ID: 1019633749

View in Genome Browser
Species Human (GRCh38)
Location 7:2064476-2064498
Sequence GGCTCACAAGAGCTGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019633745_1019633749 2 Left 1019633745 7:2064451-2064473 CCCTGTAAGAGGCTGGGATGGCT 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1019633749 7:2064476-2064498 GGCTCACAAGAGCTGCCTCTGGG No data
1019633739_1019633749 22 Left 1019633739 7:2064431-2064453 CCTCAGGAAGCGGCTCTGGCCCC 0: 1
1: 0
2: 1
3: 35
4: 235
Right 1019633749 7:2064476-2064498 GGCTCACAAGAGCTGCCTCTGGG No data
1019633746_1019633749 1 Left 1019633746 7:2064452-2064474 CCTGTAAGAGGCTGGGATGGCTC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1019633749 7:2064476-2064498 GGCTCACAAGAGCTGCCTCTGGG No data
1019633744_1019633749 3 Left 1019633744 7:2064450-2064472 CCCCTGTAAGAGGCTGGGATGGC 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1019633749 7:2064476-2064498 GGCTCACAAGAGCTGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019633749 Original CRISPR GGCTCACAAGAGCTGCCTCT GGG Intronic
No off target data available for this crispr