ID: 1019634864

View in Genome Browser
Species Human (GRCh38)
Location 7:2070129-2070151
Sequence CCCTGAGGCCCGCTACTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019634864_1019634873 23 Left 1019634864 7:2070129-2070151 CCTGGCAGTAGCGGGCCTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1019634873 7:2070175-2070197 CTGTCCTTCAGGAGCTGACTTGG No data
1019634864_1019634874 24 Left 1019634864 7:2070129-2070151 CCTGGCAGTAGCGGGCCTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1019634874 7:2070176-2070198 TGTCCTTCAGGAGCTGACTTGGG 0: 1
1: 0
2: 0
3: 24
4: 339
1019634864_1019634870 12 Left 1019634864 7:2070129-2070151 CCTGGCAGTAGCGGGCCTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1019634870 7:2070164-2070186 CCCCTCTCTCTCTGTCCTTCAGG 0: 1
1: 1
2: 9
3: 89
4: 780
1019634864_1019634876 29 Left 1019634864 7:2070129-2070151 CCTGGCAGTAGCGGGCCTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1019634876 7:2070181-2070203 TTCAGGAGCTGACTTGGGACCGG 0: 1
1: 0
2: 0
3: 19
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019634864 Original CRISPR CCCTGAGGCCCGCTACTGCC AGG (reversed) Intronic
900205576 1:1430782-1430804 CCCTGAGGCCCCGCACCGCCAGG + Intergenic
900637596 1:3673644-3673666 CCCTGAAGCCCAGCACTGCCGGG - Intronic
901145350 1:7061239-7061261 CACTGAGACCCGGTCCTGCCCGG + Intronic
901237557 1:7675630-7675652 ACCTGAGACCCGCTCCTGCTGGG - Intronic
901671408 1:10858291-10858313 ACCTGAGGCCCACCACCGCCTGG - Intergenic
901762537 1:11480013-11480035 CCCTCAGCGCCGCCACTGCCCGG - Intronic
901934285 1:12617113-12617135 CCCTGCGGCCCCCCACTCCCTGG + Intronic
902645601 1:17795951-17795973 CCCTGATGCCCCTTTCTGCCAGG + Intronic
903759386 1:25687211-25687233 GCATGGGGCCTGCTACTGCCTGG + Intronic
904319891 1:29689822-29689844 CCCTCAAGCCCGCTCCTCCCTGG - Intergenic
905668243 1:39775253-39775275 CCCTGAGCCCCGCAGCTGGCTGG + Intronic
905800442 1:40839112-40839134 GCCTGAGACCAGCTACTGCTGGG - Exonic
906094814 1:43215485-43215507 CACTGGGGCCCTCTACAGCCTGG + Intronic
906477587 1:46180424-46180446 CCCTGCTGCCCCCTGCTGCCTGG - Intronic
908227258 1:62068396-62068418 ACCAGAGGCCTGCTGCTGCCAGG + Intronic
910123939 1:83819800-83819822 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
912797753 1:112703133-112703155 CCCTCAGGCCAGCTACTCACTGG - Intronic
917002479 1:170374997-170375019 CCCTGAGGCAGGCTTCTACCTGG + Intergenic
919055973 1:192569996-192570018 CCCTGAAGCAGGCTTCTGCCTGG + Intergenic
919608424 1:199715276-199715298 CACTGAGGCCCACTACTGGGGGG + Intergenic
919805997 1:201381392-201381414 CACTGAGGCCCGCTCTGGCCAGG - Exonic
919922031 1:202171713-202171735 GCCTGGGGCCCGCTACTGTGTGG + Intergenic
920293797 1:204943457-204943479 ACCTGAAGCCCGCTTCTTCCTGG + Intronic
922795629 1:228338157-228338179 CCCTGAGGACCCCTCCTGCCTGG - Intronic
923092408 1:230750543-230750565 CCCTATGGCCCGCTACCCCCCGG - Intronic
1062906439 10:1182842-1182864 GCCTGAGGCTCACTCCTGCCTGG + Exonic
1070660912 10:78304625-78304647 CCCTGAAGCTGGCTCCTGCCTGG + Intergenic
1072685473 10:97534019-97534041 CCCTGAAGCCTTCTACTGCCTGG + Intronic
1076715431 10:132361681-132361703 GCCTGGGGCCCGCCACAGCCTGG - Intronic
1076995890 11:297356-297378 CGCTGAGGCCAGCCATTGCCGGG - Intergenic
1078270250 11:9788347-9788369 TCCTCAGGCTGGCTACTGCCAGG + Intronic
1080237561 11:30089527-30089549 CCCTGAGGCCTGCTCCTTCTGGG + Intergenic
1083255974 11:61495740-61495762 CCCTAAGTCCAGCTTCTGCCAGG + Intergenic
1083319529 11:61837444-61837466 CCCTGAGCCCCGTGTCTGCCTGG + Intronic
1083322230 11:61854893-61854915 CTCTGAGGCCTGCTGCTGCCTGG + Intronic
1083495823 11:63052273-63052295 CCCTGCGGCAGGCTTCTGCCTGG - Intergenic
1083795981 11:65016979-65017001 CCCTGTGGCCCTCTAGTGCTGGG - Intronic
1083996664 11:66276396-66276418 CCCTGAGCCCCGGTTCTGTCAGG + Exonic
1085013774 11:73159336-73159358 CACTGAGGCCCAGTGCTGCCGGG + Intergenic
1085034841 11:73293576-73293598 CCTTGAGGCCGGCCCCTGCCAGG + Intronic
1088906884 11:114161942-114161964 CCCTGTGGCCCCATTCTGCCAGG + Intronic
1091146190 11:133282498-133282520 CCCTGTGGCAAGCTTCTGCCTGG - Intronic
1101033823 12:100685535-100685557 CCCTGTGGCACACTTCTGCCTGG + Intergenic
1101671708 12:106881498-106881520 CCCTGAGTCCACCTACTGCAAGG + Intronic
1101772662 12:107765951-107765973 CCCTGAGGCAGGACACTGCCTGG + Intergenic
1102518662 12:113465924-113465946 GCCTGAGCCCTGCCACTGCCTGG + Intronic
1108855889 13:54791875-54791897 CCCTGAGGCAGGATTCTGCCTGG + Intergenic
1111442951 13:88304531-88304553 CCCTGAAGCAGGCTTCTGCCTGG - Intergenic
1114140244 14:19901432-19901454 CCCTGTGGCAAGCTTCTGCCTGG - Intergenic
1118930375 14:70234884-70234906 CCCTGGGCCCCTCCACTGCCTGG + Intergenic
1121140721 14:91539317-91539339 CCCTGAAGCAGGCTTCTGCCTGG + Intergenic
1121367926 14:93332322-93332344 GCCTGAGGACTGCTACTCCCAGG - Intronic
1122874237 14:104656174-104656196 CCCTGAGGCCCCATCCTGTCTGG - Intergenic
1122880255 14:104687682-104687704 CCCCCAGGGCCGCTCCTGCCTGG - Intergenic
1122922603 14:104886163-104886185 GCCTGAGGCCCGCCCCGGCCTGG - Intronic
1123117701 14:105902110-105902132 CCCTGCAGCCAGGTACTGCCGGG + Intergenic
1125605618 15:40938298-40938320 CCCTGAAGGCCACTACTGGCAGG - Exonic
1125766941 15:42142382-42142404 CCCTGTGGCCCTCTGCTCCCTGG - Intronic
1126073553 15:44886764-44886786 CCCTGTGGCAGGCTTCTGCCTGG + Intergenic
1126084709 15:45000861-45000883 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
1128787699 15:70410455-70410477 ACCTGGGGCCAGCTGCTGCCAGG + Intergenic
1129036110 15:72649122-72649144 CCCTGCAGCCCCCTACTGCAGGG - Intergenic
1129213777 15:74088105-74088127 CCCTGCAGCCCCCTACTGCAGGG + Intergenic
1129400234 15:75277258-75277280 CCCTGCAGCCCCCTACTGCAGGG - Intronic
1129730914 15:77932438-77932460 CCCTGCAGCCCCCTACTGCAGGG + Intergenic
1130016329 15:80189408-80189430 CTCAGGGGCACGCTACTGCCCGG + Intergenic
1131470056 15:92688992-92689014 CCCTGAGGCAGGCTTCTGCCTGG - Intronic
1131832658 15:96363586-96363608 CCCTGTTGCCCGCGACTGCTGGG - Intergenic
1132587651 16:712971-712993 CCTTGACACCCGCTACAGCCTGG - Intronic
1136083431 16:27867815-27867837 CCCTGAGGCCAGCCACTTCCTGG + Intronic
1136269297 16:29139097-29139119 CACTGAGGCAGGCTACTGCCAGG - Intergenic
1139974833 16:70801112-70801134 TCGTGAGTCCCGCTAGTGCCGGG - Exonic
1140457119 16:75112005-75112027 CCCCGAGGCCTCCCACTGCCGGG - Exonic
1142072778 16:88100369-88100391 CACTGAGGCAGGCTACTGCCAGG - Intronic
1142351487 16:89582798-89582820 CCCTCACACCTGCTACTGCCTGG - Intronic
1145810189 17:27759744-27759766 CCCTGGGACACGCGACTGCCCGG - Intronic
1148907290 17:50919497-50919519 CCCTGAGCCCCGTGACTGCTGGG - Intergenic
1149057927 17:52387712-52387734 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150325019 17:64250078-64250100 TCCTGAGGGCAGCTCCTGCCAGG + Intronic
1150969433 17:70010770-70010792 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
1151551070 17:74822837-74822859 TCCTGAGCCACGCTGCTGCCCGG - Intronic
1151975798 17:77482967-77482989 CCCTGAGCCTCGCTTCTGCCTGG - Intronic
1152210777 17:79001908-79001930 TCCTGAGGGCCGGCACTGCCAGG - Intronic
1154441444 18:14393182-14393204 CCCTGTGACCCGCTCCTGGCCGG + Intergenic
1157452197 18:47797180-47797202 CCCTGTGGCCTGCTTCTGGCTGG + Intergenic
1160143621 18:76347422-76347444 CCCTGAGGCTCGCACCTGCCCGG + Intergenic
1160521793 18:79512101-79512123 CCCTGAGGCCGGCTCCTCCTGGG - Intronic
1160947518 19:1650668-1650690 CTCTGAGGCCCCCTACCCCCGGG + Intronic
1160948707 19:1655534-1655556 CCCTGGGGCTCGCGCCTGCCAGG + Intergenic
1161153715 19:2721749-2721771 CCCTGAGGCCGGCTGGGGCCCGG + Intronic
1161640331 19:5418739-5418761 CCCTGAGGCTGGCTCTTGCCTGG + Intergenic
1162159405 19:8700199-8700221 CACTGAGCCCCTCTCCTGCCAGG - Intergenic
1163552350 19:17972621-17972643 TCCTGAGGCTCCCTCCTGCCTGG - Intronic
1167146279 19:47682107-47682129 CCCTCAGGCCCCCGACAGCCAGG + Exonic
1167315047 19:48757941-48757963 CCCTGAGGCCTGCAGCTTCCGGG + Exonic
1168345633 19:55649005-55649027 CCCTGAGGCCCTCGGCTGCTGGG + Exonic
928211704 2:29328526-29328548 CCATCAGGCCAGCTGCTGCCTGG - Intronic
932469730 2:71945907-71945929 CTCTGTGGCCCTCTCCTGCCAGG - Intergenic
933783043 2:85814979-85815001 CCCTGAGGCCCCCTACAGCTTGG + Intergenic
934035630 2:88086550-88086572 CCCAGAGCCCCGCTCCGGCCAGG + Intronic
936721121 2:115253957-115253979 CCCTGAAGCAGGCTTCTGCCTGG + Intronic
937616079 2:123923405-123923427 CCCTGTGGCAGGCTTCTGCCTGG + Intergenic
938077435 2:128347143-128347165 CCACCAGGCCCGCTCCTGCCTGG - Intergenic
943437671 2:187886224-187886246 CCCTGAGGCAAGCTTCTACCTGG + Intergenic
943603010 2:189943456-189943478 CCCTGAAGCAGGCTTCTGCCGGG - Intronic
946199608 2:218064232-218064254 CCCTGGGGCCCTCTGCTTCCAGG - Intronic
946250339 2:218407493-218407515 CTCTGAGCCTCGCTACTGCAGGG - Intergenic
947164270 2:227245960-227245982 CCGTAAGGCCCGGTATTGCCTGG - Exonic
947183342 2:227432152-227432174 CCATGAGGCAGGCTTCTGCCTGG + Intergenic
948209889 2:236185169-236185191 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
948463003 2:238139225-238139247 CCCTTGGGCCAGCTGCTGCCGGG - Intronic
948806605 2:240455903-240455925 CCCTGAGGCCCGCTGCAGGCTGG - Intronic
949021631 2:241744081-241744103 CCCAGAAGCCCACCACTGCCGGG - Intronic
1170986680 20:21265634-21265656 CTCTGAGGCCACCTGCTGCCTGG + Intergenic
1174906401 20:54556770-54556792 CCCTGAGGCTCTGTACTGTCTGG + Intronic
1175139363 20:56848553-56848575 CCCTGAGAGCTGCTTCTGCCTGG - Intergenic
1175495387 20:59410837-59410859 GCCCGAGGCCAGCTACAGCCTGG - Intergenic
1175602976 20:60289824-60289846 CCCTGAAGCAGGCTTCTGCCTGG + Intergenic
1175804570 20:61820385-61820407 CCCGGAGGCCCGCAGCTGCGTGG - Intronic
1175996770 20:62815460-62815482 CCCTAAGGCCCCCTGCTGTCTGG + Intergenic
1179809370 21:43860702-43860724 CGCTGAGTCGCGCGACTGCCAGG - Intergenic
1180056883 21:45363569-45363591 CACTGAGGCCTGGGACTGCCGGG - Intergenic
1182967521 22:34535921-34535943 CCCTGTGGCAGGCTTCTGCCTGG + Intergenic
1183283133 22:36943675-36943697 CCCTGAGCCCAGCTACTGCCAGG + Intergenic
1183314680 22:37130326-37130348 GCCTGTGGCCAGCTACTTCCTGG + Intronic
1183630614 22:39030291-39030313 CCCTGCGGCCCCCTCCTCCCAGG + Intronic
1183634069 22:39050383-39050405 CCCTGCGGCCCCCTCCTCCCAGG + Intronic
1183738747 22:39658323-39658345 CCCCGAGGCACTCTGCTGCCGGG - Intronic
1183828316 22:40405251-40405273 CCCAGAGATCGGCTACTGCCAGG + Exonic
1184759737 22:46537587-46537609 CCCGGCGGCCGGCTGCTGCCTGG + Intergenic
950178785 3:10896209-10896231 CTCTGAGGCCAGCTCCTCCCAGG + Intronic
950864099 3:16175307-16175329 CCCTGAAGCCAGGTACCGCCTGG + Exonic
952190593 3:31018991-31019013 CCCTGAGGCCAAATTCTGCCTGG - Intergenic
952596788 3:35028013-35028035 CCCTGAGGCAAACTTCTGCCTGG + Intergenic
962840148 3:139225680-139225702 CCCTGAGGCCCTCTCCAGGCAGG - Intronic
963803334 3:149698635-149698657 CCCTGTGGCAGGCTTCTGCCTGG + Intronic
964638717 3:158885776-158885798 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
964786149 3:160399006-160399028 CCCGGAGCCCCGCTGCCGCCAGG + Intronic
965349643 3:167597381-167597403 CCCTGCAGCCCACTTCTGCCTGG - Intronic
965559734 3:170049790-170049812 CCCTGAGGAAGGCTGCTGCCTGG - Intronic
965760365 3:172068983-172069005 CCCTGAAGACCACAACTGCCTGG - Intronic
965990421 3:174811112-174811134 CCCTGAAGCCAGTTTCTGCCTGG - Intronic
967208449 3:187145352-187145374 CCCTGAAGCAGGCTTCTGCCTGG + Intronic
967840215 3:193999076-193999098 CCCAGGGGCCTGCTCCTGCCGGG - Intergenic
973542271 4:51946474-51946496 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
974651132 4:64755335-64755357 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
974733277 4:65897380-65897402 CCCTGAAGCAAGCTTCTGCCTGG + Intergenic
981131383 4:141161907-141161929 CCCTGAAGCAGGCTTCTGCCTGG - Intronic
985570342 5:641307-641329 CCCGGAGGGCGGCTTCTGCCTGG - Intronic
995106213 5:108380944-108380966 CCCCGACGCCGGCTGCTGCCAGG - Exonic
997892179 5:137686886-137686908 CCCTGAGGGGCGCCTCTGCCCGG + Intronic
997953094 5:138257676-138257698 GCCTGTGGCCCCCAACTGCCTGG - Exonic
998380914 5:141724730-141724752 CCCTGAAGCAAGCTTCTGCCTGG + Intergenic
1002009321 5:176264345-176264367 CCCTGTGGCAGGCTTCTGCCTGG + Intronic
1005914669 6:30341971-30341993 CCCTGAGACTGGCTACTGGCGGG + Exonic
1006447135 6:34085968-34085990 CCCTGAGGCGAGCTGGTGCCTGG + Intronic
1007791816 6:44313398-44313420 CCCTGAGTCCTCCTACCGCCAGG - Intronic
1007848574 6:44781607-44781629 CACCGAGGCCCCCTACTTCCAGG + Intergenic
1008189606 6:48438785-48438807 CCCTGTGTCAGGCTACTGCCTGG - Intergenic
1013850244 6:114505028-114505050 CCCTGTGGCGAGTTACTGCCGGG + Intergenic
1015351564 6:132225666-132225688 CCCTAAGGCACACTTCTGCCTGG - Intergenic
1016580417 6:145623449-145623471 CCCTGAGGCCAGAGCCTGCCTGG + Intronic
1017002725 6:150006992-150007014 CCCTGAAGTCAGCAACTGCCAGG + Intergenic
1017012325 6:150070982-150071004 CCCTGAAGTCAGCAACTGCCAGG + Intergenic
1018996128 6:168711911-168711933 CCCTGAGGCCGGCGCTTGCCTGG + Intergenic
1019634864 7:2070129-2070151 CCCTGAGGCCCGCTACTGCCAGG - Intronic
1022668530 7:32433146-32433168 CCCAGAGTCCAGCTCCTGCCTGG + Intergenic
1024403376 7:48950087-48950109 CCCTGTGGCAAGCTTCTGCCTGG + Intergenic
1028604836 7:92644454-92644476 TTCTGAGGCCCTCTACTCCCTGG + Intronic
1043384224 8:79732217-79732239 CCCTGCGGCAGGCTTCTGCCTGG + Intergenic
1046056785 8:109087710-109087732 CCATGAGATCAGCTACTGCCAGG - Exonic
1048130741 8:131694102-131694124 CCCTGAAGCAGGCTTCTGCCTGG + Intergenic
1054764970 9:69035800-69035822 CCAGGAGGCCGGCTACTGCGCGG - Exonic
1054927348 9:70601936-70601958 AACTGAGGCCCGCTCCTGCTGGG - Intronic
1056695459 9:88846566-88846588 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
1059334359 9:113559441-113559463 CCCAGAGGCCTGCTGCTGGCTGG - Intronic
1060444372 9:123674150-123674172 CCCTGAGGCAGGCTGCTCCCTGG + Intronic
1060817648 9:126643702-126643724 CCCTGTGGCCCTGTACTGACAGG - Intronic
1061202422 9:129145622-129145644 TCCTGAGGCCACCTACTGCCAGG - Intronic
1062156499 9:135051778-135051800 CCCTGAGGCCGGCTGCTGAGAGG + Intergenic
1062579427 9:137222808-137222830 CCCTGAGGACCGCACCTGCCCGG + Intergenic
1189656627 X:43251340-43251362 CCCTGTGGCAGGCTTCTGCCTGG + Intergenic
1190058158 X:47194088-47194110 CCCTGAGCCACGCTGCTGTCGGG + Intronic
1190794106 X:53725320-53725342 CCCTGTGGCAGGCTTCTGCCTGG - Intergenic
1192126459 X:68505020-68505042 CCCTGTTGCCTGCTACTGCTAGG - Intronic
1193772637 X:85605717-85605739 CCCTGAGACAGGCTTCTGCCTGG + Intergenic
1197689658 X:129484951-129484973 CCCTGTGGCAGGCTTCTGCCTGG - Intronic
1200281106 X:154777863-154777885 CCCTGCCCCCCGCTCCTGCCAGG - Intergenic
1200459730 Y:3440649-3440671 CCCTGAAGCCGACTTCTGCCTGG + Intergenic
1200687849 Y:6273275-6273297 TCCTGAGGCTTGCTACTACCTGG - Intergenic
1200831824 Y:7693003-7693025 CCCTGAGGCTTGCTACCACCTGG + Intergenic
1200909100 Y:8515258-8515280 CCTTGAGGCCTGCTACCACCTGG - Intergenic
1200986245 Y:9305352-9305374 CCTTGAGGCCTGCTACTACCTGG + Intergenic
1201018403 Y:9626675-9626697 CCCTGAGGCCGGCTACCACTTGG + Intergenic
1201047420 Y:9901427-9901449 TCCTGAGGCTTGCTACTACCTGG + Intergenic
1201060365 Y:10038685-10038707 CCCTGAGGCCACCTACCACCTGG + Intergenic
1202124334 Y:21555550-21555572 CCTTGAGGCCTGCTACTACCTGG - Intergenic
1202154674 Y:21873830-21873852 CCTTGAGGCCTGCTACTACCTGG + Intergenic
1202232371 Y:22670312-22670334 CCTTGAGGCCTGCTACCACCTGG - Intergenic
1202310785 Y:23525846-23525868 CCTTGAGGCCTGCTACCACCTGG + Intergenic
1202560017 Y:26144748-26144770 CCTTGAGGCCTGCTACCACCTGG - Intergenic