ID: 1019626763

View in Genome Browser
Species Human (GRCh38)
Location 7:2019740-2019762
Sequence CTCAGCACTGTGGCGTGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 449}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019626763_1019626772 24 Left 1019626763 7:2019740-2019762 CCTCGCCACGCCACAGTGCTGAG 0: 1
1: 0
2: 0
3: 11
4: 449
Right 1019626772 7:2019787-2019809 CTCGGCCCACGCCTGCTCCTGGG No data
1019626763_1019626771 23 Left 1019626763 7:2019740-2019762 CCTCGCCACGCCACAGTGCTGAG 0: 1
1: 0
2: 0
3: 11
4: 449
Right 1019626771 7:2019786-2019808 GCTCGGCCCACGCCTGCTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 209
1019626763_1019626773 28 Left 1019626763 7:2019740-2019762 CCTCGCCACGCCACAGTGCTGAG 0: 1
1: 0
2: 0
3: 11
4: 449
Right 1019626773 7:2019791-2019813 GCCCACGCCTGCTCCTGGGCCGG 0: 1
1: 0
2: 3
3: 26
4: 316
1019626763_1019626768 6 Left 1019626763 7:2019740-2019762 CCTCGCCACGCCACAGTGCTGAG 0: 1
1: 0
2: 0
3: 11
4: 449
Right 1019626768 7:2019769-2019791 TGAGGCGGCGTCCCTGTGCTCGG No data
1019626763_1019626767 -9 Left 1019626763 7:2019740-2019762 CCTCGCCACGCCACAGTGCTGAG 0: 1
1: 0
2: 0
3: 11
4: 449
Right 1019626767 7:2019754-2019776 AGTGCTGAGTGCACATGAGGCGG 0: 1
1: 0
2: 2
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019626763 Original CRISPR CTCAGCACTGTGGCGTGGCG AGG (reversed) Intronic
900012481 1:128843-128865 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
900042545 1:484828-484850 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
900063984 1:719820-719842 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
900120005 1:1044646-1044668 CTCAGCACTGAGGCCTGGCCTGG - Intronic
900174383 1:1285366-1285388 CTCGGCACTGTGGCTCGGGGTGG - Intronic
901104620 1:6745555-6745577 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
901143982 1:7053014-7053036 CTCAGCAGAGTGGCCGGGCGAGG - Intronic
901419712 1:9142821-9142843 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
901684830 1:10938033-10938055 CTCAGCACTGCAGCCAGGCGTGG + Intergenic
901934259 1:12617015-12617037 CTCAGCACTCGTGGGTGGCGCGG + Intronic
902338888 1:15769881-15769903 CTCAGCACTTTGGGATGCCGAGG - Intronic
903910015 1:26716874-26716896 CTCAGCACTTTGGGAGGGCGAGG - Intronic
904025536 1:27500915-27500937 CCCAGCACTGTGGCAGGCCGAGG + Intergenic
905790946 1:40789137-40789159 CTCAGAACTGTGGAGGAGCGGGG + Intronic
905879813 1:41456092-41456114 CCCAGGGCTGTGGAGTGGCGGGG + Intergenic
906416696 1:45625444-45625466 CTCAGCACTTTGGCACGCCGAGG - Intergenic
908739601 1:67313572-67313594 CTCAGCACTGTGGGAGGCCGAGG + Intronic
910392000 1:86755374-86755396 CTCAGCACTTTGGGGGGCCGAGG + Intergenic
910411110 1:86945816-86945838 CTCAGCACTTTGGAAGGGCGAGG + Intronic
910772442 1:90843808-90843830 CTCAGCAGTGTGGAGTAGGGGGG - Intergenic
911002606 1:93181064-93181086 CTCAGCACTTTGGGATGTCGAGG + Intronic
912209542 1:107543402-107543424 CTCAGCACTTTGGGAGGGCGGGG + Intergenic
912494325 1:110081686-110081708 CTCAGCACTTTGGGGGGCCGAGG + Intergenic
914689777 1:150015529-150015551 CTCAGCACTTTGGGATGCCGAGG - Intergenic
914792500 1:150890751-150890773 CCCAGCACTTTGGGGTGCCGAGG - Intergenic
914857032 1:151360118-151360140 CTCAGCACTTTGGGGGGACGAGG - Intergenic
916120436 1:161524382-161524404 CTCAGCCGGGTGGCGCGGCGCGG - Intergenic
916305281 1:163323427-163323449 CCCAGCTCTGTGGCCTGGCAAGG + Intronic
916900949 1:169222633-169222655 CTCAGGACTATGGCGAGGAGAGG + Intronic
917412524 1:174774627-174774649 CTCAGCACTTTGGCAGGGCAAGG + Intronic
917881043 1:179336210-179336232 CTCAGCACTTTGGGAGGGCGAGG + Intronic
919138148 1:193536254-193536276 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
920403881 1:205694574-205694596 CCCAGCAGTGTGGCTGGGCGTGG + Intergenic
920459708 1:206129953-206129975 CTCACCATTGTGGGGTGGGGGGG - Intergenic
922128536 1:222753983-222754005 CTCAGCACTTTGGGAGGGCGAGG + Intergenic
922260915 1:223945327-223945349 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
922736154 1:227980409-227980431 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
923039392 1:230308966-230308988 GTCAGCACTGTGGCTTGACAAGG + Intergenic
924104770 1:240639145-240639167 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
924342088 1:243047500-243047522 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1063352876 10:5372803-5372825 CCCAGCACTGTGGGATGCCGAGG - Intronic
1064211441 10:13363527-13363549 CTCAGCACTTTGGGATGCCGAGG + Intergenic
1065743556 10:28818205-28818227 CTCAGCACTTTGGCAGGCCGAGG - Intergenic
1065849688 10:29777464-29777486 CTCAGCACTTTGGGCTGCCGAGG + Intergenic
1066110246 10:32189235-32189257 CTCAGCACTTTGGGATGCCGAGG + Intergenic
1066640746 10:37551971-37551993 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1066981169 10:42418051-42418073 CACAGCACTGTGGCGGGCCAAGG + Intergenic
1067005325 10:42655377-42655399 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1068151519 10:53138390-53138412 CTCAGCACTGTGTCTTGTCAGGG - Intergenic
1068193669 10:53687264-53687286 CTCAGCACTTTGGCAGGCCGAGG - Intergenic
1068767864 10:60784377-60784399 CTCAGCATTTTGGGGCGGCGAGG + Intronic
1069496155 10:68905165-68905187 CCCAGCACTCTGGGGGGGCGAGG - Intronic
1070280771 10:75046615-75046637 ATCAGAACTGTGGCATGGGGAGG + Intronic
1071847615 10:89536002-89536024 CTAAGTACTGTGGCTTGGCTAGG + Intronic
1072796805 10:98362258-98362280 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1072977339 10:100070176-100070198 CTCAGCACTTTGGAAGGGCGAGG - Intronic
1073349827 10:102811759-102811781 CTCAGCACTGTGGGAAGCCGAGG - Intronic
1074782492 10:116811965-116811987 CTCTGCACTCTGGCCTGGCCTGG - Intergenic
1075373471 10:121957682-121957704 CTCAGCACTTTGGGAGGGCGAGG - Intronic
1076968817 11:121046-121068 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1077168340 11:1153645-1153667 CTGAGGCCTGTGGCGTGGCCGGG + Intergenic
1077180540 11:1210817-1210839 CCCAGCACTGTGGGATGCCGAGG + Intergenic
1077440371 11:2566068-2566090 CTCAGCCCTGTGGGGTGAGGTGG - Intronic
1080014534 11:27490794-27490816 CTCAGCACTTTGGCAGGCCGAGG + Intergenic
1080658665 11:34278051-34278073 CCCAGCACTTTGGCAGGGCGAGG - Intronic
1081355315 11:42105591-42105613 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1081555165 11:44152599-44152621 CTCAGCACTTTGGGAAGGCGAGG - Intronic
1081797643 11:45832499-45832521 CTCAGCACTTTGGGATGCCGAGG - Intergenic
1081884409 11:46482758-46482780 CCCAGCACTTTGGGGTGCCGAGG + Intronic
1082738129 11:56879549-56879571 CTTAACACTGTGGCATGGCCTGG + Intergenic
1083403143 11:62438428-62438450 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1083603595 11:63963295-63963317 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1083851357 11:65369332-65369354 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1084015471 11:66377575-66377597 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1084204435 11:67583749-67583771 CTCAGCACTGGGGCGGAGCGGGG + Exonic
1085260908 11:75204166-75204188 CTCTGCTCTGTGGCCTGGCCTGG - Intronic
1085990584 11:81838675-81838697 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1086060037 11:82691107-82691129 CTCAGCACTTTGGGGAGCCGAGG + Intergenic
1086230673 11:84566211-84566233 CTCAGCACTTTGGGATGCCGAGG - Intronic
1086764377 11:90676178-90676200 CTCTGCCCTGTGGCGTTGCAAGG - Intergenic
1087073584 11:94106543-94106565 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1088247202 11:107830333-107830355 CTCAGCACTGTGGGAGGCCGAGG + Intronic
1088308238 11:108433204-108433226 CCCAGCACTTTGGAGGGGCGAGG + Intronic
1088465941 11:110138807-110138829 CCCAGCACTTTGGGGTGCCGAGG - Intronic
1088576569 11:111277865-111277887 TTCAGCTCTGTGGTGTGGCTGGG - Intronic
1088982207 11:114874116-114874138 CCCAGCACTTTGGGGTGCCGAGG + Intergenic
1090282933 11:125473366-125473388 CCCAGCACTGTGGAGTGCCTCGG + Intronic
1090821185 11:130343221-130343243 CCCAGCACTTTGGCATGCCGAGG + Intergenic
1091146340 11:133283413-133283435 CTAAGCAGTGTGGGGTGGGGTGG - Intronic
1092230652 12:6773776-6773798 CTCAGCACCGTGTAGCGGCGGGG - Exonic
1093251001 12:16804895-16804917 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1093317520 12:17668981-17669003 CTCAGCACTTTGGGATGCCGAGG - Intergenic
1094004909 12:25738900-25738922 CACAGCAGTGTGGCCTGGAGAGG + Intergenic
1094216614 12:27949221-27949243 CTCAGCACTTTGGCAGGCCGAGG + Intergenic
1094667332 12:32533673-32533695 CTCAGCACTTTGGCACGCCGAGG - Intronic
1096741609 12:53697545-53697567 CTGAGCACAGTGGGGTGGTGGGG + Intergenic
1097954432 12:65469025-65469047 CTTAGCACTGTGGGAGGGCGAGG - Intronic
1098559055 12:71851787-71851809 CTCTGCCCTGTGGCGTTGCAGGG + Intronic
1100520785 12:95373788-95373810 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1100935008 12:99653912-99653934 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1101491718 12:105215788-105215810 CTCAGCACTTTGGGATGCCGAGG + Intronic
1101918050 12:108911456-108911478 CTCAGCACTGTGGGAGGCCGAGG + Exonic
1102382381 12:112478320-112478342 CCCAGCACTGTGGGGTGTTGAGG + Intronic
1103164356 12:118757299-118757321 CTCAGCACTTTGGGGGGCCGAGG + Intergenic
1103284327 12:119787479-119787501 CTCAGCACTTTGGGGGGCCGAGG + Intronic
1103628529 12:122240075-122240097 CTCAGCACTGTAGGGGGCCGAGG + Intronic
1103727150 12:123003632-123003654 GTCACCACTGTGGCTTGGAGGGG - Intronic
1103813053 12:123631420-123631442 CTCAGCACTTTGGGAGGGCGAGG + Intronic
1103972511 12:124680969-124680991 CTAGCCACTGTGGCGTGGAGGGG - Intergenic
1104046076 12:125163950-125163972 CCCAGCACTTTGGGGTGCCGAGG + Intergenic
1104993168 12:132637968-132637990 CGCAGCACTGTGGCTTTGAGAGG - Intronic
1107799757 13:44094717-44094739 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1108338490 13:49472019-49472041 CCCAGCACTGTGGCAGGCCGAGG - Intronic
1110852927 13:80264958-80264980 CCCAGCACTTTGGCATGCCGAGG + Intergenic
1111223630 13:85240057-85240079 CTCAGCACTGTGGGAAGCCGAGG - Intergenic
1112281311 13:98065209-98065231 CCCAGCACTTTGGCCGGGCGCGG - Intergenic
1113012716 13:105788625-105788647 CACAGCACTGGGGCTTGTCGGGG - Intergenic
1113191997 13:107759456-107759478 CCCAGCACTGTGGGAAGGCGAGG - Intronic
1114041173 14:18679997-18680019 CCCAGCACTGTGGGAGGGCGAGG + Intergenic
1114046199 14:18878465-18878487 CCCAGCACTGTGGGAGGGCGAGG + Intergenic
1114118011 14:19640985-19641007 CCCAGCACTGTGGGAGGGCGAGG - Intergenic
1114301157 14:21379600-21379622 CTCAGCACTTTGGGATGCCGAGG + Intronic
1117806910 14:59502996-59503018 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1118248301 14:64133456-64133478 CTCAGCTCTGTGGTGTGTTGGGG + Intronic
1118379881 14:65208859-65208881 CCCAGCACTGTGGGGGGCCGAGG + Intergenic
1118873311 14:69761342-69761364 CTCAGCACTCTGGGGGGCCGAGG + Intronic
1121039369 14:90732626-90732648 CTCAGCACTTTGGCAGGCCGAGG - Intronic
1121169853 14:91844511-91844533 CTCAGCACTGTGGGAGGCCGAGG + Intronic
1121817759 14:96941592-96941614 CCCAGCACTCTGGCGGGACGAGG - Intergenic
1122555173 14:102575051-102575073 CACAGCACGGGGGCGGGGCGGGG - Intergenic
1122602511 14:102928676-102928698 CTCAGACGCGTGGCGTGGCGTGG + Intronic
1122673190 14:103387741-103387763 CTCAGCACTTTGGGGAGCCGAGG - Intronic
1122866357 14:104606222-104606244 CTCAGCACTTTGGGAGGGCGAGG + Intergenic
1124404403 15:29381098-29381120 CCCAGCACTTTGGGGTGCCGAGG - Intronic
1125491748 15:40153710-40153732 CCCAGCACTTTGGCATGCCGAGG - Intergenic
1125558029 15:40602384-40602406 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1126002269 15:44222301-44222323 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1126417701 15:48435045-48435067 CTCAGCACTTTGGGATGCCGAGG - Intronic
1126483260 15:49151148-49151170 CTCAGCACTTTGGGAGGGCGAGG + Intronic
1128170410 15:65506496-65506518 CTCAGCACTGTGGGAAGCCGAGG + Intronic
1128299877 15:66559834-66559856 CTCAGCACTTTGGGATGCCGAGG + Intronic
1128847697 15:70916583-70916605 ATCAGCACTGAGGCCAGGCGCGG - Intronic
1130950127 15:88579869-88579891 CTCAGCACTTTGGCATGCCGAGG + Intergenic
1131013639 15:89039893-89039915 CTCAGCACTGGGGCATAGTGTGG - Intergenic
1131477543 15:92753074-92753096 CTCAGCACTTTTGGGAGGCGAGG + Intronic
1132112958 15:99115710-99115732 CTCAGCACTTTGTGGCGGCGAGG - Intronic
1132342056 15:101085105-101085127 CTCAGCACTGGGGGCTGGCCCGG + Intergenic
1132830185 16:1924078-1924100 GCCAGCACTGTGGCCGGGCGTGG + Intergenic
1134484534 16:14647025-14647047 CTCAGCACTGTGGGATGCTGAGG - Intronic
1134889641 16:17828663-17828685 CCCAGCACTTTGGCGGGCCGAGG - Intergenic
1135257846 16:20955548-20955570 CCCAGCACTGTGGGATGGTGAGG - Intronic
1136583407 16:31168455-31168477 CCCAGCACTTTGGCATGCCGAGG - Intergenic
1138508496 16:57492974-57492996 CCCAGCACTTTGGCAGGGCGAGG - Intergenic
1138645676 16:58422665-58422687 CTCAGCACTTTGGCAGGCCGAGG - Intergenic
1138675419 16:58647790-58647812 CCCAGCACTTTGGGGTGCCGAGG - Intergenic
1138686002 16:58726432-58726454 CTCAGCACTTTGGGGGGCCGAGG - Intronic
1139458350 16:67102383-67102405 CTCAGCACTTTGGGATGCCGAGG - Intergenic
1139548896 16:67662664-67662686 CCCAGCAGTGTGGAGTGGCATGG - Exonic
1141413703 16:83854021-83854043 CTCAGCCATGTGGCTTGGTGCGG + Intergenic
1141984271 16:87570087-87570109 CTCAGCACTGTGTGGAGGAGCGG - Intergenic
1142083724 16:88164948-88164970 CTCGGCACCGTGGCATGGCGGGG - Intergenic
1142124610 16:88403932-88403954 CTCAGCTCTGTGGCTTCGGGCGG + Intergenic
1142168366 16:88605920-88605942 CTCAGCACTGGCACGTGGAGTGG - Intronic
1142451858 16:90178075-90178097 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1142564170 17:828650-828672 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1143471911 17:7180630-7180652 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1143589970 17:7878469-7878491 CTCAGCACTGTGGGAGGCCGAGG + Intronic
1143748570 17:9011836-9011858 CTCAGCACTCTGGGGGGCCGAGG - Intergenic
1143797168 17:9346426-9346448 CTCAGCACTCTGGTGTGTCATGG + Intronic
1143974579 17:10820565-10820587 CCCAGCACTGTGGGATGCCGAGG - Intergenic
1144120260 17:12145557-12145579 CCCAGCACTTTGGGATGGCGAGG - Intergenic
1144282676 17:13742386-13742408 CACAGCACTGTGGGGGGCCGAGG - Intergenic
1144772282 17:17766555-17766577 GTCAGCACTGGGGCGTGCTGGGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145924485 17:28635519-28635541 CTCGGCACTGTAGAGTGGCCAGG + Exonic
1146330074 17:31919600-31919622 CTCAGCACTTTGGGATGCCGAGG + Intergenic
1146627084 17:34442959-34442981 CTCAGCACTCTGGAGTGGGAGGG + Intergenic
1147756252 17:42770176-42770198 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1147812884 17:43185744-43185766 CTCAGCACTTTGGGAGGGCGAGG + Intronic
1149899372 17:60459740-60459762 CTCAGCACTTTGGCGGGCCAAGG - Intronic
1149981515 17:61315079-61315101 CTGAGCAGTGTGGCGTGTGGAGG - Intronic
1150418218 17:65004997-65005019 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1150693866 17:67387413-67387435 CCCAGCACTTTGGGGTGCCGAGG + Intronic
1151613010 17:75189022-75189044 CCCAGCACTTTGGGATGGCGAGG + Intergenic
1151769350 17:76149781-76149803 CTCAGCACTTTGGGGGGCCGAGG + Intronic
1151790920 17:76305414-76305436 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1151830179 17:76544889-76544911 CTCGGAACAGTGGCGTGGAGGGG - Intronic
1152126386 17:78449924-78449946 CTCAGCACTATGGGGGGCCGAGG - Intronic
1152676199 17:81642554-81642576 CTCAGCATTGAGGTGTGGGGTGG - Intronic
1152732319 17:81978270-81978292 CCCAGCACTGTGGGATGCCGAGG + Intronic
1152836899 17:82539124-82539146 CTCAGCACTGTAAGGTGGCCGGG + Intronic
1152836908 17:82539169-82539191 CTCAGCACTGTAAGGTGGCCGGG + Intronic
1152836918 17:82539214-82539236 CTCAGCACTGTAAGGTGGCCGGG + Intronic
1152836928 17:82539259-82539281 CTCAGCACTGTAAGGTGGCCGGG + Intronic
1152836938 17:82539304-82539326 CTCAGCACTGTAAGGTGGCCGGG + Intronic
1152836946 17:82539349-82539371 CTCAGCACTGTAAGGTGGCTGGG + Intronic
1154192347 18:12241298-12241320 CTCAGCACTTTGGAAGGGCGAGG - Intergenic
1155759698 18:29549998-29550020 CCCAGCACTCTGGGGTGCCGAGG + Intergenic
1158592743 18:58791345-58791367 CTCAGCACTTTGGGATGCCGAGG - Intergenic
1160645624 19:190974-190996 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1160656330 19:273004-273026 CTCAGCACTTTGGGAGGGCGAGG - Intergenic
1161273010 19:3400588-3400610 CCCAGCACTGTGGGGGGCCGAGG + Intronic
1161716416 19:5878560-5878582 CTCAGCACTTTGGGATGCCGAGG - Intronic
1161883191 19:6972105-6972127 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1162095086 19:8305455-8305477 CTCAGCACTTTGGCAGGCCGAGG + Intronic
1162406306 19:10476442-10476464 CCCAGCACTTTGGGGGGGCGAGG - Intergenic
1162573068 19:11483545-11483567 CCCAGCTCTGGGGCGGGGCGGGG + Exonic
1162659910 19:12160827-12160849 CTCAGCACTTTGGGAGGGCGAGG - Intergenic
1162870393 19:13581903-13581925 CTCAGCACTTTGGGATGCCGAGG + Intronic
1163558826 19:18007309-18007331 TTCAGCTCTGTGGCGGGACGGGG + Intronic
1163645734 19:18488046-18488068 CTCAGCAGTGTGGTATGGTGTGG + Intronic
1163693034 19:18747384-18747406 CTCAGCACTTTGGGGGGCCGAGG + Intronic
1165103918 19:33457431-33457453 CTGAGCACTGTGGGCTGGCAGGG + Intronic
1165531984 19:36410749-36410771 CTCAGCACTTTGGGATGCCGAGG - Intronic
1165946322 19:39444990-39445012 CTCAGCACTTTGGCAGGACGAGG + Intronic
1166721158 19:44996928-44996950 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1166842441 19:45706348-45706370 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1167492753 19:49801713-49801735 TCCAGCACCGTGGCCTGGCGCGG - Exonic
1168498832 19:56876343-56876365 CTCAGCACTGTGGGATGCCGAGG - Intergenic
926052277 2:9752811-9752833 CTCTGCACTGGGGTGTGGTGGGG + Intergenic
926826362 2:16909245-16909267 CTCAGCACTTTGGGATGCCGAGG + Intergenic
928992065 2:37243198-37243220 CTCAGCACTTTGGGAGGGCGAGG + Intronic
929641320 2:43582817-43582839 CTCAGCACTTTGGGAGGGCGAGG - Intronic
929751688 2:44721717-44721739 CCCAGCACTTTGGGGTGCCGAGG + Intronic
929995782 2:46825613-46825635 CTCAGCTCTGAGGCCTGGAGAGG - Intronic
930131251 2:47853318-47853340 CTCAGCACTGTGGGAGGCCGAGG - Intronic
931315697 2:61128742-61128764 CTCAGCACTCTGGGGGGCCGAGG - Intronic
931363163 2:61595771-61595793 CCCAGCACTGTGGCAGGCCGAGG - Intergenic
932832587 2:75005384-75005406 CTCAGCACTTTGGGAGGGCGAGG - Intergenic
933767807 2:85722352-85722374 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
933910214 2:86934110-86934132 CTCAGCACTGTGGAAGGTCGAGG + Intronic
934022514 2:87969299-87969321 CTCAGCACTGTGGAAGGTCGAGG - Intergenic
935107904 2:100062552-100062574 CTCAGCTCTGTGGCTGGGTGGGG + Intronic
935257403 2:101323323-101323345 CTCAGCACTTTGGGAGGGCGAGG - Intergenic
937198035 2:120177392-120177414 CGGAGCACGGTGGGGTGGCGGGG + Exonic
937755031 2:125526789-125526811 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
937966768 2:127518043-127518065 CTGAGGACTGTGGGGTGGGGAGG + Intronic
938094941 2:128455546-128455568 CTGACCACTGTGGCCTGGCAGGG + Intergenic
938269022 2:129952496-129952518 CTCAGCACTGTGGGAGGGTGAGG - Intergenic
938746794 2:134286668-134286690 CTCAGCACTTTGGGAGGGCGAGG - Intronic
939462659 2:142516777-142516799 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
944175958 2:196829645-196829667 CCCAGCACTTTGGGGTGCCGAGG + Intergenic
944454204 2:199876569-199876591 CCCAGCACTTTGGGGTGCCGAGG + Intergenic
947403965 2:229755545-229755567 CCCAGCACTGTGGGAGGGCGAGG + Intergenic
947630877 2:231652303-231652325 CTCAGCACTTTGGCAGGCCGAGG + Intergenic
947761607 2:232607333-232607355 CTCAGCACTTTGGGGGGCCGAGG + Intronic
947809351 2:232992305-232992327 CTCAGCACTTTGGGGGGCCGAGG + Intronic
947906647 2:233768832-233768854 CTCAGCACTTTGGCAGGCCGAGG - Intronic
947955170 2:234183499-234183521 CTCAGCACTTTGGGGAGCCGAGG + Intergenic
948081475 2:235208479-235208501 CTCAGCACTTTGGGAGGGCGAGG + Intergenic
948197936 2:236108877-236108899 TTCAGCACTGTCTTGTGGCGGGG - Intronic
948431023 2:237919112-237919134 CTCAGCACTGTGGGAGGGCGAGG - Intergenic
1169240330 20:3972648-3972670 CCCAGCACTGTGGAGGGCCGAGG + Intronic
1169471721 20:5891680-5891702 CTCAGCACTTTGGGAGGGCGAGG - Intergenic
1170922440 20:20691595-20691617 CTTAGCACTGTGTCGGGGAGTGG - Intronic
1171431438 20:25085284-25085306 CTCAGCACTTTGGGAGGGCGAGG + Intergenic
1171988487 20:31677432-31677454 CTCAGCACTTTGGGGGGCCGAGG - Intronic
1172046809 20:32086267-32086289 CTCAGCACTTTGGGGGGCCGAGG - Intronic
1172224174 20:33293585-33293607 CTCAGCACTTTGGCAGGTCGAGG + Intronic
1172671241 20:36635663-36635685 CTCTGCACTGTGGAATGGCCAGG - Intronic
1173567083 20:44048884-44048906 CCCAGCACTTTGGCGGGCCGAGG + Intronic
1174014162 20:47474553-47474575 CTCAGCACTTTGGGAGGGCGAGG - Intergenic
1174601586 20:51729352-51729374 TTCAGCACTGGGTAGTGGCGGGG - Intronic
1174640598 20:52040600-52040622 CTCAGCACTTTGGGATGCCGAGG + Intergenic
1175631026 20:60536558-60536580 CCCAGCACTTTGGCAGGGCGAGG + Intergenic
1175672949 20:60921580-60921602 CTCAGCACTGAGGCATGCCCAGG - Intergenic
1176279881 20:64295249-64295271 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1176742277 21:10615794-10615816 CTCCCCAGTGTGGCATGGCGAGG + Intergenic
1177090778 21:16764787-16764809 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1178129115 21:29549854-29549876 CTCAGCACTTTGGGGGGCCGAGG + Intronic
1178932455 21:36831427-36831449 CTCAGCACTTTGGGAGGGCGAGG + Intronic
1180026809 21:45169166-45169188 CTCTGCACTGTGGCGTGGGAAGG + Intronic
1180464737 22:15601102-15601124 CCCAGCACTGTGGGAGGGCGAGG + Intergenic
1180970665 22:19813431-19813453 CTCAGCACTGTGGGAGGCCGAGG + Intronic
1182178430 22:28318158-28318180 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1182591880 22:31387379-31387401 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1182626678 22:31652379-31652401 CCCAGCACTTTGGCGGGCCGAGG - Intronic
1183344902 22:37301947-37301969 CTCAGCACTGTGGGAGGTCGAGG - Intronic
1184859277 22:47164028-47164050 CTCAGCTCTGTTACCTGGCGCGG - Intronic
1185257448 22:49843266-49843288 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
950457255 3:13100088-13100110 CTGAGAACAGTGGCGTGGCGAGG + Intergenic
951296577 3:20943694-20943716 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
952952111 3:38533522-38533544 ATCAGCACTGGGGTGTGGAGAGG - Intronic
953502406 3:43450288-43450310 CTCAGCACTTTGGGAGGGCGAGG + Intronic
953607071 3:44419191-44419213 CTCTGCCCTGTGGCCTGGCAGGG - Intergenic
953863202 3:46562974-46562996 CTCAGCACTTTGGGATGCCGAGG - Intronic
954199631 3:49016624-49016646 CTCAGCACTGAAGCATGGTGGGG - Exonic
954219792 3:49146004-49146026 CTCAGCACTTTGGGAGGGCGAGG + Intergenic
954252463 3:49378495-49378517 CTCAGCACTGTGGGAGGCCGAGG - Intronic
956535829 3:70275270-70275292 CTCAGCACTTTGGCAGGCCGAGG + Intergenic
959708140 3:109358284-109358306 CTCAGCACTTTGGGATGCCGAGG + Intergenic
959714154 3:109414321-109414343 CTCAGCACTTTGGCAGGCCGAGG + Intergenic
961582843 3:127897110-127897132 CTCAGCACTTTGGAGAGGCCAGG + Intergenic
963037163 3:141040718-141040740 CTCAGCACTGTGGGAAGTCGAGG - Intergenic
965587864 3:170334928-170334950 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
966845996 3:184130292-184130314 CTCAGCACTTTGGGGGGCCGAGG + Intergenic
968372057 3:198228552-198228574 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
968632153 4:1657262-1657284 CCCTGCACTGGGGCGTGGGGTGG - Intronic
969222754 4:5772144-5772166 CCCAGCACTGTGGGATGCCGAGG - Intronic
969481032 4:7446987-7447009 CTCAGCACAGTGGGGTGAGGAGG - Intronic
969593293 4:8133856-8133878 CTCAGGACTGTGGTGTGGGCAGG - Intronic
969836329 4:9845261-9845283 CTCAGCACTTTGGGGGGCCGAGG - Intronic
970438847 4:16062139-16062161 CCCAGCACTTTGGGGTGCCGAGG - Intronic
972477644 4:39466224-39466246 CTCAGCACTTTGGGAGGGCGAGG - Intronic
972957004 4:44405516-44405538 CTCAGCACTTTGGGAGGGCGAGG - Intronic
973061328 4:45729658-45729680 CCCAGCACTGTGGGATGCCGAGG + Intergenic
974056206 4:56985387-56985409 CTCGGTGCTGTGGCGAGGCGGGG + Intronic
975214602 4:71738689-71738711 TTCAGCCCTGTGGCTTGGCAGGG - Intergenic
975441080 4:74411343-74411365 CTCTGCACTTCGGCTTGGCGCGG + Intergenic
978185141 4:105848623-105848645 CTCAGCACTTTGGGATGCCGAGG + Intronic
979260743 4:118641034-118641056 CTCAGCACTGTGGAAGGCCGAGG + Intergenic
981209379 4:142084367-142084389 CTCAGCACTTTGGGGGGCCGAGG - Intronic
982710367 4:158752311-158752333 CTCAGCACTTTGGCAGGCCGAGG - Intergenic
982977811 4:162089382-162089404 CTCAGCACTTTGGGATGCCGAGG + Intronic
983087431 4:163464449-163464471 CTCAGCACTTTGGGATGCCGAGG - Intergenic
983591036 4:169411574-169411596 CTCAGCACTGTGGGAGGCCGAGG - Intronic
984120192 4:175732213-175732235 CTCAGCACTGTGGGAGGCCGAGG - Intronic
984130859 4:175874476-175874498 TTCAGTACTGTGGTGTGGAGGGG + Intronic
984730407 4:183063198-183063220 CTCAGCACTTTGGGGGGCCGAGG + Intergenic
986380871 5:7184292-7184314 CTCAGCACTTTGGCAGGCCGAGG - Intergenic
986734699 5:10660350-10660372 CTCAGCAGTGTGGCCTGGGCAGG + Intergenic
987339360 5:16925660-16925682 CTCAGCACTTTGGGATGCCGAGG - Intronic
988973280 5:36490737-36490759 CTCAGCCCTGCGGAGTGGCTAGG - Intergenic
989288938 5:39738934-39738956 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
989598467 5:43180043-43180065 CTCAGCACTTTGGGAGGGCGAGG - Intronic
989621854 5:43392365-43392387 CTCAGCACTTTGGAAGGGCGAGG - Intronic
989705853 5:44329423-44329445 CCCAGCACTTTGGGGTGCCGAGG - Intronic
990864617 5:60367196-60367218 CTCAGCACTTTGGGAGGGCGAGG + Intronic
991186897 5:63819161-63819183 CCCAGCACTTTGGGGAGGCGAGG + Intergenic
991706218 5:69361369-69361391 CCCAGCACTGTGGGGAGCCGAGG - Intronic
992452809 5:76888664-76888686 CCCAGCACTATGGCTGGGCGCGG - Intronic
993971850 5:94429658-94429680 CTCAGCCCTGGGGGGTGGCAGGG + Intronic
993999776 5:94765447-94765469 CTCAGCACTTTGGGAGGGCGAGG + Intronic
994091941 5:95817536-95817558 GTCATGACTGTGGCTTGGCGTGG - Intronic
994584158 5:101684223-101684245 CTCAGTACTGTGGGTTGGCCAGG - Intergenic
994820823 5:104648827-104648849 CTCAGCACTTTGGGATGCCGAGG - Intergenic
995511681 5:112917165-112917187 CTCAGCACTTTGGGGTGCTGAGG - Intronic
996851009 5:127952340-127952362 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
998253002 5:140564997-140565019 CTCAACAGTGTGGAGTGGTGTGG + Exonic
998535220 5:142924110-142924132 CTCAGCACTTTGGGATGCCGAGG - Intronic
999165336 5:149544883-149544905 CCCAGCACTTTGGCGGGCCGAGG + Intronic
999214456 5:149920328-149920350 CTCAGCACTGTGGGAGGCCGAGG + Intronic
999754868 5:154656862-154656884 CCCAGCACTGTGGGGGGCCGAGG - Intergenic
999975142 5:156904835-156904857 CCCAGCACTGTGGGATGCCGAGG + Intergenic
1001287328 5:170433435-170433457 CCCAGCACTTTGGGGTGCCGAGG - Intronic
1001757736 5:174183877-174183899 CCCAGCACTGTGACGTGAAGAGG + Intronic
1001943892 5:175761561-175761583 CTCAGCTCTGTGGCTTTGCAGGG - Intergenic
1002344737 5:178540629-178540651 CTCAGCAGGGTGGCTGGGCGTGG + Intronic
1002731298 5:181334101-181334123 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1002753237 6:139999-140021 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1003058970 6:2847760-2847782 CCCAGCACTTTGGGATGGCGAGG + Intergenic
1003930602 6:10920465-10920487 CTCAGCACTTTGGGAGGGCGAGG - Intronic
1003981852 6:11397264-11397286 CCCAGCACTTTGGGGTGCCGAGG + Intergenic
1004069788 6:12288066-12288088 CTCAGCAAGGTGGGGTGGCGTGG + Intergenic
1004530744 6:16453208-16453230 CTCAGCACTTTGGGATGCCGAGG + Intronic
1004969216 6:20890002-20890024 CTCAGCACTTTGGGGGGCCGAGG - Intronic
1005091881 6:22065692-22065714 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1006259617 6:32856948-32856970 CTCAGCACTTTGGGATGCCGAGG + Intronic
1006447199 6:34086289-34086311 GTCAGCACAGTGGCATGGCATGG - Intronic
1006957839 6:37891977-37891999 CTCAGCACTTTGGGAGGGCGAGG - Intronic
1009405102 6:63302874-63302896 CTCAGCACTTTGGGATGCCGAGG + Intronic
1010345010 6:74800733-74800755 CTCAGCACTTTGGGAGGGCGAGG + Intergenic
1010461944 6:76123742-76123764 CTCAGCACTTTGGGAGGGCGAGG - Intergenic
1010966202 6:82212234-82212256 CTCAGCACTTTGGGGGGCCGAGG - Intronic
1011134245 6:84082692-84082714 CTCAGCACTGTGGAAGGCCGAGG - Intronic
1011203766 6:84869020-84869042 CGGAGCACTGGGGTGTGGCGTGG - Intergenic
1011442187 6:87398939-87398961 CTCAGCACTTTGGGAGGGCGAGG + Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1016237218 6:141882768-141882790 CTCAGCACTTTGGGAGGGCGAGG + Intergenic
1017232897 6:152091930-152091952 CTCAGCCCTGTGGCTTGGGCGGG + Intronic
1019626763 7:2019740-2019762 CTCAGCACTGTGGCGTGGCGAGG - Intronic
1019780344 7:2936139-2936161 CTCAGCACTTTGGGATGTCGAGG - Intronic
1019907221 7:4073951-4073973 CTGAGCACTATGGGGTGGGGCGG + Intronic
1020171110 7:5845802-5845824 CCCAGCACTTTGGAGTGTCGAGG + Intergenic
1020192727 7:6012800-6012822 CTCAGCACTTTGGAAGGGCGAGG - Intronic
1020673924 7:11156542-11156564 CTCAGCACTGTGGGAGGCCGAGG + Intronic
1021641779 7:22744574-22744596 CACAGCACTGTGTGGTGGTGTGG + Intergenic
1023012016 7:35932765-35932787 CCCAGCACTTTGGGGTGCCGAGG + Intergenic
1023493832 7:40772873-40772895 CTCAGCACTGTGGGAGGCCGTGG - Intronic
1023593385 7:41802560-41802582 CTCATCATTGTGGCCAGGCGTGG + Intergenic
1024076444 7:45821280-45821302 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1024116321 7:46197239-46197261 CTCAGCACTTTGGAGGGCCGAGG - Intergenic
1025108661 7:56194242-56194264 CTCACCACTGGGGCTTGGTGAGG + Intergenic
1025124739 7:56335588-56335610 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1025127966 7:56360158-56360180 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1025187640 7:56873702-56873724 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1025213584 7:57036119-57036141 CTCAGCACTTTGGCAGGCCGAGG - Intergenic
1025658369 7:63540704-63540726 CTCAGCACTTTGGCAGGCCGAGG + Intergenic
1027008825 7:74723719-74723741 CTTAGCACCGTGGCCAGGCGCGG - Intronic
1027392671 7:77720990-77721012 CCCAGCACTTTGGCATGCCGAGG - Intronic
1027396025 7:77755412-77755434 CTCAGCACTGTGGGAGGCCGAGG + Intronic
1027926919 7:84477186-84477208 CCCAGCACTTTGGGGTGCCGAGG + Intronic
1028109705 7:86925144-86925166 CTCAGCACTGTGCCCTGGTGAGG - Intronic
1029392009 7:100281750-100281772 CTCAGCACTTTGGGAGGGCGAGG + Intergenic
1032784155 7:135187277-135187299 GTCAGCACTGTGGCTGGGGGAGG - Intronic
1033123629 7:138688049-138688071 CCCAGCACTGTGGGGGGCCGAGG - Intronic
1033805421 7:144948874-144948896 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1033910512 7:146258140-146258162 CTCAGCACTCTGGAAGGGCGAGG - Intronic
1034575000 7:151988948-151988970 CTCAGCACTGTGGGAAGCCGAGG - Intronic
1034782160 7:153890479-153890501 CTAAGCAATGTGGCATGGCAAGG - Intronic
1035185859 7:157125491-157125513 CTCAGCTCTGAGGCCTGGGGCGG - Intergenic
1035512211 8:200180-200202 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1036197832 8:6736100-6736122 CCCAGCACTGTGGGGGGCCGAGG - Intronic
1036512703 8:9415358-9415380 CCCAGCACTGTGGCGGGCCGAGG + Intergenic
1036647141 8:10618247-10618269 CTCAGCACTTTGGGGGGCCGAGG + Intronic
1036938060 8:13024291-13024313 CCCAGCACTGTGGGGGGCCGAGG - Exonic
1037862847 8:22418151-22418173 CTCAGCACTTTGGGATGCCGAGG - Intronic
1040047191 8:42975953-42975975 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1041541391 8:58989062-58989084 CCCAGCACTGTGGGGGGCCGAGG + Intronic
1042455740 8:69000210-69000232 CTCAGCACTTTGGGAAGGCGAGG + Intergenic
1042484830 8:69337783-69337805 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1042556550 8:70038247-70038269 CCCAGCACTTTGGGATGGCGAGG + Intergenic
1042877605 8:73453923-73453945 CTCAGCCCTCTGGAGTGGAGTGG - Intronic
1045235494 8:100349514-100349536 CTCAGCACTGGAGGGAGGCGAGG + Intronic
1045531410 8:102988659-102988681 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1045820302 8:106329240-106329262 CTCAGCACTTTGGGAGGGCGAGG - Intronic
1046106942 8:109677882-109677904 CCCAGCACTTTGGCAGGGCGAGG + Intronic
1047120472 8:121898392-121898414 CTCAGCACTTTGGGAAGGCGAGG + Intergenic
1048488997 8:134874587-134874609 CTCAGCACTTTGGGATGCCGAGG + Intergenic
1048983885 8:139719997-139720019 ATCAGCACTGAGGCTTGGAGAGG + Intergenic
1049092921 8:140530351-140530373 CTCGGCACTGTGGTGGGGTGGGG - Intergenic
1049768092 8:144364613-144364635 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1049982085 9:913642-913664 CTCAGCACTTTGGGATGCCGAGG + Intronic
1051941552 9:22511496-22511518 CTCAGCACTTTGGGGGGCCGAGG - Intergenic
1052588521 9:30460391-30460413 CTCAGCACTTTGGGATGCCGAGG + Intergenic
1053142039 9:35688553-35688575 CTCTGCCCTGTGGCCTGGCATGG + Intronic
1054725651 9:68647448-68647470 CCCAGCACTGTGGGATGGTGAGG - Intergenic
1054778272 9:69141837-69141859 CCCAGCACTGTGGCAGGCCGAGG - Intronic
1054784417 9:69197205-69197227 CTCAGCACTGTGGGAGGTCGAGG - Intronic
1054941912 9:70752857-70752879 CTCAGCACTTTGGCAGGCCGAGG + Intronic
1056912508 9:90715578-90715600 CTCAGCACTTTGGGGGGCCGAGG + Intergenic
1057008540 9:91581980-91582002 CTCAGCACTGTGGAAGGCCGAGG - Intronic
1057017487 9:91665491-91665513 CTCAGCACTTTGGGGGGCCGAGG - Intronic
1057537844 9:95932312-95932334 CCCAGCACTGTGGGAGGGCGAGG - Intronic
1058464692 9:105215733-105215755 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1060538270 9:124410242-124410264 CTCAGCACTTTGGGGGGCCGAGG - Intronic
1061138080 9:128747867-128747889 CTCAGCACTTTGGAGGGCCGAGG - Intronic
1061263396 9:129492144-129492166 CTCAGCACTGTGGGAGGCCGAGG - Intergenic
1061330433 9:129889063-129889085 CTCTGCTCTAAGGCGTGGCGGGG + Exonic
1061928240 9:133818112-133818134 CTCAGCACTTTGGGGGGCCGAGG + Intronic
1062755703 9:138286606-138286628 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1185555726 X:1019685-1019707 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1185559637 X:1049731-1049753 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1185559678 X:1049994-1050016 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1187365786 X:18664966-18664988 CTCAGCACTTTGGGAGGGCGAGG - Intronic
1189748682 X:44196165-44196187 CTCAGCACTGTGGCAGGCCAAGG - Intronic
1190259478 X:48789054-48789076 CTCAGCACTGTGGGAGGCCGAGG + Intronic
1190812094 X:53894871-53894893 CCCAGCACTTTGGGATGGCGAGG + Intergenic
1192353935 X:70382177-70382199 CCCAGCACTGTGGGATGCCGAGG + Intronic
1192489060 X:71558199-71558221 CCCAGCACTTTGGCCGGGCGAGG - Intronic
1195466296 X:105183049-105183071 CTCGGCACTGTGGCGAGTGGAGG + Intronic
1196838864 X:119839025-119839047 CTCAGCACTGTGGGAGGCCGAGG - Intronic
1198307041 X:135393678-135393700 CCCAGCACTTTGGCAGGGCGAGG + Intergenic
1198463363 X:136883780-136883802 CTCAGCACTTTGGGAGGGCGAGG - Intergenic
1198842907 X:140878334-140878356 CTCAGCACTGTGGCTTTCTGAGG + Intergenic
1199897419 X:152137922-152137944 CTCAGGTCTGCGGCGGGGCGTGG - Intronic
1200117080 X:153774116-153774138 CTGAGCACCGTGGCGGGGCAGGG - Intronic
1201193017 Y:11464931-11464953 CTCAGCACTTTGGAATGCCGAGG + Intergenic
1201522486 Y:14891260-14891282 CTCAGCACTTTGGAGTGTTGAGG + Intergenic
1202382219 Y:24283420-24283442 CTCAGCACTGTGGGAGGCCGAGG + Intergenic
1202488565 Y:25386705-25386727 CTCAGCACTGTGGGAGGCCGAGG - Intergenic