ID: 1019619786

View in Genome Browser
Species Human (GRCh38)
Location 7:1986301-1986323
Sequence CACCAACCTCTGCTGCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019619782_1019619786 -1 Left 1019619782 7:1986279-1986301 CCTGTGTGACCCCTCAGCTCAGC 0: 1
1: 0
2: 5
3: 20
4: 198
Right 1019619786 7:1986301-1986323 CACCAACCTCTGCTGCAGCTTGG No data
1019619783_1019619786 -10 Left 1019619783 7:1986288-1986310 CCCCTCAGCTCAGCACCAACCTC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1019619786 7:1986301-1986323 CACCAACCTCTGCTGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019619786 Original CRISPR CACCAACCTCTGCTGCAGCT TGG Intronic
No off target data available for this crispr