAGAGGG - Intergenic
1050024509 9:1320011-1320033 AGCAAAGAAGCCCCTTCAGCAGG - Intergenic
1053427304 9:38018839-38018861 AGTCCAGATGGCCATGCAGAAGG + Intronic
1053620696 9:39811431-39811453 AGTCAAAAAGCTCCTGAAAAAGG - Intergenic
1053626016 9:39872504-39872526 AGTCAAAAAGCTCCTGAAAAAGG + Intergenic
1053878861 9:42570715-42570737 AGTCAAAAAGCTCCTGAAAAAGG - Intergenic
1053893806 9:42723649-42723671 AGTCAAAAAGCTCCTGAAAAAGG + Intergenic
1054217872 9:62378197-62378219 AGTCAAAAAGCTCCTGAAAAAGG - Intergenic
1054232830 9:62530980-62531002 AGTCAAAAAGCTCCTGAAAAAGG + Intergenic
1054263470 9:62896013-62896035 AGTCAAAAAGCTCCTGAAAAAGG + Intergenic
1057212527 9:93207984-93208006 AGTCACAAAGCCCCTGGACAAGG - Intronic
1059175454 9:112166264-112166286 AGTTAAGAATCACCTGGAGACGG + Intronic
1059182789 9:112234852-112234874 AATCCAGCAGCCCCTGCATATGG + Exonic
1061120157 9:128637060-128637082 AGTCATGAGGCCCCTGCTGGTGG - Intronic
1061909561 9:133715549-133715571 ATTCAAGTAGCCCCTGCTGACGG + Intronic
1203736142 Un_GL000216v2:141474-141496 TGTCAAAAAGCCTCTGTAGACGG + Intergenic
1189504201 X:41594664-41594686 AGTCAAGGAGACACTGCAGAAGG + Intronic
1191899001 X:66022188-66022210 AGGGAAGAAGGCCATGCAGAAGG + Exonic
1192230017 X:69257989-69258011 AGTCCAGAAGCCCCAGGAAAAGG - Intergenic
1194700307 X:97105567-97105589 AGTCTAAAAGCTCCTGCTGAGGG - Intronic
1195306625 X:103589282-103589304 AGTCAAATATCCTCTGCAGAAGG - Intergenic
1202094065 Y:21226692-21226714 AGTCAAGAAGTGCTTACAGAAGG - Intergenic