ID: 1019631192

View in Genome Browser
Species Human (GRCh38)
Location 7:2050685-2050707
Sequence TCTGCCCCTTCAGTTGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019631192_1019631198 11 Left 1019631192 7:2050685-2050707 CCAAGGACAACTGAAGGGGCAGA 0: 1
1: 0
2: 0
3: 29
4: 244
Right 1019631198 7:2050719-2050741 GAGCAGCCCAGTACCCCCGAGGG No data
1019631192_1019631197 10 Left 1019631192 7:2050685-2050707 CCAAGGACAACTGAAGGGGCAGA 0: 1
1: 0
2: 0
3: 29
4: 244
Right 1019631197 7:2050718-2050740 GGAGCAGCCCAGTACCCCCGAGG 0: 1
1: 0
2: 1
3: 17
4: 142
1019631192_1019631199 14 Left 1019631192 7:2050685-2050707 CCAAGGACAACTGAAGGGGCAGA 0: 1
1: 0
2: 0
3: 29
4: 244
Right 1019631199 7:2050722-2050744 CAGCCCAGTACCCCCGAGGGCGG 0: 1
1: 0
2: 1
3: 13
4: 119
1019631192_1019631206 30 Left 1019631192 7:2050685-2050707 CCAAGGACAACTGAAGGGGCAGA 0: 1
1: 0
2: 0
3: 29
4: 244
Right 1019631206 7:2050738-2050760 AGGGCGGCTCAGTCCTCAGCAGG 0: 1
1: 0
2: 1
3: 20
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019631192 Original CRISPR TCTGCCCCTTCAGTTGTCCT TGG (reversed) Intronic
900518734 1:3095610-3095632 TCTCCTCCTTCAGATGCCCTAGG + Intronic
900823069 1:4905002-4905024 TCTGCTCCTTCTGTGGTCCCTGG + Intergenic
901592749 1:10359371-10359393 TCTTCCCCTCCACTTGTCATAGG + Intronic
902065772 1:13685167-13685189 TCTGCACCCTCAGCTCTCCTGGG + Intergenic
902807927 1:18872419-18872441 CCTGCCCCTCCAGGTGTCCAGGG - Exonic
904396428 1:30225316-30225338 TCTGACCCTTCAGTTTCCTTAGG - Intergenic
904766683 1:32854177-32854199 TCTGCATATACAGTTGTCCTTGG + Intronic
906935364 1:50209749-50209771 TCTGCCCCTACATTTTTCATAGG + Intergenic
906944450 1:50283929-50283951 TCTGCCCCTTCTTTTGCCTTTGG - Intergenic
908043497 1:60142494-60142516 TCTGCTCCTTCACTAGCCCTGGG + Intergenic
908645763 1:66276033-66276055 TCTGCCCCCTCAGTTGTATTTGG + Intronic
909227539 1:73044671-73044693 TGTGCCCCTCCACCTGTCCTTGG + Intergenic
911665131 1:100543273-100543295 TCTGGCTCTTTAGTAGTCCTAGG + Intergenic
913248118 1:116888164-116888186 GCAGCCCCTACTGTTGTCCTGGG + Intergenic
915035228 1:152918001-152918023 TTTGCACCATCAGTTCTCCTGGG - Intergenic
915487578 1:156232527-156232549 TCAGCCCCTAGAGCTGTCCTGGG + Intronic
916440537 1:164820379-164820401 TCTGGCTTTTCAGTTGTACTTGG + Intronic
917925334 1:179784883-179784905 TCTGTCCCTTCAATTATCTTGGG + Intronic
918066290 1:181104469-181104491 GCGGCTCCTTCAGTTGTCCTGGG - Intergenic
918179163 1:182070964-182070986 TCAGCACCTTCAGTGGACCTGGG + Intergenic
918612142 1:186504968-186504990 GCTTCCCCTTCAGTTGCTCTAGG + Intergenic
919600941 1:199621531-199621553 TCTTCCCATTCACTTGGCCTTGG + Intergenic
920541780 1:206784311-206784333 CCTGCCCCTTCTGTTCCCCTCGG + Intergenic
920730623 1:208480466-208480488 ACTCCCCATTCAGTTGTCCTTGG - Intergenic
921967382 1:221104917-221104939 TCTGCCCCTTGTCTTTTCCTGGG + Intergenic
922195212 1:223353729-223353751 GCTGCCCCTTCCTCTGTCCTGGG - Intronic
923491715 1:234489963-234489985 TCTGCACCATCAGCTCTCCTGGG + Intergenic
923568528 1:235094309-235094331 TCTGCACCTTCCGCTCTCCTGGG - Intergenic
924085915 1:240451491-240451513 TCTGCCCCTGCAGTGGTTCTGGG + Intronic
1063367697 10:5501005-5501027 TTTGCCCCTTGTGTGGTCCTGGG - Intergenic
1065628314 10:27653507-27653529 TCTGGCCCTTCCTCTGTCCTGGG + Intergenic
1067043563 10:42971125-42971147 TCTGCCCCTCCACCTGCCCTGGG - Intergenic
1067497322 10:46773043-46773065 TCCTGCCCTTCAGATGTCCTAGG - Intergenic
1067571725 10:47376648-47376670 TCAGCCCCTCCATTTGTGCTAGG - Intronic
1067597330 10:47567372-47567394 TCCTGCCCTTCAGATGTCCTAGG + Intergenic
1067821705 10:49536742-49536764 TCTCCTCCTTCAGTAGTCCTGGG + Intronic
1068783695 10:60946474-60946496 TCTGCCTCATCAGTTGTTGTGGG - Intronic
1069715410 10:70517771-70517793 TCTGCCCCTGCAGTTTTCACGGG + Intronic
1070809832 10:79292145-79292167 TCTCCCCCTGCAGTTACCCTGGG + Exonic
1070861771 10:79673013-79673035 TCTGCCCTTTCAGTTTGCCTAGG + Intergenic
1070875380 10:79801616-79801638 TCTGCCCTTTCAGTTTGCCTAGG - Intergenic
1071642307 10:87323758-87323780 TCTGCCCTTTCAGTTTGCCTAGG - Intergenic
1072723959 10:97800226-97800248 TCTGCTTCTTTAGTTCTCCTGGG + Intergenic
1073506900 10:104003078-104003100 TCTTCACCTTCAGTTGTTCCTGG - Exonic
1074708800 10:116159691-116159713 TCTCCCACTTCACTTGTCCATGG - Intronic
1074810275 10:117097999-117098021 TGTGCCTCTTCAGTTGTTCTGGG - Intronic
1077196087 11:1280872-1280894 ACTGTCCCTTCAGCTGTCCCTGG - Intronic
1078855857 11:15206163-15206185 TCTCCCCCTTCAGCCATCCTGGG - Intronic
1078913026 11:15750942-15750964 TCTGCCCCCTCAGCTGTCCCTGG - Intergenic
1079356733 11:19736048-19736070 TCTGCCCCTTGAGCTTCCCTGGG - Intronic
1081616308 11:44593368-44593390 TCTGCCCATGCAGCTGTCCCAGG + Intronic
1081720291 11:45284079-45284101 TCTGCCCCTTCATTTTTCTCTGG - Intronic
1081967448 11:47178243-47178265 TCTGTCCCTTCAGCTGTTCCAGG - Intronic
1083755362 11:64789189-64789211 CCTGCCCCTGCATTTGTCCTGGG - Exonic
1084468409 11:69340891-69340913 TTTGCCCATTCATTTGTCTTAGG + Intronic
1085994358 11:81893276-81893298 TCTGCCCCATCTGTTGCCATGGG - Intergenic
1086823205 11:91461725-91461747 ACTGCCACTTCAGTTATCATGGG + Intergenic
1086938474 11:92769788-92769810 TTTGACCCTTCATTTGTCATAGG + Intronic
1087637275 11:100716206-100716228 TCTGCCCCTTGAATTGTGCTGGG + Intronic
1089567448 11:119379209-119379231 ACTGCCCCTTTAATTCTCCTGGG - Intronic
1089606603 11:119645046-119645068 TCTGCCCCTGAAGCTGTCCTGGG + Intronic
1090819465 11:130328184-130328206 GCTGCCCCCTCAGTAGTCTTTGG + Intergenic
1091504710 12:1055723-1055745 TCTGCCACTTCAACTGACCTAGG + Intronic
1093240743 12:16669161-16669183 TTTCCCCCTTCAGTTGTACTAGG + Intergenic
1094816123 12:34186566-34186588 ACTGCCCCTTAAGTTCTCTTAGG + Intergenic
1095100975 12:38183704-38183726 ACTGCCCCTTAAGTTCTCTTAGG - Intergenic
1095732661 12:45522283-45522305 ACTGGCCCTTCAGTTTGCCTGGG + Intergenic
1097059591 12:56272655-56272677 TCTGCCCCTTCTGTTTCCATAGG - Exonic
1097163755 12:57069979-57070001 TGTGCCCTTCCATTTGTCCTAGG - Intronic
1104431954 12:128723849-128723871 CCTGCCCTTTCAGGTCTCCTGGG - Intergenic
1104700024 12:130895889-130895911 TCAGCCCCTGCAGTAATCCTCGG - Intergenic
1105366976 13:19774260-19774282 AAAGCCTCTTCAGTTGTCCTTGG - Intronic
1105857874 13:24387868-24387890 TCTGCCCCTTCAGGGAGCCTGGG + Intergenic
1107016276 13:35710099-35710121 GCTGCCCCCTCAGGTGACCTGGG - Intergenic
1107496755 13:40933786-40933808 TCTCCTCCTTCAATTGTCTTGGG - Exonic
1109391976 13:61705515-61705537 TCTGCACCATCAGTTTTCTTGGG + Intergenic
1111832455 13:93346411-93346433 AGTGCCACTTCAGTTTTCCTGGG - Intronic
1112136026 13:96578490-96578512 TCTGCCGTTTCCTTTGTCCTTGG + Intronic
1113561447 13:111284850-111284872 TCTGCGCCTGCAGGTGCCCTCGG + Intronic
1114391176 14:22310284-22310306 TCTGCCACTGCTGTGGTCCTAGG - Intergenic
1114757674 14:25278544-25278566 TCTGCCCCTCCAGTGATCCAGGG - Intergenic
1116963050 14:50986500-50986522 TTACCCCCTTCAGTTGTCCTGGG + Intronic
1118466719 14:66037985-66038007 TCTGCCCCTTAAGTAGACCTTGG - Intergenic
1118507652 14:66431410-66431432 TGTGCCCCTTCAGTAGTACTTGG + Intergenic
1118603733 14:67488308-67488330 CCTGCCCTTTCACTTCTCCTCGG - Intronic
1122263625 14:100536837-100536859 TCTGCTCCTTGAGATGTACTGGG - Intergenic
1122799894 14:104224325-104224347 CCTGGCCCCTCACTTGTCCTTGG + Intergenic
1123918887 15:25056839-25056861 CCTGCCCCTTCAAATGTGCTTGG + Intergenic
1124479198 15:30062957-30062979 TCCGCACCTTCAGTTTGCCTGGG - Intergenic
1125687382 15:41571501-41571523 TCTTGTCCTTCAGATGTCCTAGG - Intronic
1126049732 15:44675016-44675038 TCTGCCATTTCAGTTACCCTTGG - Intronic
1126178792 15:45764930-45764952 TCTGTCGCTGCAGTTGTTCTTGG + Intergenic
1126558130 15:50013108-50013130 TCTGACCCTCCAGTTCTGCTGGG - Intronic
1127762415 15:62152009-62152031 TCAGCCCTTTGAGATGTCCTGGG - Intergenic
1128074517 15:64817969-64817991 GCTGCCCCTCCAGCTGGCCTGGG - Exonic
1128388029 15:67164568-67164590 TCAGTCACTTCAGTTGTGCTTGG - Intronic
1128819110 15:70636165-70636187 TCTGTGCCTTCTGTTGTCCATGG - Intergenic
1132780378 16:1621219-1621241 TCTTCCCCATCACATGTCCTGGG - Intronic
1135035301 16:19072131-19072153 TCTGCCCATTCAGTAGACCAGGG - Intronic
1137290286 16:47047926-47047948 TCTGCCTCTTCAGCCGGCCTGGG + Intergenic
1137558339 16:49487440-49487462 TCTGCCCCTTCCCTTCTCCAAGG + Intergenic
1140053643 16:71505224-71505246 TCTGCTATTTCAGTTATCCTTGG - Intronic
1140132819 16:72178987-72179009 TCTGCTTCTTGAGTTGCCCTGGG + Intergenic
1144237297 17:13273966-13273988 TCTTCCCCTTCAGTTGTGGTTGG + Intergenic
1144359749 17:14480723-14480745 TCTGCCCCTTCTTTTCTGCTTGG - Intergenic
1146429753 17:32780948-32780970 TGTGCCCCTTCAGATGCCATTGG + Intronic
1146835011 17:36103764-36103786 TGTGCCCCCACATTTGTCCTAGG + Exonic
1146849625 17:36211000-36211022 TGTGCCCCCACATTTGTCCTAGG + Intronic
1148463012 17:47848809-47848831 ACTGCCCCTTGTGTTGGCCTGGG - Intronic
1148774581 17:50088322-50088344 GCTGCCCCCTCAGTAGTCGTCGG - Intronic
1150107797 17:62475253-62475275 TCTGTCCCTTCACCTGTCCCAGG - Intronic
1151163663 17:72186324-72186346 TCTGCCCTTGCAATTCTCCTAGG + Intergenic
1151398752 17:73842190-73842212 TCAGCCACTCCAGCTGTCCTCGG - Intergenic
1152074525 17:78150694-78150716 TCTACCCCTTCAGGTGTCCCAGG - Intronic
1152444619 17:80334369-80334391 TCTGCCCTTTACGTAGTCCTTGG - Intronic
1153112376 18:1607490-1607512 TCTGCAGCTCCAGTTCTCCTGGG + Intergenic
1153223693 18:2882280-2882302 GCTTCCTCTTCAGTTTTCCTTGG + Intronic
1157594300 18:48854528-48854550 TCTGCCCCTGCTGCTGCCCTAGG + Intronic
1160178908 18:76617813-76617835 TCTGCCCCGTCGGAGGTCCTTGG + Intergenic
1161746304 19:6062242-6062264 ACTGCCGCTGCTGTTGTCCTTGG - Intronic
1161854067 19:6753706-6753728 CCCGCCCCTGCATTTGTCCTAGG - Intronic
1163563082 19:18032439-18032461 TCTGCCCCTTCTGTTTCCATAGG + Intergenic
1167689799 19:50978336-50978358 TCTGCACCTTCAGCTGTCAGGGG - Intronic
924999996 2:397203-397225 CCAGCCCCTTCACCTGTCCTCGG + Intergenic
925019654 2:558403-558425 CCTGTCCCTTCCGTTCTCCTGGG + Intergenic
925782789 2:7398214-7398236 TTTCCCCCTTCAGTTTCCCTTGG - Intergenic
930142790 2:47970042-47970064 TTTGGCTATTCAGTTGTCCTAGG + Intergenic
932487358 2:72092291-72092313 ACTGCTCCTTCTGTTCTCCTGGG - Intergenic
932936572 2:76110064-76110086 TCTGCCCCTACAGTAGTGCTAGG + Intergenic
933544924 2:83697716-83697738 TCTGCCCCTACAGCTGTGCTGGG - Intergenic
934912818 2:98274920-98274942 TCTGCTCCTACAGTTGTCCAAGG - Intronic
935796304 2:106644655-106644677 TCACCTCCTTCAGGTGTCCTGGG - Intergenic
935885074 2:107609106-107609128 TCTCCCTCTTCAGTTTTTCTGGG + Intergenic
935920556 2:108008497-108008519 TCTGCCTCTTCTGTAGTCTTGGG - Exonic
936160439 2:110080558-110080580 ACTGCCCCCTCATTTGTCCCAGG + Intergenic
936184225 2:110290796-110290818 ACTGCCCCCTCATTTGTCCCAGG - Intergenic
936280592 2:111136343-111136365 TTTCCCGCTTCAGTTTTCCTGGG + Intronic
937914083 2:127090407-127090429 TCCACCACTTCAGTTGTGCTGGG + Intronic
939916217 2:148047018-148047040 TGTGCTCCTTCAGGTCTCCTTGG + Intronic
942807645 2:179951785-179951807 CCTGCCTCTTCAGTGTTCCTGGG - Intronic
943453639 2:188075775-188075797 TCTGCCAGCTCAGATGTCCTTGG + Intergenic
944286761 2:197959265-197959287 ACTGCACCATCAGTTCTCCTGGG - Intronic
946230726 2:218289776-218289798 TCTGCCTCTGAAGATGTCCTTGG - Intronic
946739708 2:222789781-222789803 CCTGCAGCTTCAGTTCTCCTGGG - Intergenic
947877567 2:233477897-233477919 TCTGCCCCTTCAGTCTTGCCCGG + Intronic
1170552160 20:17487397-17487419 TGTGGCCCATCAGTGGTCCTGGG - Intergenic
1171383197 20:24748559-24748581 TCTGCCCTCTGAGGTGTCCTGGG - Intergenic
1171958640 20:31477719-31477741 TCGCCCCCTCCACTTGTCCTCGG - Intronic
1173371245 20:42438232-42438254 TATGCATCTACAGTTGTCCTAGG - Intronic
1173569353 20:44066678-44066700 TCTGCCCCCTCATCTCTCCTTGG + Intronic
1175024138 20:55883340-55883362 GCTTCCCCTTCATCTGTCCTGGG + Intergenic
1178700359 21:34828120-34828142 CCTGCCCCTACAGTTTTGCTGGG - Intronic
1179418325 21:41215969-41215991 TCTGCCCCTTCCTTTATTCTAGG - Intronic
1181559865 22:23693809-23693831 CATTCCCCTTCAGATGTCCTTGG - Exonic
1183032927 22:35118867-35118889 TCTGCCCCATGAGTTGGCCTGGG + Intergenic
1184739514 22:46419251-46419273 TTTGGCCCTTCATTTGTCATTGG - Intronic
949204444 3:1421197-1421219 TCTGCCCCTCTTTTTGTCCTAGG + Intergenic
949476811 3:4454553-4454575 TATGACCCTGCAGTTCTCCTAGG + Intronic
950839137 3:15950017-15950039 TCTACCCCTCCAGTTGTTCGGGG + Intergenic
950983990 3:17340686-17340708 TCTGCTCTTTCAGCTGCCCTTGG - Intronic
951191806 3:19780695-19780717 TGTTCCCCTTCTGTTGTCCATGG - Intergenic
951445966 3:22781141-22781163 TCTCCCCCTTCCGTAGTACTTGG - Intergenic
953194002 3:40714929-40714951 TCTCCACCTTCAGGTCTCCTGGG + Intergenic
954543482 3:51412632-51412654 TCTTCCCCTTTATGTGTCCTAGG - Intronic
955205181 3:56889234-56889256 ACTGCCTTTTCGGTTGTCCTGGG + Intronic
955507566 3:59647386-59647408 TCTGACCCTCCATTTGTCCATGG - Intergenic
955838801 3:63089272-63089294 TAAGCCTCTTCAGTTGGCCTTGG - Intergenic
956160061 3:66341969-66341991 TCTTCAACTTCATTTGTCCTTGG + Intronic
956165306 3:66394076-66394098 TCTGACCCTTCAGTGATTCTGGG + Exonic
959175815 3:102908810-102908832 ACTGCACATTCAGTTTTCCTTGG - Intergenic
960179401 3:114557320-114557342 TCTGACCCTTCTGTTATCCCAGG - Intronic
961019142 3:123489502-123489524 TCTGCCCCTTTCCGTGTCCTTGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
963269520 3:143272009-143272031 TCTGCCCCTTCATTCTTCCCTGG - Intronic
965490315 3:169327083-169327105 TCTGACCCTATAGTTGACCTTGG - Intronic
966000730 3:174944985-174945007 CTTGCCCCTTCAGTTCTTCTGGG + Intronic
966515437 3:180815797-180815819 TCTGCACCATCAGCTCTCCTGGG + Intronic
967591016 3:191273735-191273757 TCTTCTCCTCCAGTTATCCTTGG + Intronic
968993900 4:3933376-3933398 TGAGACCCTTCAGTTGCCCTGGG + Intergenic
970164591 4:13222939-13222961 GCAGCCCCTTCAGTGGTCTTAGG - Intergenic
971122148 4:23716610-23716632 TATCCCCCTTCTGTAGTCCTTGG + Intergenic
972342168 4:38162044-38162066 TCTGCCCCTACTGCTGTCATGGG - Intergenic
973634216 4:52846842-52846864 TCTGGCCAGGCAGTTGTCCTTGG - Intergenic
974103614 4:57443475-57443497 TCAGCCCCTTGAGCTGTTCTTGG + Intergenic
974415361 4:61599660-61599682 TCTGTCCCTCCAGCTTTCCTTGG - Intronic
974458640 4:62160827-62160849 TCTGACCCTTCCCTTGTCCAAGG - Intergenic
974582002 4:63815050-63815072 TCTGCCACTTCAAGTGTCCATGG + Intergenic
979048466 4:115899262-115899284 TCTGCACCATCAGCTCTCCTGGG + Intergenic
979093338 4:116515977-116515999 GCTGCCCCTGGAGTTGCCCTTGG + Intergenic
980114402 4:128665424-128665446 TATGACACTTCAGTTCTCCTGGG + Intergenic
980150664 4:129043409-129043431 GCTGCCCATTTAGTTCTCCTAGG + Exonic
984745997 4:183218662-183218684 TCTGCACCATCAGCTTTCCTGGG - Intronic
985881410 5:2641565-2641587 TCTGCCCCTTGAGCTGTCTTGGG + Intergenic
987709645 5:21491580-21491602 CCTGCCCGTTCACCTGTCCTGGG - Intergenic
988749968 5:34182586-34182608 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
989354476 5:40527682-40527704 TCTACACCTTAAGCTGTCCTTGG - Intergenic
989538077 5:42586811-42586833 TCTGCACCTTCATTTGGCTTTGG - Intronic
991738226 5:69645788-69645810 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
991759968 5:69910634-69910656 CCTGCCCGTTCACCTGTCCTGGG - Intergenic
991787364 5:70207464-70207486 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
991789802 5:70225514-70225536 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
991814551 5:70500623-70500645 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
991817686 5:70521907-70521929 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
991839198 5:70785697-70785719 CCTGCCCGTTCACCTGTCCTGGG - Intergenic
991879810 5:71207849-71207871 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
991882250 5:71225873-71225895 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
993174795 5:84470064-84470086 TCTGCACCATCAATTCTCCTAGG + Intergenic
994461072 5:100067673-100067695 CCTGCCCATTCACCTGTCCTGGG + Intergenic
994485221 5:100381117-100381139 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
995199298 5:109409510-109409532 GCTGCCTCTTCTGCTGTCCTTGG - Intronic
996020197 5:118582612-118582634 TCTGCCTCTTCTATTTTCCTGGG - Intergenic
996823330 5:127654492-127654514 TCTGCCTCTTCAGTCACCCTAGG - Intronic
997957129 5:138287557-138287579 TCTGCCACTGCAGAAGTCCTTGG - Intronic
998129480 5:139644156-139644178 TCTGCTCCTTCAGACGTCATGGG + Intergenic
1002689256 5:181038824-181038846 TCAGCCCCTTTTGCTGTCCTAGG + Intergenic
1003072501 6:2956260-2956282 TCTGCCCCTTCTGATGTCAGGGG - Intronic
1004590381 6:17045721-17045743 TCTGCTACTTGAGCTGTCCTTGG - Intergenic
1005548030 6:26888916-26888938 CCTGCCCGTTCACCTGTCCTAGG + Intergenic
1006010838 6:31041839-31041861 GCCGCTCCTTCAGTTGTCTTTGG - Intergenic
1006448590 6:34093045-34093067 TCTGCCCGCTCAGTTGTCCAGGG + Intronic
1007498673 6:42279362-42279384 CCTGGCCCTGCAGCTGTCCTGGG + Intronic
1009018790 6:57930010-57930032 CCTGCCCGTTCACCTGTCCTGGG + Intergenic
1010653797 6:78487678-78487700 TCTGCCCCTTCACTGGAGCTGGG + Intergenic
1011739617 6:90347007-90347029 CCTGCCCCTTCTCTTCTCCTAGG - Intergenic
1014665403 6:124231041-124231063 TCTGCCCCTGCAGTTTTGCAGGG - Intronic
1016769736 6:147835765-147835787 TCTTCCCCTCCACTTGTCTTGGG + Intergenic
1019631192 7:2050685-2050707 TCTGCCCCTTCAGTTGTCCTTGG - Intronic
1020243571 7:6413656-6413678 TCTGCCCCTTCATTTTTGCTGGG - Intronic
1023618121 7:42041608-42041630 CCTGCTACTTCAGTTGTTCTGGG - Intronic
1024934888 7:54702064-54702086 TCTGCCTCTACAGATGTCATAGG - Intergenic
1027346269 7:77262918-77262940 TCTGCCCTTTCAGTGGCGCTTGG - Intronic
1027505778 7:79016089-79016111 TCTGCCAGCTCAGTTGTCCATGG - Intronic
1031490989 7:122388157-122388179 TCAGCACCATCAGTTGTTCTGGG - Intronic
1032036843 7:128527793-128527815 TCTGTCCCTTCACCTGTCCCAGG - Intergenic
1032246692 7:130219440-130219462 TCTGACCTTTAAGCTGTCCTTGG + Intergenic
1032348036 7:131135078-131135100 TCTCCTCCTTCAGTGGTTCTAGG + Intronic
1034957811 7:155345454-155345476 TCCGCCCCTTCAGTGGTTCCAGG + Intergenic
1034998540 7:155593663-155593685 CCTGCCTCATCAGTTCTCCTGGG - Intergenic
1037595630 8:20351820-20351842 TCTGCCCCTTATGTAGGCCTTGG + Intergenic
1037686518 8:21144165-21144187 TCTGCCTCTCCTGTTGTCCCAGG - Intergenic
1037764378 8:21763336-21763358 TCTGCCCCATCTGTCCTCCTGGG + Intronic
1037819724 8:22129882-22129904 TAGCCCCCTGCAGTTGTCCTGGG - Intronic
1037914189 8:22762435-22762457 TCTGCTCCATCAGTTTTTCTGGG + Intronic
1038924206 8:32119710-32119732 TATGGCCTTCCAGTTGTCCTGGG - Intronic
1038983070 8:32780255-32780277 TCTGCTCCTGCAGTTGCCATAGG - Intergenic
1039003946 8:33012740-33012762 TCTGCTCTTTCAGCTGTTCTTGG - Intergenic
1039268475 8:35854575-35854597 TCTGGCCCTTCAGTTTGCATGGG + Intergenic
1040455627 8:47594578-47594600 GCTGCCCCTTCCTTGGTCCTTGG + Intronic
1040799819 8:51328165-51328187 TCTGCACCATCAGCTGTCCTGGG + Intronic
1040861954 8:52008258-52008280 CTTGCCCCTTAAGTCGTCCTAGG - Intergenic
1041194179 8:55384019-55384041 TCTCCCTTTTGAGTTGTCCTAGG + Intronic
1041535792 8:58924244-58924266 TCTGCACCTTCACATGTCATTGG - Intronic
1042304165 8:67314079-67314101 ACTGACCCTTCAGTTTTCATGGG - Intronic
1045342294 8:101265884-101265906 TCTGCCTCCTCAGCTGTTCTAGG + Intergenic
1045833361 8:106490979-106491001 TCAGCCCCTTCGCTTGTCCTGGG + Intronic
1045946817 8:107805580-107805602 TCTTCCCCTTCAGCTCTGCTAGG - Intergenic
1047305186 8:123646932-123646954 TGTGCCCCTGCAGTGGTGCTTGG - Exonic
1049096261 8:140550060-140550082 CCTGCCCCTTCTTTTGTCCTTGG - Intronic
1049708396 8:144053042-144053064 CCTGCCCCTGGAGGTGTCCTCGG - Exonic
1051383747 9:16484861-16484883 TCTCCCCCATCACTTGTCATTGG - Intronic
1051467971 9:17402704-17402726 TCTGCACCATCAGCTCTCCTGGG + Intronic
1053313226 9:37032569-37032591 TATGCCCCAGAAGTTGTCCTGGG + Intronic
1055339840 9:75269523-75269545 TTTCCCCCTTCAGATGTCCAGGG - Intergenic
1056556239 9:87691061-87691083 CCTGCCCCTTCAGTTTTTTTTGG + Intronic
1058918705 9:109592774-109592796 TTTGCCCCTCCAGTTGAGCTGGG + Intergenic
1061498828 9:130990850-130990872 TCTTCCCCTTCAGGTCTCCGCGG - Intergenic
1062035957 9:134382647-134382669 TCAGCCCCTCCAGTTATCCAGGG + Intronic
1188468283 X:30507836-30507858 TCTGCCTCTCCTATTGTCCTTGG + Intergenic
1189204599 X:39226903-39226925 TCTGCCCTTTGAGTAGTCATAGG - Intergenic
1194714190 X:97271684-97271706 CCTGACCTTTCAGTTGGCCTTGG + Intronic
1195627921 X:107022759-107022781 TCTAGCCTTTAAGTTGTCCTGGG - Intergenic
1200048075 X:153413088-153413110 TCAGCCCCATCAGCTTTCCTTGG - Intergenic
1201760932 Y:17537306-17537328 ACTGCCCCTTAAGTTCTCTTAGG + Intergenic
1201840620 Y:18368684-18368706 ACTGCCCCTTAAGTTCTCTTAGG - Intergenic