ID: 1019628969

View in Genome Browser
Species Human (GRCh38)
Location 7:2036342-2036364
Sequence GCGCTCCTGCGCTCATGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3680
Summary {0: 1, 1: 2, 2: 19, 3: 81, 4: 3577}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019628969_1019628977 30 Left 1019628969 7:2036342-2036364 CCCAGGCATGAGCGCAGGAGCGC 0: 1
1: 2
2: 19
3: 81
4: 3577
Right 1019628977 7:2036395-2036417 TTCCTGCGCCACCTCCGTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 111
1019628969_1019628972 -6 Left 1019628969 7:2036342-2036364 CCCAGGCATGAGCGCAGGAGCGC 0: 1
1: 2
2: 19
3: 81
4: 3577
Right 1019628972 7:2036359-2036381 GAGCGCTGACAAGTCAGGACAGG No data
1019628969_1019628974 -4 Left 1019628969 7:2036342-2036364 CCCAGGCATGAGCGCAGGAGCGC 0: 1
1: 2
2: 19
3: 81
4: 3577
Right 1019628974 7:2036361-2036383 GCGCTGACAAGTCAGGACAGGGG 0: 1
1: 0
2: 0
3: 13
4: 103
1019628969_1019628975 -1 Left 1019628969 7:2036342-2036364 CCCAGGCATGAGCGCAGGAGCGC 0: 1
1: 2
2: 19
3: 81
4: 3577
Right 1019628975 7:2036364-2036386 CTGACAAGTCAGGACAGGGGAGG 0: 1
1: 0
2: 4
3: 38
4: 259
1019628969_1019628976 29 Left 1019628969 7:2036342-2036364 CCCAGGCATGAGCGCAGGAGCGC 0: 1
1: 2
2: 19
3: 81
4: 3577
Right 1019628976 7:2036394-2036416 ATTCCTGCGCCACCTCCGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 51
1019628969_1019628973 -5 Left 1019628969 7:2036342-2036364 CCCAGGCATGAGCGCAGGAGCGC 0: 1
1: 2
2: 19
3: 81
4: 3577
Right 1019628973 7:2036360-2036382 AGCGCTGACAAGTCAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019628969 Original CRISPR GCGCTCCTGCGCTCATGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr