ID: 1019628393

View in Genome Browser
Species Human (GRCh38)
Location 7:2033047-2033069
Sequence CAGCTGACGCTGCCACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019628387_1019628393 13 Left 1019628387 7:2033011-2033033 CCTTCTTGGGGTACAGCAGCGTG 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1019628393 7:2033047-2033069 CAGCTGACGCTGCCACTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019628393 Original CRISPR CAGCTGACGCTGCCACTGAC TGG Intronic
No off target data available for this crispr