ID: 1019629334

View in Genome Browser
Species Human (GRCh38)
Location 7:2039062-2039084
Sequence AGTGATAGACAGCCTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019629334_1019629338 7 Left 1019629334 7:2039062-2039084 CCATCCACAGGCTGTCTATCACT 0: 1
1: 0
2: 5
3: 13
4: 179
Right 1019629338 7:2039092-2039114 TTTAATAACGTCATGCAAATGGG No data
1019629334_1019629337 6 Left 1019629334 7:2039062-2039084 CCATCCACAGGCTGTCTATCACT 0: 1
1: 0
2: 5
3: 13
4: 179
Right 1019629337 7:2039091-2039113 TTTTAATAACGTCATGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019629334 Original CRISPR AGTGATAGACAGCCTGTGGA TGG (reversed) Intronic
900290578 1:1921973-1921995 ATTTATTGACAGGCTGTGGAGGG + Exonic
903185172 1:21624799-21624821 CGTGCTAGACAGCCTGGGGTTGG - Intronic
904750188 1:32737144-32737166 AGGGACAGACAGCCTTGGGATGG - Intergenic
904965496 1:34369463-34369485 AGTCACTGACAGCCTGGGGAGGG + Intergenic
905015081 1:34772362-34772384 GGTGATAAAAAGCCTCTGGAAGG - Intronic
905299526 1:36977030-36977052 ACTGACAGCCAGCCTCTGGAGGG - Intronic
906505779 1:46378542-46378564 AGTGCTACACAGTCAGTGGAGGG - Intergenic
908081254 1:60581038-60581060 AGAGACAGACAGACAGTGGAGGG - Intergenic
910056799 1:83043463-83043485 AGTGATTGAAGGCTTGTGGAAGG + Intergenic
911218760 1:95224745-95224767 AGTGATATACAGTCTGGGCATGG + Intronic
912563204 1:110565107-110565129 AATGAGAGTCTGCCTGTGGAAGG + Intergenic
914901461 1:151713385-151713407 GATGAGAGACAGCCTGGGGATGG - Intronic
915489008 1:156241318-156241340 AGTGTTAAACACCCTGGGGAGGG - Intronic
919619416 1:199848052-199848074 TGTGATAGAGAGCAAGTGGATGG - Intergenic
920052374 1:203171780-203171802 GGTGATTCTCAGCCTGTGGATGG - Intronic
923121687 1:230998153-230998175 AGTCACAGCCAGACTGTGGATGG + Intronic
924520501 1:244802156-244802178 AGTGAGAGACGGCCTCTGCAGGG + Intergenic
1067382088 10:45783930-45783952 AGTGATGGACAGCCATAGGAAGG + Intronic
1067889784 10:50124572-50124594 AGTGATGGACAGCCATAGGAAGG + Intronic
1068973435 10:62982824-62982846 AGGGAGAGCCAGCCTGTCGAAGG - Intergenic
1072738830 10:97897225-97897247 AATTATAGGCAGCCTGGGGAAGG + Intronic
1073494753 10:103880673-103880695 GGTGTTAGACAGCATGTAGATGG + Intergenic
1073805545 10:107093770-107093792 AGTGATAGGCAGATTGTGTAAGG - Intronic
1074527394 10:114274258-114274280 GATGACAGACAGCCTTTGGAGGG + Intronic
1074757334 10:116634290-116634312 AGGGACAGAGAGCCGGTGGAGGG - Intronic
1074904977 10:117853462-117853484 AGTGGAAGACAGCTTTTGGAGGG + Intergenic
1075941052 10:126390206-126390228 AGTGAGAGAGAGCTTGTGGAGGG - Intergenic
1076527579 10:131121935-131121957 GCTGACAGACAGTCTGTGGAGGG + Intronic
1076843686 10:133058625-133058647 AGTGAGAAACGTCCTGTGGAGGG - Intergenic
1081347737 11:42010979-42011001 AGTCATAGACAGCTAATGGATGG - Intergenic
1081989455 11:47329921-47329943 AGGGAGAGACAGCCTGGGTATGG + Exonic
1083277029 11:61602734-61602756 ATTGATAGGCAGCCTGGGGCTGG + Intergenic
1084447756 11:69213597-69213619 AGTGAGAGAGAGCATGTGCAGGG + Intergenic
1084554267 11:69866511-69866533 AGTGTCAGACAGCCTGGGCAAGG + Intergenic
1086803923 11:91215653-91215675 AGTGATAGACATCCTTGGAATGG + Intergenic
1087926722 11:103927247-103927269 AGTAATTGAGAGCCTGAGGATGG - Intronic
1088816596 11:113425383-113425405 AGAGGTAGACAGCAGGTGGAGGG + Intronic
1088915702 11:114226383-114226405 GGTGCTGGACAGCCTGTGGTTGG + Intronic
1089644449 11:119869418-119869440 AGTGACAGACACAGTGTGGAAGG - Intergenic
1089826530 11:121282931-121282953 AGTGATAGTCAGCCACTGAAGGG + Intergenic
1091820191 12:3470462-3470484 CATGGTAGACAGCCTGGGGAAGG - Intronic
1095520690 12:43061602-43061624 ATTGAAAGGGAGCCTGTGGAAGG - Intergenic
1098857166 12:75665929-75665951 AGTGTCACACAGCCTGTAGATGG - Intergenic
1100793298 12:98153870-98153892 AGTGATAGAAAGCCTCTGAAGGG - Intergenic
1101411047 12:104468574-104468596 AGTGATAGACATTCTGCGAAGGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105926336 13:25012049-25012071 AGTGATAGAAAGCAAATGGATGG - Intergenic
1106165896 13:27246086-27246108 AGCAACAGAAAGCCTGTGGAGGG + Intergenic
1106240465 13:27908289-27908311 GGTGATAGACGGACTGTGGAAGG + Intergenic
1106910496 13:34458101-34458123 TGTGATAGGCAGCCTCTGAAAGG + Intergenic
1107116876 13:36756433-36756455 AATGATGAACAGCCTGTTGAAGG + Intergenic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1112868937 13:103944475-103944497 AGAGAGAGAGAGCTTGTGGAGGG - Intergenic
1113116035 13:106875774-106875796 AGTGAGAGGAAGCCTGTGGAGGG + Intergenic
1114482331 14:23043604-23043626 AGTGATAGACACCCTTTGGATGG + Exonic
1127097512 15:55527397-55527419 AATGGCAGACAGCCTGTGGATGG + Intergenic
1128537646 15:68502914-68502936 AGTGATAGTTAGCCTGGGGATGG - Intergenic
1128818375 15:70630418-70630440 ACTGGTGGACAGGCTGTGGAAGG + Intergenic
1128929930 15:71695132-71695154 ATTGGGACACAGCCTGTGGAAGG - Intronic
1130132225 15:81153682-81153704 GGTGATGGTCAGCCTGTGAAAGG + Intergenic
1133456366 16:5945878-5945900 AGTGTCAGACACCCTGTGGGAGG - Intergenic
1134198123 16:12174826-12174848 AGTAATAAACAGCATGTTGAAGG + Intronic
1134834930 16:17353324-17353346 ATTGACAGAGAGCCTGTTGAGGG + Intronic
1135792757 16:25412716-25412738 AGAGATAGAAATACTGTGGAAGG + Intergenic
1138695354 16:58807900-58807922 AATGAAAGCCAGCCTGTGTAAGG + Intergenic
1139055242 16:63175238-63175260 AGTGTTAGACATACTGTGGTTGG - Intergenic
1141000506 16:80303044-80303066 GGTGAGAGACAGCTTGTGCAGGG - Intergenic
1142191344 16:88719663-88719685 AGTGATGGACTGGGTGTGGACGG - Exonic
1143807580 17:9441981-9442003 TCTGAGAGTCAGCCTGTGGATGG - Intronic
1144167704 17:12628537-12628559 AGAGGTAGGCAGCCTGTGGCTGG + Intergenic
1146126022 17:30232401-30232423 AGTGACAGACAGCAAGGGGAGGG - Intronic
1146621334 17:34400825-34400847 TGTGATGGCCAGCATGTGGAAGG - Intergenic
1146906594 17:36622077-36622099 TGAGATAGCCAGCCTGGGGAAGG + Intergenic
1147548630 17:41422448-41422470 AGCGATAGACAGCCTGCGTAAGG + Intronic
1150637180 17:66921809-66921831 AGAGAGAGACAGCTTGTGCAGGG - Intergenic
1154023985 18:10689744-10689766 AGTGATGGACTGGGTGTGGACGG - Exonic
1155583526 18:27339097-27339119 AGTAATAGACATCCAGTTGAGGG - Intergenic
1155903393 18:31419342-31419364 TGTGAGAGGCAGCCTGTAGAAGG + Intergenic
1157248973 18:46077598-46077620 AGTGGTAGACAGGCTGTCGGTGG + Intergenic
1157708118 18:49826340-49826362 AGAGATTGACAGCCTGTGGAGGG - Exonic
1158329841 18:56349666-56349688 AGTGAGAGAGAGCTTGTGCAGGG - Intergenic
1159525760 18:69586829-69586851 ATTGATGGGCAGCCTGTGGGAGG - Intronic
1159886197 18:73909548-73909570 AGTAATAGTCAGCCTGGGAAAGG - Intergenic
1162838964 19:13341598-13341620 AGGGAGGGACAGCCTGTGCAAGG - Intronic
1163300905 19:16445612-16445634 AGTGACAGACTGCCTGGGGCTGG - Intronic
1164161594 19:22628721-22628743 AGTGGTAGGCAGGCTGTGGGGGG + Intergenic
1165939058 19:39406358-39406380 AGAGATAGACAGGGTGAGGAAGG - Intergenic
928028816 2:27761626-27761648 AGGGAGGGAGAGCCTGTGGAGGG - Intergenic
929594151 2:43165621-43165643 GGAGATGGACAGCCTTTGGAGGG - Intergenic
929887420 2:45891447-45891469 AGTGATAGCCAGCATCAGGATGG - Intronic
932111947 2:69010013-69010035 GGTGATGTTCAGCCTGTGGATGG - Intergenic
938287249 2:130128564-130128586 GGTGCTACACTGCCTGTGGAGGG - Intronic
938428346 2:131210305-131210327 GGTGCTACACTGCCTGTGGAAGG + Intronic
938469251 2:131544309-131544331 GGTGCTACACTGCCTGTGGAGGG + Intergenic
939559020 2:143712040-143712062 AGTGAAGGACAGCTTGTAGAAGG + Intronic
940321064 2:152376943-152376965 ACTGATAGAGACCCTGTGAAGGG + Intronic
942329228 2:174804483-174804505 AGTGGAAAACAGACTGTGGAAGG + Intronic
945403842 2:209422461-209422483 AATCATAGACAGTATGTGGATGG - Intergenic
1169120641 20:3093479-3093501 AGGGATAAACAGCTTGTGCAGGG + Intergenic
1169707272 20:8519526-8519548 AGTGATTGACAGTTTGAGGAAGG + Intronic
1170351436 20:15446356-15446378 AGGCATAGGCAGCCTGTGCAAGG + Intronic
1170976736 20:21171994-21172016 AGTGATATTTAGCCTCTGGATGG - Intronic
1174543075 20:51304870-51304892 AGCCACAGACAGCCTTTGGAGGG + Intergenic
1174721527 20:52818209-52818231 ATTGACAGACAGCCTGTTGATGG + Intergenic
1175270780 20:57732426-57732448 AGAGATATTCAGCATGTGGATGG - Intergenic
1175302991 20:57956145-57956167 GGTGATGGAGAGCCTGTGAAGGG + Intergenic
1175840357 20:62022611-62022633 AGAGAAAGCCAGCCTGTGTAAGG - Intronic
1177241007 21:18457262-18457284 AATGAAAGACAGCATGTGAATGG + Intronic
1178223306 21:30685584-30685606 AATGATACAAAGCCTGTGCAGGG - Intergenic
1179652057 21:42817638-42817660 AGGGATAGAGACCCTCTGGAAGG - Intergenic
1180678257 22:17603901-17603923 AGGGATAGACAGCCTGAGTATGG + Intronic
1181533385 22:23529781-23529803 ATTGATAGCCAGCCTGGGGGTGG - Intergenic
1184368269 22:44066640-44066662 AGTGGTCGACAGGCTGTTGAAGG - Intronic
1185284046 22:49992289-49992311 AGCGAGAGTCAGCTTGTGGAGGG - Intergenic
949625855 3:5866196-5866218 AGTGATAGAAAGTCAGTGGAGGG - Intergenic
950152043 3:10695277-10695299 AGAGAGAGACAGCTTGTGCAGGG + Intronic
952545113 3:34410687-34410709 AGTGATAAACATCCTATGGCTGG - Intergenic
953933897 3:47022925-47022947 TGTGTTACACAGCCTGTGTATGG - Intronic
954427563 3:50451444-50451466 AGTGTCAGGCAGCCTGGGGAGGG - Intronic
955969193 3:64420113-64420135 AGTGGTACACCTCCTGTGGAGGG + Intronic
956935980 3:74102348-74102370 AGTCAAAGACAGCCTGATGAGGG - Intergenic
962449510 3:135500910-135500932 AGTGAATGACAGCCACTGGATGG + Intergenic
965431829 3:168598666-168598688 AATGATAAACATCCTGTAGATGG + Intergenic
965934083 3:174083956-174083978 AGGGATAAACAGCCTCTAGATGG + Intronic
966656973 3:182370038-182370060 AGTGGTGGACAGCCTGAGTATGG - Intergenic
967462430 3:189761991-189762013 TGTGGGAGACACCCTGTGGAAGG - Intronic
973671785 4:53226856-53226878 AGTGATAGACAGGTTTTTGAGGG - Intronic
975276541 4:72507801-72507823 ATAGACAGATAGCCTGTGGAGGG - Intronic
976031565 4:80760925-80760947 AGTGAGAGACAGCATGTGTTGGG + Intronic
976519972 4:86015418-86015440 AGTGAAAGACAGGAAGTGGATGG - Intronic
977476759 4:97520164-97520186 AGTGAAAGACAGTTGGTGGAAGG + Intronic
979746057 4:124214661-124214683 AGGAAGAGACAGACTGTGGATGG - Intergenic
980241099 4:130176752-130176774 TGTGAGCGAGAGCCTGTGGATGG - Intergenic
982165933 4:152613745-152613767 AATGATCCCCAGCCTGTGGAGGG - Intergenic
982866873 4:160524719-160524741 AGTGATAGACAACCTAGGAAAGG + Intergenic
986449314 5:7850296-7850318 GGGGCTGGACAGCCTGTGGAGGG - Intronic
986769573 5:10959816-10959838 AGTGAGAGAGACCCTGTGGGAGG + Intergenic
990701679 5:58481466-58481488 AGTGAAGGACAGCATGTGTAGGG + Intergenic
990701688 5:58481550-58481572 AGTGAGTGACAGCATGTGTAGGG + Intergenic
990701707 5:58481662-58481684 AGTGAGGGGCAGCCTGTGTAGGG + Intergenic
990701765 5:58482021-58482043 AGTGAGGGACAGCATGTGTAGGG + Intergenic
990701780 5:58482212-58482234 AGTGAATGACAGCATGTGTAGGG + Intergenic
990701789 5:58482294-58482316 AGTGAATGACAGCATGTGTAGGG + Intergenic
990701797 5:58482376-58482398 AGTGAATGACAGCATGTGTAGGG + Intergenic
990701831 5:58482572-58482594 AGTGAATGACAGCATGTGTAGGG + Intergenic
990701840 5:58482651-58482673 AGTGAGGGACAGCCTGTATAAGG + Intergenic
994633398 5:102313959-102313981 AGTGCTATATAGCCTTTGGATGG - Intergenic
994703923 5:103175535-103175557 ACTGATAGAAAGCCTGTAGTTGG + Intronic
995289726 5:110438047-110438069 AATGTTAGAAAGCCTGGGGATGG - Intronic
995848315 5:116518220-116518242 GGTGAGGGACAGCCAGTGGAGGG - Intronic
997674057 5:135699731-135699753 AGTGATAGACTGCCTAGTGAGGG + Intergenic
998405117 5:141869849-141869871 AGGGAGAGAGAGCCAGTGGAAGG + Intronic
998594569 5:143515492-143515514 AATGATAGAATGACTGTGGAAGG - Intergenic
999473251 5:151874916-151874938 AGTGATAGGGAGCATGAGGAGGG + Intronic
1002063485 5:176640482-176640504 AGTGATAGATAGGCCCTGGAGGG - Intronic
1005639155 6:27778099-27778121 AGTGAGATACAGCCTCTGAAAGG - Intergenic
1007407973 6:41645643-41645665 AGTGACAGACAGCCTGAGACGGG - Intronic
1007711642 6:43827977-43827999 AGCGAGAGGCATCCTGTGGAGGG + Intergenic
1009990421 6:70836295-70836317 AGGCAAAGACAGCCTGTGTAGGG + Intronic
1015336303 6:132043305-132043327 AGTAATAGAAAGCAAGTGGATGG + Intergenic
1017228897 6:152051330-152051352 AGTGCTGGGCAGCCTGGGGATGG - Intronic
1018154624 6:160974239-160974261 AGAGAAAGACTGCATGTGGAAGG + Intergenic
1019629334 7:2039062-2039084 AGTGATAGACAGCCTGTGGATGG - Intronic
1020440264 7:8209986-8210008 GGTCAGAGCCAGCCTGTGGAGGG + Intronic
1021106848 7:16646860-16646882 TATGAGAGACAGCCTGTGGGAGG + Intronic
1021358357 7:19682431-19682453 AGAGAGAGACAGCTTGTGCAGGG - Intergenic
1022212533 7:28225610-28225632 AGTGATGCCCAGCATGTGGAAGG - Intergenic
1024458058 7:49631327-49631349 AGGGAAAGACAGCATGTGAAAGG + Intergenic
1027251257 7:76400240-76400262 AGGGACAGACAGACTGTGGCAGG - Intronic
1027682229 7:81235148-81235170 TGTGATAGACCACCTGTGGATGG - Intergenic
1027708662 7:81568660-81568682 TGAGAAAGACAGCATGTGGAAGG - Intergenic
1031692263 7:124803421-124803443 AGTTATGGACAGACTGTGCAGGG + Intergenic
1035167803 7:157002153-157002175 AGTGAAAGGCAACCTGGGGATGG - Intronic
1035781399 8:2230786-2230808 GGGGAGAGACAGCGTGTGGAAGG + Intergenic
1037727547 8:21495616-21495638 AGTGGTAGATAGCCACTGGAGGG - Intergenic
1038963179 8:32544811-32544833 AGTGATAGACAGGCCGGGCATGG - Intronic
1042384810 8:68161981-68162003 AGTGAGAGAGAGCATGTGCAGGG + Intronic
1044714501 8:95088200-95088222 GGTGAGAGGCAGCCTGTGGGAGG - Intronic
1044944869 8:97380525-97380547 AGAGATGGACAGGCTGTGGATGG - Intergenic
1045670257 8:104543482-104543504 AGGGAGAGACAGCTTGTTGATGG - Intronic
1046947727 8:119989695-119989717 AGTGATAGATAGCCTGTGCACGG - Intronic
1047092164 8:121586452-121586474 TGTCAGAGACAGCCAGTGGATGG + Intergenic
1048424890 8:134313867-134313889 AGTACGAGACAGCCTGTGAATGG + Intergenic
1048508805 8:135044012-135044034 AGTGATACACAGCCAGTGATGGG + Intergenic
1048806842 8:138249047-138249069 GGTGACAGACAGCCTGGGGTAGG - Intronic
1052997844 9:34560757-34560779 AGTGACTGTCAGCCTGTGGCAGG + Intronic
1053754767 9:41294280-41294302 AGAGATTGACAGCCTGTGGAGGG + Intergenic
1054260289 9:62858583-62858605 AGAGATTGACAGCCTGTGGAGGG + Intergenic
1056847975 9:90056872-90056894 TGTCAAAGACAGCCTGTGGGTGG - Intergenic
1057793049 9:98136652-98136674 AATGTTACACAGCCTGTGGGAGG - Intronic
1059358286 9:113718446-113718468 AGTGATAGACATGCTGGGGAGGG - Intergenic
1062262340 9:135669174-135669196 AGAGAGAGAGAGCCTGTGCAGGG - Intergenic
1186923774 X:14309843-14309865 AATGATAGGCAGCCAATGGAAGG - Intergenic
1192032132 X:67525056-67525078 AGTGCAAGACAGCTTGTGGTTGG + Intergenic
1193857355 X:86620691-86620713 TGTGATTGAGAGACTGTGGAAGG + Intronic
1194985817 X:100488559-100488581 AGTGCTAGACAGCTTGTGAGCGG - Intergenic
1195275470 X:103276420-103276442 AGGGATCCACAGGCTGTGGATGG + Intronic
1196751452 X:119121239-119121261 TTTGAAAAACAGCCTGTGGAGGG - Intronic