ID: 1019618946

View in Genome Browser
Species Human (GRCh38)
Location 7:1980190-1980212
Sequence CTCAGGCGTGTCCCCCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019618946_1019618950 -3 Left 1019618946 7:1980190-1980212 CCCCGCTGGGGGACACGCCTGAG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1019618950 7:1980210-1980232 GAGCATGTCCACTTCCTTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 202
1019618946_1019618953 0 Left 1019618946 7:1980190-1980212 CCCCGCTGGGGGACACGCCTGAG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1019618953 7:1980213-1980235 CATGTCCACTTCCTTCCTGGGGG 0: 1
1: 1
2: 1
3: 36
4: 275
1019618946_1019618951 -2 Left 1019618946 7:1980190-1980212 CCCCGCTGGGGGACACGCCTGAG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1019618951 7:1980211-1980233 AGCATGTCCACTTCCTTCCTGGG 0: 1
1: 0
2: 1
3: 23
4: 248
1019618946_1019618952 -1 Left 1019618946 7:1980190-1980212 CCCCGCTGGGGGACACGCCTGAG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1019618952 7:1980212-1980234 GCATGTCCACTTCCTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019618946 Original CRISPR CTCAGGCGTGTCCCCCAGCG GGG (reversed) Intronic
901331217 1:8410215-8410237 CCCAGCCGTGTCCCCCAGCCAGG - Intronic
901626649 1:10628764-10628786 CGCAGGGCTGTCCCCCAGCAGGG - Intronic
905559469 1:38915160-38915182 CTCACTCTTGTCCCCCAGCCTGG + Intronic
915470646 1:156123857-156123879 CTCAGGCCTGGCCCCCTGCCAGG + Intronic
920012220 1:202876917-202876939 CTCAGGCGAGCCTCCCAGCTCGG - Intergenic
921340043 1:214125444-214125466 CTCAGACGTGTCCTGCAGAGTGG - Intergenic
922287653 1:224183659-224183681 CGCAGGCGCGTCCCCGAGCGCGG + Intronic
922307490 1:224357020-224357042 CTCAGCCGTGTCCCCCGGCAAGG - Intronic
923744329 1:236686528-236686550 CCCAGGCGTGTCGCCCCGAGAGG + Exonic
924584486 1:245350136-245350158 CTCAGGCGGGTCCACCAACCCGG - Intronic
1063147463 10:3309025-3309047 CTCAGGGGAGCCCCCCAGGGTGG - Intergenic
1067015094 10:42752646-42752668 GTCAGGCGTCTCCTCCAGAGTGG + Intergenic
1074462583 10:113651842-113651864 CTCAGGAGTATCCACCACCGTGG + Exonic
1075259524 10:120950254-120950276 CTCCGGCTTGTCCCTCTGCGCGG + Intergenic
1077028067 11:450523-450545 GTCAGGCGGCTCCTCCAGCGAGG - Exonic
1077213555 11:1384438-1384460 CCCAGGTGTGTCTCCCCGCGTGG + Intergenic
1077416118 11:2425061-2425083 ACCAGGCGTCTCCACCAGCGCGG - Intergenic
1077645068 11:3916478-3916500 CTCACTCTTGTCCCCCAGGGTGG + Intronic
1077985466 11:7347259-7347281 CTCACGCTTGTCCCCCAGGCTGG + Intronic
1079077485 11:17393174-17393196 CTCAGCTGTGGCCCCCACCGCGG - Intronic
1083867188 11:65462389-65462411 CTCATTCTTGTCCCCCAGGGTGG - Intergenic
1084131953 11:67142672-67142694 CTCACGCTTGTCCCCCAGTCTGG - Intronic
1084922082 11:72479399-72479421 CTCTGATGTGTCCCCCAACGTGG - Intergenic
1085394812 11:76201879-76201901 CACAGGCGGGTCCCCTAGAGCGG - Intronic
1085395830 11:76206674-76206696 CGAAGGCGTGTCTCCCAGCGTGG + Intronic
1085502985 11:77039676-77039698 CTCTGGCGTCTCCTCCTGCGGGG - Exonic
1090393780 11:126406195-126406217 CTGAGGCCTGTCCTCCAGGGTGG - Intronic
1091831066 12:3551511-3551533 CTCAGCCCTGTCCCCCACCAAGG - Intronic
1104036915 12:125104157-125104179 CTCAGGCGTTTACCCCCACGGGG + Intronic
1113682038 13:112251236-112251258 TGCAGCCCTGTCCCCCAGCGTGG - Intergenic
1114070323 14:19100081-19100103 GTCAGGCGTCTCCTCCAGAGTGG - Intergenic
1114091938 14:19299921-19299943 GTCAGGCGTCTCCTCCAGAGTGG + Intergenic
1121846368 14:97175763-97175785 CTCAGGCTTCTCCCCTTGCGTGG + Intergenic
1127643286 15:60935280-60935302 CTCTGGCTTTTCTCCCAGCGAGG - Intronic
1128310615 15:66629878-66629900 CTCTGGAGTGTCCCCCACCCCGG - Intronic
1132567546 16:630392-630414 CTCAGGCCTGTCCCCAAGGCGGG - Intronic
1136268943 16:29137190-29137212 CTCAGACTTGGCCTCCAGCGAGG + Intergenic
1142153551 16:88523174-88523196 CTCACTCTTGTCCCCCAGCCTGG - Intronic
1143309672 17:5978031-5978053 CTCAGGTTTGTCTCCCACCGAGG + Intronic
1144760637 17:17705168-17705190 CTCAAGCCTGTCCCCCGGCCAGG + Intronic
1145043226 17:19592357-19592379 CACAGAAGTGTCCCCCAGTGAGG - Intergenic
1150004767 17:61462903-61462925 CTTGGGGGTGTTCCCCAGCGTGG - Intronic
1151798310 17:76361768-76361790 CTCAGCCCTGTCCCCAAGGGAGG + Intronic
1157623061 18:49027119-49027141 CTCAGCCCTGGCCCCCAGTGGGG + Intergenic
1159956775 18:74524207-74524229 GGCATGAGTGTCCCCCAGCGAGG - Intergenic
1162818331 19:13208991-13209013 CTCAGGTCTGTCCCCAAGCCTGG + Exonic
1165354426 19:35294912-35294934 CTCAGCCCTGTCACCCAGCCTGG - Intronic
1165848831 19:38837139-38837161 CTCAGGCTTGTCCTCCAGGGAGG - Intronic
1168243476 19:55098609-55098631 CTCAGGAGAGACCCCCAGCCGGG - Intronic
926037049 2:9643913-9643935 CTCAGTGGTGTCCCTCAGCCTGG - Intergenic
929819945 2:45264932-45264954 CTCAGGCGTGTCCCTAACCTTGG + Intergenic
929966741 2:46542590-46542612 CCCAGGCGCCTCCCCGAGCGCGG - Intronic
930289918 2:49481066-49481088 CTCGGGGGTGCCCCCCAGTGAGG - Intergenic
944265278 2:197717690-197717712 CTCAGCCTTGTCCCCCAGGCTGG - Intronic
948037838 2:234873578-234873600 CCCAGCCCTGTCCCCCAGCATGG + Intergenic
948421906 2:237865070-237865092 CTCAGCTGTGGCCCCCAGCATGG + Intronic
1170000546 20:11608943-11608965 CTGAGGCTTGTCCGCCGGCGGGG + Intergenic
1172525135 20:35596153-35596175 CTCAGACGTCTCCACCAGCTTGG + Intergenic
1172533078 20:35647282-35647304 CTCACGCTTGTCCCCCAGGCTGG - Intronic
1174415143 20:50361134-50361156 GTCAGGGGTGGCCCCCAGCCTGG - Intergenic
1179534389 21:42041990-42042012 CCCAGGAGTGACCCCCAGTGTGG + Intergenic
1181422210 22:22810133-22810155 CTCAGTCTTGTCCACCAGCAGGG + Intronic
1183079146 22:35445200-35445222 CTCAGGTGTGTCCACCTGTGAGG - Intergenic
1184051146 22:42005482-42005504 CTCAGGAGTGTCACCCAGGCTGG - Intronic
1184343611 22:43899762-43899784 CTCAGGCGATTCACCCAGCTTGG - Intergenic
950467849 3:13165902-13165924 CTCAGGCATGTCCGTAAGCGGGG - Intergenic
954921333 3:54193689-54193711 CTCAGGAGGGACCCCCAGCCTGG + Intronic
961472696 3:127126226-127126248 CACAGGCCTGTCCCCCACAGGGG - Intergenic
967184100 3:186930699-186930721 CCCAGGCGTCTTCCCCAGCCCGG - Exonic
968047293 3:195631448-195631470 CACAGGCCTGTCCTCCAGCATGG - Intergenic
968135484 3:196216940-196216962 CTCGGCCTTGCCCCCCAGCGTGG + Intronic
968307320 3:197658476-197658498 CACAGGCCTGTCCTCCAGCATGG + Intergenic
968688660 4:1978348-1978370 TGCAGGAGTGTCCCCCAGCGCGG - Intronic
968811703 4:2802934-2802956 CCCAGGCGTGGCCCCCATCATGG - Intronic
969137210 4:5039521-5039543 CTCAGGCAGGTCCCCCAGGAGGG - Intergenic
969478249 4:7433313-7433335 GTCACGCGTGTTCCCCAGCGTGG + Exonic
977459604 4:97308887-97308909 CTCAGGCAAGACCCCCAGCAAGG - Intronic
985573920 5:664984-665006 CTCAGACGGGTGCCCCAGAGGGG - Exonic
985744309 5:1637712-1637734 CACAGGCATGTCCTCCAGCATGG + Intergenic
985769134 5:1798031-1798053 CTCAGGCAGGGCCCACAGCGTGG - Intergenic
985769447 5:1799683-1799705 CTCGGGCGTGTCTCCCCGAGTGG - Intronic
985958801 5:3284062-3284084 CCAACGCGTGTCCCCCAGCCAGG - Intergenic
986336446 5:6759197-6759219 AACAGGCGTAGCCCCCAGCGTGG - Intergenic
986704131 5:10441535-10441557 CGCAGGCGGGTCCCGCAGCGGGG + Exonic
998134184 5:139666133-139666155 CTCAGCAGTGTCCTCCAGCAGGG + Intronic
1001759279 5:174194153-174194175 GTCAGGCTTGTCCCCCAGGAGGG - Intronic
1001954092 5:175836531-175836553 CTCAGGCAGGTTCTCCAGCGGGG + Intronic
1002635984 5:180609072-180609094 CTCAGGCGGGACCCACAGCCTGG - Intronic
1004315919 6:14587557-14587579 CTCAGTCTTGTCCCCCAGGCTGG - Intergenic
1017238296 6:152140025-152140047 CTCCTCCGTGTCCCCCAGCCAGG + Exonic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019618946 7:1980190-1980212 CTCAGGCGTGTCCCCCAGCGGGG - Intronic
1019618955 7:1980224-1980246 CTCATGCGTGTCCCCCAGGAAGG - Intronic
1019619007 7:1980401-1980423 CCCAGGTGTGTCCCCCAGAGAGG - Intronic
1019619016 7:1980435-1980457 CTCAGGTACGTCCCCCAGAGAGG - Exonic
1019745644 7:2699246-2699268 CTCAGGCGTGTTCCTAAGTGTGG + Intronic
1021765854 7:23947889-23947911 CTCGGGCGTGTCTCCCAGTTAGG - Intergenic
1024212095 7:47215209-47215231 CTCAGGGGAGTCCCCTAGGGAGG + Intergenic
1030215815 7:107043166-107043188 CTCACTCTTGTCCCCCAGCCTGG + Intergenic
1031604045 7:123748363-123748385 CGCAGGCCTGTCCTCCAGCCTGG - Intronic
1033145899 7:138869732-138869754 CTCAGACTTGTGCCGCAGCGCGG + Exonic
1034383594 7:150720168-150720190 CACAGACGTGGCCCCCAGCCTGG - Exonic
1035247467 7:157573139-157573161 CTCAGGGGTGCACCCCAGCATGG + Intronic
1048636373 8:136300361-136300383 CTGAGGCAAGTCCCCCAGCCTGG + Intergenic
1048981618 8:139705628-139705650 CTCAGACGTAGCCCACAGCGCGG - Intergenic
1049674455 8:143883475-143883497 CTCAGCCTTGTCCCTCAGCCCGG - Intergenic
1053850929 9:42288653-42288675 AGCAGGCGCTTCCCCCAGCGCGG + Intergenic
1054573112 9:66831332-66831354 AGCAGGCGCTTCCCCCAGCGCGG - Intergenic
1057436535 9:95045464-95045486 CTCAGGCGTGTCCAAAAGCCTGG - Intronic
1062384484 9:136303777-136303799 CTGAGGTGTGTCCCCCAGGCAGG + Exonic
1062726159 9:138074845-138074867 GTCAGGCCTGTCCTTCAGCGCGG - Intronic
1185541100 X:903674-903696 CTCAGTCTTGTCGCCCAGGGTGG + Intergenic
1192506595 X:71689170-71689192 CTCAGGCGATTCTCCCAGCTTGG + Intergenic
1192520102 X:71792376-71792398 CTCAGGCGATTCTCCCAGCTTGG - Intergenic
1198303864 X:135360397-135360419 CTCAGGTGTCTCTCCCAGAGTGG - Exonic