ID: 1019628372

View in Genome Browser
Species Human (GRCh38)
Location 7:2032939-2032961
Sequence CCCCGCAGAAGGACGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019628358_1019628372 25 Left 1019628358 7:2032891-2032913 CCACTCTGCACACAGGGAGAGTG 0: 1
1: 0
2: 3
3: 26
4: 247
Right 1019628372 7:2032939-2032961 CCCCGCAGAAGGACGTGGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 123
1019628357_1019628372 26 Left 1019628357 7:2032890-2032912 CCCACTCTGCACACAGGGAGAGT 0: 1
1: 0
2: 4
3: 21
4: 207
Right 1019628372 7:2032939-2032961 CCCCGCAGAAGGACGTGGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019628372 Original CRISPR CCCCGCAGAAGGACGTGGAG AGG Intronic
900510583 1:3058392-3058414 TGCTGCAGAAGGACGGGGAGGGG - Intergenic
900786605 1:4654164-4654186 CCCCGAAGAAGGACTGGGTGGGG - Intergenic
902805248 1:18857294-18857316 CCCTGGAGAAGGACCTGGGGAGG - Intronic
904014577 1:27409828-27409850 CCCCGGAGGAGGAGGAGGAGGGG + Exonic
905515510 1:38559140-38559162 ACCCCCATAAGGACGTGGAGAGG + Intergenic
916012748 1:160720885-160720907 CCCCACAGAAGGGAGTGAAGTGG + Intergenic
916012975 1:160723683-160723705 CCCCACAGAAGGGAGTGAAGTGG + Intergenic
916350705 1:163846523-163846545 CCCTCCAGAAGGAGGTGAAGAGG + Intergenic
919669677 1:200327454-200327476 ACCCACTGAAGGAGGTGGAGAGG - Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
1063386530 10:5619689-5619711 CCCCACCGAAGGAAGCGGAGGGG + Intergenic
1065343020 10:24723779-24723801 CGCCGCAGGAGGGCGTGGGGCGG + Intergenic
1067015294 10:42753639-42753661 CCCAGGAGAAGGGCGTGGCGAGG + Intergenic
1070667972 10:78358758-78358780 CCCTGCAGAAGGTGGTGGTGGGG + Intergenic
1071152553 10:82652184-82652206 CCCTGCAGCAGCACCTGGAGGGG + Intronic
1072082554 10:92045966-92045988 CTCTGCAGAGCGACGTGGAGCGG - Intergenic
1076750931 10:132542598-132542620 GCCTGGAGAAGGACATGGAGGGG - Intronic
1076865762 10:133165473-133165495 CCCCGCAGGGGGACGGGGACCGG + Intronic
1079521949 11:21338731-21338753 CCCTGCAGCAGGACTTGGAAAGG + Intronic
1080034836 11:27700307-27700329 CCCCCGAGCAGGAGGTGGAGGGG + Intronic
1083697106 11:64450135-64450157 GCCGTGAGAAGGACGTGGAGTGG + Exonic
1084022466 11:66425953-66425975 CTCTGCAGATGGAAGTGGAGGGG + Exonic
1087052188 11:93897164-93897186 ACCCACAGAAGGACATGGAGAGG + Intergenic
1090596542 11:128326966-128326988 CCGGGCAGAAGGACGTTGAGAGG - Intergenic
1091412526 12:253576-253598 CCTCTCAGAAGGGCCTGGAGGGG - Intronic
1091657037 12:2353512-2353534 CCCTGCAGCAGGAGGTGGAGAGG + Intronic
1095957218 12:47813688-47813710 CCCCACAGCAGGATGGGGAGGGG - Intronic
1095961119 12:47834919-47834941 CCCCGGAGAGGGACAGGGAGGGG - Intergenic
1102189185 12:110973260-110973282 CATCGCAGAAGAAAGTGGAGTGG + Intergenic
1102211972 12:111133807-111133829 TCCCTCAGTAGGACGTGGAGAGG + Intronic
1103936812 12:124481395-124481417 CACCCCAGGAGGACGTGGTGGGG + Intronic
1104947270 12:132421665-132421687 CATCGCAGAAGGGCATGGAGCGG + Intergenic
1113748995 13:112765468-112765490 ACGCTCAGAAGAACGTGGAGTGG - Intronic
1202860824 14_GL000225v1_random:80006-80028 CCCCGCAGAAGCCCGGGGACGGG - Intergenic
1129244576 15:74271694-74271716 CCCCGGAGAAAGATCTGGAGAGG - Exonic
1130049772 15:80474188-80474210 ATCCTCAGAAGGACGTGGATGGG - Intronic
1130878171 15:88032225-88032247 CTCAGCAGAAGGACAAGGAGAGG + Intronic
1132146820 15:99434023-99434045 CCCCGCAGAACGCTGTGGGGAGG + Intergenic
1132386834 15:101406841-101406863 CACTGTAGAAGGAGGTGGAGTGG - Intronic
1132717755 16:1300736-1300758 CCCAGCAGGAGGGCGTGGGGAGG - Intergenic
1133231002 16:4366436-4366458 CCCCTCAAAAGGCCCTGGAGTGG - Intronic
1133254412 16:4507897-4507919 CTGCCCAGAAGTACGTGGAGCGG + Exonic
1136110528 16:28061846-28061868 CCCTGAAGAAGGAGGTGGGGCGG + Intronic
1136560762 16:31037990-31038012 ACCGGGAGAAGAACGTGGAGCGG + Exonic
1140864693 16:79049895-79049917 CCATGCAGAAGGACATGGAGTGG + Intronic
1141660263 16:85437552-85437574 CCAAGGAGAAGGACGAGGAGGGG + Intergenic
1142256310 16:89015378-89015400 CTCGGCAGGAGGACGAGGAGGGG + Intergenic
1142733432 17:1878972-1878994 CCCTGCAGAAGCACGTGGGCAGG - Exonic
1142764998 17:2059713-2059735 CCCTGCACAAGGACCTGGATGGG + Intronic
1144573742 17:16416286-16416308 ACCAGCAGAGGGAAGTGGAGAGG - Intronic
1145763612 17:27442837-27442859 CCCAGCAGGAAGACGAGGAGTGG + Intergenic
1147967257 17:44199906-44199928 CCGCGCAGAGGGAGGGGGAGAGG - Intronic
1148440505 17:47709353-47709375 CCGCGCAGAAGGAGGCGCAGCGG - Exonic
1148975218 17:51521538-51521560 CCCCTCTTAAGGACGTGGGGAGG + Intergenic
1149806049 17:59619393-59619415 CCTCACAGGAGGACGTGGCGGGG - Intergenic
1151812662 17:76453418-76453440 CCCGGGAGGAGGAAGTGGAGTGG + Exonic
1152275695 17:79355478-79355500 CCAGGCAGCAGGACCTGGAGAGG - Intronic
1152616625 17:81340947-81340969 CCCCGCAGAAAGCAGAGGAGGGG + Intergenic
1154159736 18:11972359-11972381 CCCCGTAGACGGAAGTGCAGAGG + Intergenic
1158350957 18:56563894-56563916 CACAGCACAAGGAGGTGGAGGGG + Intergenic
1158859683 18:61580338-61580360 CACCGCAGAAGGACCAGAAGTGG + Intergenic
1159704171 18:71666067-71666089 GCCAGCAGAAGGATGAGGAGGGG + Intergenic
1161829390 19:6591355-6591377 CCCAGAAGAATGAGGTGGAGAGG - Intronic
1164682496 19:30145085-30145107 CCCCTCAGAAGGGCCTGGCGGGG - Intergenic
1164692635 19:30222597-30222619 CCCCGCAGACGGCCGGGCAGGGG - Intergenic
1165328353 19:35126824-35126846 ACAGGCAGAAGGACGGGGAGGGG + Intronic
1165738759 19:38193541-38193563 CACCGCAGAAGGGCCTGCAGCGG + Exonic
1166330427 19:42075314-42075336 CACCCCGGAAGGAGGTGGAGTGG + Intronic
925605690 2:5657753-5657775 GTCCACAGAAGGACGTGGACAGG + Intergenic
925628824 2:5868402-5868424 CCTTTCAGAAGGAGGTGGAGTGG - Intergenic
929920932 2:46171126-46171148 CCCCGCAGCAGGATGTGCAGTGG - Intronic
931348850 2:61470874-61470896 CCCCGCAGCGGGAGGGGGAGAGG + Intergenic
934771155 2:96908299-96908321 CCACGCACATTGACGTGGAGAGG + Intronic
936383159 2:112005510-112005532 CCTGGAAGAAGGACATGGAGAGG - Intronic
940751225 2:157628867-157628889 CCCCGCAGCCGGGCGGGGAGCGG + Exonic
948833602 2:240613204-240613226 CCACCCAGAAGGAGGAGGAGAGG + Intronic
948860425 2:240750200-240750222 CCCCGCAGTGGGCCCTGGAGGGG - Intronic
1169685554 20:8267328-8267350 CCCCGCAGAAGGCAGTGGGTGGG - Intronic
1170441015 20:16378804-16378826 CCCTGGAGAAGGACCAGGAGAGG - Exonic
1171182949 20:23104279-23104301 CCCAGCAGAAGGGAGAGGAGAGG + Intergenic
1173416814 20:42864171-42864193 CTCAGCAGAAGGCCCTGGAGTGG - Intronic
1174469312 20:50744437-50744459 GGCTGGAGAAGGACGTGGAGGGG - Intronic
1175875732 20:62228371-62228393 CCCTGCAGAAGGTCGGGAAGAGG + Intergenic
1175889507 20:62310068-62310090 GCCCGCAGCAGGACCTGGCGGGG + Exonic
1175900361 20:62357606-62357628 TCTCCCAGAGGGACGTGGAGTGG + Intronic
1175941037 20:62537635-62537657 CCCAGGAGAAGGTCTTGGAGTGG + Intergenic
1181462635 22:23094575-23094597 TCCTGCAGAAGGAGGTAGAGGGG - Intronic
1183189010 22:36309530-36309552 CCCCTAAGAAGGAAGTGGTGAGG + Intronic
1184877644 22:47285631-47285653 CCTCGCAGATGGCCTTGGAGTGG + Intergenic
1185017351 22:48352522-48352544 TCCCGAGGAAGGAAGTGGAGTGG - Intergenic
1185339246 22:50284249-50284271 CCCCACAGAGGGGCGTGGGGCGG + Intronic
952646218 3:35662490-35662512 CCCCACAGAGGGACAGGGAGGGG + Intronic
955319541 3:57964440-57964462 CCCCGCATAAGGTCCTGGGGTGG + Intergenic
961718969 3:128879547-128879569 CCCCGCAGCAGGGGATGGAGAGG - Intronic
962825921 3:139100991-139101013 TCCCACAGAAGGGCATGGAGTGG + Intronic
962945699 3:140167301-140167323 CCAGGCAGAAGAACGTGGATGGG - Intronic
964492203 3:157249020-157249042 ACCTGCAGAAGGGAGTGGAGAGG + Intergenic
965516761 3:169629964-169629986 CTCCGCAGAAGGGCTGGGAGAGG - Intronic
971897455 4:32616127-32616149 CCCCTCAGATGGATGTGGAAAGG - Intergenic
978387770 4:108192763-108192785 GGCTGCAGAAGGAGGTGGAGAGG + Intergenic
982200603 4:152956737-152956759 CCCCGCAGCAGGAGGTTGTGGGG - Intronic
982716483 4:158814159-158814181 CACCTCAGAAGGACATGCAGAGG + Intronic
986175377 5:5348031-5348053 CCCCACAGCAGGACGTGGCTCGG + Intergenic
993203713 5:84850090-84850112 GCAAGCAGAAGAACGTGGAGTGG + Intergenic
995078464 5:108016305-108016327 CCACACAGAAGGATGTGGAGTGG + Intronic
997727235 5:136132213-136132235 CTCCCCACAAGGAGGTGGAGAGG + Intergenic
998503390 5:142652865-142652887 CAGGGCAGAAGGAAGTGGAGGGG - Intronic
1002469815 5:179428625-179428647 CCACCCAGAAGGACGAGGAAAGG + Intergenic
1005583197 6:27252001-27252023 GCCCGCAGTAGGGCGTGGAGTGG - Exonic
1010649367 6:78433594-78433616 ACCCCCAGAATGACGTGGAAAGG + Intergenic
1014947263 6:127514324-127514346 CCTGGAAGAAGGAAGTGGAGTGG + Intronic
1016322033 6:142856842-142856864 GCCCACAGCAGGAAGTGGAGGGG + Intronic
1016768448 6:147821408-147821430 CCCTGCAGAACCACGTGGAGGGG - Intergenic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1017927236 6:158921185-158921207 CCCTGCACGAGGACCTGGAGTGG - Intergenic
1019367574 7:642839-642861 CACCACAGCAGGGCGTGGAGGGG + Intronic
1019628372 7:2032939-2032961 CCCCGCAGAAGGACGTGGAGAGG + Intronic
1019687154 7:2388333-2388355 CTCCTCAGAAGCAAGTGGAGAGG + Intergenic
1024113257 7:46168830-46168852 CCCCGAAGAAGGGCATGGAAAGG - Intergenic
1031402875 7:121346288-121346310 CCCCGCAGCAGGAATTGGAGTGG + Intergenic
1034355728 7:150449571-150449593 CCCCGCAGAAGGAGGAGCAGTGG - Intergenic
1035752126 8:2003127-2003149 CCGCGGAGGAGGACGTGGTGGGG + Exonic
1037959337 8:23084360-23084382 CCGCCCTGGAGGACGTGGAGGGG + Intronic
1039597888 8:38807217-38807239 CCCCAGAGATGGAGGTGGAGAGG + Intronic
1043701311 8:83291624-83291646 CCCCGCAGCAGCAGGTGGTGGGG + Intergenic
1050509300 9:6377001-6377023 CCCCCCAGAAGGGGGTGGACTGG + Intergenic
1051641740 9:19230428-19230450 CCCCGCAGGAGGAAAGGGAGAGG + Exonic
1053320998 9:37098742-37098764 CCCCTCTGAAAGAGGTGGAGGGG - Intergenic
1056558217 9:87707140-87707162 TCCCGCAGCAGGGCGTGGAGGGG - Exonic
1057605727 9:96496708-96496730 CCCCGCTGGAGGAGGTGCAGCGG + Intronic
1058139085 9:101339225-101339247 CCTCGCTGAAGGACGAGAAGAGG - Intergenic
1061550819 9:131333841-131333863 CCCTGCAGAGGCAGGTGGAGGGG - Intergenic
1061920892 9:133781768-133781790 CCCAGCAGAGGGATGAGGAGGGG + Intronic
1186425650 X:9463373-9463395 CCCCCCAGAAGGACATGGTGGGG - Intronic
1187853332 X:23612762-23612784 CTGCGCAGAAGGACATGGGGTGG - Intergenic
1189325803 X:40109850-40109872 CGTCGCAGAAGGAGGGGGAGAGG + Intronic
1190618885 X:52265641-52265663 CCCCTCAGAAGGGACTGGAGGGG - Intergenic
1193511082 X:82400339-82400361 ACCAGCAGCTGGACGTGGAGAGG - Intergenic
1196014675 X:110925091-110925113 CCCCAAAGAAGGACAAGGAGAGG + Intergenic