ID: 1019631326

View in Genome Browser
Species Human (GRCh38)
Location 7:2051380-2051402
Sequence AAGGCTCCACAGCACCACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019631326_1019631335 4 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631335 7:2051407-2051429 TACAGGACAGAAGGGGCTCCTGG No data
1019631326_1019631340 23 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631340 7:2051426-2051448 CTGGGATCTGGATGAAGTGGTGG 0: 1
1: 0
2: 0
3: 33
4: 288
1019631326_1019631337 11 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631337 7:2051414-2051436 CAGAAGGGGCTCCTGGGATCTGG No data
1019631326_1019631342 29 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631342 7:2051432-2051454 TCTGGATGAAGTGGTGGCGAGGG 0: 1
1: 0
2: 1
3: 18
4: 175
1019631326_1019631336 5 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631336 7:2051408-2051430 ACAGGACAGAAGGGGCTCCTGGG 0: 1
1: 0
2: 1
3: 28
4: 286
1019631326_1019631341 28 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631341 7:2051431-2051453 ATCTGGATGAAGTGGTGGCGAGG 0: 1
1: 0
2: 0
3: 10
4: 124
1019631326_1019631332 -4 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631332 7:2051399-2051421 CCTTGGCCTACAGGACAGAAGGG 0: 1
1: 0
2: 1
3: 17
4: 171
1019631326_1019631338 20 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631338 7:2051423-2051445 CTCCTGGGATCTGGATGAAGTGG No data
1019631326_1019631333 -3 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631333 7:2051400-2051422 CTTGGCCTACAGGACAGAAGGGG 0: 1
1: 0
2: 1
3: 20
4: 163
1019631326_1019631330 -5 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631330 7:2051398-2051420 GCCTTGGCCTACAGGACAGAAGG 0: 1
1: 0
2: 3
3: 26
4: 203
1019631326_1019631343 30 Left 1019631326 7:2051380-2051402 CCCACGTGGTGCTGTGGAGCCTT 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1019631343 7:2051433-2051455 CTGGATGAAGTGGTGGCGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019631326 Original CRISPR AAGGCTCCACAGCACCACGT GGG (reversed) Intronic
900975619 1:6014364-6014386 GAGGCCACGCAGCACCACGTCGG + Intronic
903074222 1:20749944-20749966 AAGACTCCTCTGCACCAGGTGGG + Intronic
904956485 1:34288446-34288468 CAGGCTCCACAGCCCCTCATTGG + Intergenic
916511639 1:165476897-165476919 TATGCTCCACAGGACCACATGGG + Intergenic
917917294 1:179715497-179715519 AAGGCTCCACATAAGCACTTGGG + Intergenic
918299560 1:183190367-183190389 AAGGCTCCTCAGCACCTTCTTGG - Intronic
919448076 1:197735335-197735357 AATGCTACACAGCTCCACCTTGG + Intronic
1065460695 10:25960238-25960260 AAGGCTCCAGAGCATAAAGTTGG - Intronic
1071375495 10:84998288-84998310 ATGGCTCCAAAGCACCAGGTAGG - Intergenic
1074155319 10:110793535-110793557 AGAGCTCCGCTGCACCACGTGGG + Intronic
1074756492 10:116627721-116627743 CAGGTCCCACAGCACCGCGTGGG - Intronic
1077625998 11:3771873-3771895 AAGGGCCCACAGAACCAGGTGGG - Exonic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1079367803 11:19824489-19824511 AAGGCTGCACAGCACAACAGGGG - Intronic
1079562894 11:21844736-21844758 AAACCTCCACAGCAACACCTAGG - Intergenic
1081962769 11:47150591-47150613 AAGCCTCCACAGCATCTCTTGGG - Intronic
1082983393 11:59144804-59144826 AAGGCTCCAGAGCTCCAGCTGGG - Exonic
1083297545 11:61723181-61723203 GAGGCTCCTCAGCACCTCCTTGG + Intronic
1083750817 11:64759638-64759660 CAGGCTCCCCAGCAGCACCTTGG + Exonic
1089715890 11:120358913-120358935 AAGGCTCAACTGCACCTGGTGGG + Intronic
1098055583 12:66501863-66501885 ATGGCTTCACAGCAGCATGTTGG + Intronic
1098536862 12:71603119-71603141 ATTGCACAACAGCACCACGTGGG - Intergenic
1099530411 12:83772588-83772610 AAGCCTCCACAGGAGCACTTGGG - Intergenic
1104365323 12:128171462-128171484 AAGGCCACACAGAACCATGTGGG + Intergenic
1109305597 13:60637479-60637501 AAAGCTCAACAGCAGCACCTAGG - Intergenic
1116225633 14:42148342-42148364 AAAGCCCAACAGCACCACCTGGG - Intergenic
1119192166 14:72690168-72690190 ACGTCTCCACATCTCCACGTAGG + Intronic
1122521646 14:102348351-102348373 AAGGCTGAGCAGCACCACGTGGG + Exonic
1122827124 14:104375699-104375721 AAGGCACCCCAGCATCACGCTGG - Intergenic
1123151348 14:106184937-106184959 CAGGCTCCTCAGCTCCATGTAGG + Intergenic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1126340288 15:47634269-47634291 AAGGGTCAGCAGCACCAAGTGGG - Intronic
1131009345 15:89004315-89004337 AAGGCTCCTAAGCACCAGCTGGG - Intergenic
1135382015 16:22003411-22003433 AAGGCTGCAGTGGACCACGTGGG - Intergenic
1136515601 16:30766374-30766396 AAGGCTCCGCAGGGCCACCTGGG - Exonic
1141157989 16:81610302-81610324 TCGGCTCCTCAGCACCACGGCGG - Intronic
1144695381 17:17300923-17300945 AAGGCTCCACTGCCCCTCGCAGG + Intergenic
1152657315 17:81526002-81526024 AGGGCCCCACAGCTCCACGTTGG - Intergenic
1152663219 17:81552510-81552532 AAGGCTCCCCTGCTCCCCGTGGG - Intronic
1152724073 17:81936743-81936765 AGGGCTTCACAGCAGCAGGTAGG - Exonic
1155254548 18:23983294-23983316 AAGGCTGGACAGATCCACGTAGG - Intergenic
1160327946 18:77967962-77967984 CAGGCTTCACTGCACCATGTGGG - Intergenic
1164998453 19:32740861-32740883 AAGACTGCACAGCACCATCTTGG - Intronic
927980234 2:27370381-27370403 CAGGGTCCACAGCGCCACCTGGG + Intronic
934779091 2:96957786-96957808 AAGGGTTCACATCACCATGTTGG - Intronic
937453254 2:122019800-122019822 AAAGCACCACAGCAGCACGGAGG + Intergenic
937719086 2:125071069-125071091 GAGGCTCCACAGGAGCACCTGGG - Intergenic
938752598 2:134347844-134347866 AAGGCTCCACATGACCACAGTGG + Intronic
946835007 2:223763962-223763984 ATAGCACCACAGCACCACCTGGG - Intronic
948735400 2:240000838-240000860 CAGGCTCCACCACACCACCTAGG + Intronic
1171314470 20:24177009-24177031 AAGTCTCCATAGCACCACTATGG + Intergenic
1171371377 20:24664471-24664493 AACCCTCCTCAGCATCACGTGGG + Intronic
1177497922 21:21913307-21913329 AAGTCTCCACATCACCATGTGGG + Intergenic
1179028943 21:37703288-37703310 AGGGCTCCACAGCAACAGGGGGG + Intronic
1180663114 22:17486407-17486429 AGGGTTCCACAGCATCACGGGGG - Intronic
1184112278 22:42402345-42402367 CATGGTCCACAGCCCCACGTGGG - Intronic
1185368692 22:50448559-50448581 AAGGCTGCACAGCGCCTCGAGGG - Exonic
950881219 3:16323932-16323954 AAGACTGCACAGCACCAGGCGGG + Intronic
952880383 3:37982057-37982079 AAAGGACCACAGCACCACTTAGG + Exonic
953483402 3:43272083-43272105 AAAGGTGCACAACACCACGTCGG + Intergenic
961834961 3:129650130-129650152 AAGACTCCACATCATCACTTTGG + Exonic
962751873 3:138439542-138439564 AAGGCTGCAGAGCTCCACGCAGG - Intronic
968573963 4:1356354-1356376 GGGGCTGCACACCACCACGTTGG - Intronic
970172424 4:13303211-13303233 AGTGCTCCTCAGCTCCACGTAGG - Intergenic
975666785 4:76741064-76741086 GGGGCTCCGCAGCCCCACGTGGG - Exonic
978843463 4:113244257-113244279 CAGGGTTCACAGCACCAAGTAGG - Intronic
980909135 4:138978104-138978126 AAGGACCCACAGCAGCAGGTGGG - Intergenic
983669326 4:170217226-170217248 AAGGCTCCACACAAGCACCTGGG - Intergenic
986192663 5:5511461-5511483 AAGGCTGCCCAGCTCCAAGTGGG + Intergenic
986593601 5:9396785-9396807 AATGCTACACAGGGCCACGTGGG - Intronic
991613199 5:68469401-68469423 AATGCTCCACTGCCCCAGGTTGG - Intergenic
997666363 5:135632575-135632597 ATGTCTCCACAGCACCAGGAGGG + Intergenic
1002088099 5:176788388-176788410 AAGTCTTCCCAGCACCAGGTGGG - Intergenic
1003510058 6:6772209-6772231 AAGGCTCTCCAGCACCAAGCTGG - Intergenic
1003579263 6:7324830-7324852 TAGGCTCCACAGCACAGCCTAGG - Intronic
1003839319 6:10104078-10104100 AAGTCTACACAGCACAAGGTAGG - Intronic
1004562626 6:16764379-16764401 AAGTCGCCACAGCAGCACTTGGG + Intergenic
1004692507 6:18004461-18004483 AAGTCTTCAGAGCATCACGTTGG - Intergenic
1007962692 6:45974860-45974882 ACATCTCCACAGCACCAAGTGGG + Intronic
1013519344 6:110918127-110918149 AAGGGTCCACAGACCCCCGTTGG - Intergenic
1014123898 6:117755255-117755277 AAGGCTCCACATGAGCACCTGGG - Intergenic
1016840542 6:148520180-148520202 CAGGCTCCGCTCCACCACGTAGG - Intronic
1018583903 6:165334754-165334776 AAGGCTCAACAGAACAAGGTGGG + Intronic
1019631326 7:2051380-2051402 AAGGCTCCACAGCACCACGTGGG - Intronic
1020754858 7:12189820-12189842 ACGGCTACACTGCACCACCTTGG + Intergenic
1028313749 7:89373468-89373490 AAGGCTGCACAGTCCCACGGGGG - Intergenic
1030311562 7:108074042-108074064 CAGGCTCCAGAGCTCCAGGTGGG + Intronic
1038006723 8:23436806-23436828 AAGGCTGCACTGCAGCATGTTGG - Intronic
1041196816 8:55409024-55409046 AAGGAGCCACAGCACCAGGAGGG + Intronic
1046604244 8:116353243-116353265 AAGGCTCCACAGCAACCAGGTGG - Intergenic
1048934686 8:139345049-139345071 AAGGGTAGACAGCACCACTTTGG - Intergenic
1186193523 X:7089148-7089170 TAAGCTACACAGCACCACCTGGG + Intronic
1187004364 X:15217367-15217389 CAGGCTCCACAGCAACACTTTGG + Intergenic
1187490676 X:19748417-19748439 AATGCTTCAGAGCAGCACGTGGG + Intronic
1188074682 X:25760512-25760534 CAGGCTCATCAGCACCACCTGGG + Intergenic
1188798682 X:34498899-34498921 AGTGCTGCACAGCACCACTTGGG + Intergenic
1190879338 X:54481846-54481868 AAGGCTCCACAGCAGGAAGAAGG + Intronic
1191149657 X:57207767-57207789 AAGGATCCACAGACCCATGTTGG + Intergenic
1192153311 X:68725172-68725194 AAGGCTACACAGGACCCCATGGG - Exonic
1194584146 X:95712949-95712971 AAGACAACACAGTACCACGTAGG - Intergenic
1195926365 X:110029729-110029751 AAGATTTCACAGCACCACATAGG - Intronic
1200357363 X:155565876-155565898 AAGGCACCCCATCACCCCGTGGG + Intronic
1201565440 Y:15360669-15360691 TAAGCTACACAGCACCACTTGGG + Intergenic