ID: 1019619440

View in Genome Browser
Species Human (GRCh38)
Location 7:1982969-1982991
Sequence CTAAAATCAAGCTGACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019619436_1019619440 9 Left 1019619436 7:1982937-1982959 CCCATGAAGAGGGTATTCTATAA 0: 1
1: 0
2: 0
3: 17
4: 151
Right 1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG No data
1019619437_1019619440 8 Left 1019619437 7:1982938-1982960 CCATGAAGAGGGTATTCTATAAA 0: 1
1: 0
2: 0
3: 9
4: 207
Right 1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG No data
1019619435_1019619440 10 Left 1019619435 7:1982936-1982958 CCCCATGAAGAGGGTATTCTATA 0: 1
1: 0
2: 2
3: 7
4: 121
Right 1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG No data
1019619434_1019619440 11 Left 1019619434 7:1982935-1982957 CCCCCATGAAGAGGGTATTCTAT 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1019619440 7:1982969-1982991 CTAAAATCAAGCTGACAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019619440 Original CRISPR CTAAAATCAAGCTGACAGGC TGG Intronic
No off target data available for this crispr