ID: 1019637410

View in Genome Browser
Species Human (GRCh38)
Location 7:2083456-2083478
Sequence CACAGCACGGAGAGGAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019637410 Original CRISPR CACAGCACGGAGAGGAGGTG CGG Intronic
900198020 1:1387229-1387251 CACAGCAGGCATCGGAGGTGAGG - Exonic
900334956 1:2158114-2158136 CACCGCACGTAGAGCAGGTCGGG - Intronic
900626156 1:3609600-3609622 CAGAGAAGGGAGAGGAGGGGAGG + Intronic
900677199 1:3895086-3895108 CACAGCAGGGAGGAGAGGTGGGG - Intronic
901337602 1:8464595-8464617 CACAGCAAGGAGGGGAGTGGTGG - Intronic
902348652 1:15837114-15837136 CACTGAACGAAGAGGAAGTGCGG - Intergenic
903010248 1:20324707-20324729 CTCAGCAAGGAGAGGAGGGTTGG + Intronic
903668528 1:25022312-25022334 CACAGCAGGGGGTGGGGGTGGGG - Intergenic
904696446 1:32334437-32334459 CACAGGAGGGAGAGGAGGAAAGG + Exonic
905039874 1:34947416-34947438 CACAGGAGGGAAAGGAGGTATGG + Intergenic
905307433 1:37029363-37029385 GGCAGCACGGAGAGGAACTGGGG - Intronic
905892452 1:41525933-41525955 CACGGCACGTGGAGGAGGCGTGG + Intronic
906263827 1:44413086-44413108 GACAGCAAAGAGAGGAGGGGTGG - Intronic
907427348 1:54388790-54388812 CACAGCCAGGAGAGCAGGGGTGG + Intronic
907556239 1:55346383-55346405 CACACCAAGGAGTGGAGCTGGGG + Intergenic
908132200 1:61083872-61083894 CACGGAAAGGAGAGGCGGTGGGG - Intronic
908515983 1:64893240-64893262 GACAGCAAGGAAAGGAGGGGAGG + Intronic
908590413 1:65626203-65626225 CACCTCAGGGAGAGCAGGTGCGG - Intronic
908871955 1:68623591-68623613 AACAGAATGGAGAGAAGGTGGGG - Intergenic
909742878 1:79054562-79054584 CACAGCATAGAGGGTAGGTGGGG - Intergenic
910455670 1:87395061-87395083 CACAGGCTGGAGAGGTGGTGGGG - Intergenic
912835019 1:112988455-112988477 CATAGCACTGAGTGAAGGTGAGG + Intergenic
913288113 1:117246112-117246134 CACAGCTGGGAAAGGAGGAGAGG - Intergenic
914845414 1:151281350-151281372 CCCAGCATGGAGTGGGGGTGGGG - Intronic
915477930 1:156164387-156164409 CACACCACTGGGTGGAGGTGGGG - Intronic
916213163 1:162374576-162374598 CCCAGCACGGAGAGAAGCTGAGG - Exonic
916727014 1:167532672-167532694 TACATCACAGAGAGGAGGAGAGG + Intronic
917571074 1:176266046-176266068 CACAGCAAGGAGAGGGCCTGAGG - Intergenic
919736778 1:200957572-200957594 TACAGCACAGACAGGAGTTGGGG + Intergenic
920100591 1:203514724-203514746 TACAGCAGGGCAAGGAGGTGGGG + Intergenic
920260615 1:204685542-204685564 CAGGGCGCGGAGAGGGGGTGGGG - Intronic
920337753 1:205256659-205256681 GGCAGCAGGGAGAGGAGGAGAGG + Intronic
920342578 1:205284733-205284755 CACAGCTCTGAGAGCAGCTGGGG - Intergenic
920419333 1:205820470-205820492 CTAAGCAGGGAGAGGAGGGGAGG - Intergenic
920641722 1:207758583-207758605 AACAGCATTGAGAGGTGGTGGGG - Intronic
920956056 1:210621060-210621082 CACAGCAGGAGGAGGAGCTGAGG - Intronic
921367430 1:214386929-214386951 CAGAGAACACAGAGGAGGTGGGG + Intronic
921464727 1:215473802-215473824 CAAAGCACAGAGAGAAAGTGAGG + Intergenic
921478445 1:215636632-215636654 CACAGCACGCAGGGGAAGGGAGG + Intronic
922704567 1:227782364-227782386 CCCAGCACTGACAGGAGGGGGGG - Intergenic
922784713 1:228277155-228277177 CACAGGACGGTGTGGAGCTGCGG + Exonic
923326098 1:232881431-232881453 ATCATCACGGAGAGGAGGGGTGG - Intergenic
923650341 1:235867202-235867224 CAGAGCCCTGGGAGGAGGTGCGG - Intronic
923828322 1:237525115-237525137 CAAAGCAAGGAGAGCAGGAGGGG - Intronic
924159216 1:241212851-241212873 CACAGCAGTGGGAGGAGGTGTGG - Intronic
1063663249 10:8048023-8048045 CACAGCACGGATAGGAAAAGAGG - Intergenic
1064035104 10:11908428-11908450 CCCAGCAGGGACAGGAGCTGGGG - Intergenic
1064499116 10:15949613-15949635 GAAAGCAAAGAGAGGAGGTGAGG - Intergenic
1065896229 10:30165197-30165219 TACAGCTCTGAGAGAAGGTGTGG + Intergenic
1066611312 10:37250990-37251012 TACAGCATAGAGAGGAGATGGGG + Intronic
1067295336 10:44972341-44972363 CACAGCAGGCAGCGCAGGTGTGG + Intronic
1071288788 10:84173197-84173219 CACAGCTCTTAAAGGAGGTGGGG - Intergenic
1073142200 10:101255525-101255547 CACAGGAAGGAGAAGAGGTTAGG - Intergenic
1073466364 10:103696658-103696680 CACAGGAAGAAGAGGAGGGGAGG + Intronic
1073559008 10:104481285-104481307 CACATGACACAGAGGAGGTGGGG - Intergenic
1074434827 10:113425098-113425120 CACAGCGGGGAGGTGAGGTGTGG + Intergenic
1074831901 10:117255256-117255278 CACTGCAGGGAGAGAAAGTGGGG - Exonic
1075106326 10:119542443-119542465 CCCAGCGGGGAGAGGTGGTGCGG + Intronic
1075567602 10:123515886-123515908 CACAGCACAGAAGGGAGCTGGGG - Intergenic
1075619948 10:123919054-123919076 CACAGCTCAGAGAGGAGCTGTGG - Intronic
1076096095 10:127736245-127736267 CACAGCGCGGGGAGCAGGGGAGG + Intergenic
1076312329 10:129517377-129517399 CACAGAACAGAGGTGAGGTGGGG - Intronic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076600621 10:131654803-131654825 CACTGCAAGGCCAGGAGGTGAGG - Intergenic
1076605234 10:131685149-131685171 CACAGCACAGGCAGGAGGTAGGG + Intergenic
1076841632 10:133048819-133048841 AACAGCAGGCAGAGGAGGGGAGG + Intergenic
1076930423 10:133528428-133528450 CGCCGCGCGGCGAGGAGGTGCGG - Intronic
1077218356 11:1404490-1404512 CCCAGCACCCAGAGGAGGTTGGG + Intronic
1079082605 11:17424449-17424471 CACAGCTTGGAGAAGAGGTGGGG + Intronic
1080701839 11:34650576-34650598 CCCAGCAAGGAGGGGAGCTGAGG + Intronic
1081592880 11:44437238-44437260 CTGAGCACACAGAGGAGGTGGGG - Intergenic
1081916947 11:46738285-46738307 CACAGCACCTAGTGAAGGTGTGG + Intronic
1082828743 11:57599793-57599815 CAAAGCAGGAAGAGAAGGTGTGG - Intronic
1083235188 11:61346526-61346548 CACAGCAGTGAGAGGAGCTGAGG - Exonic
1083254934 11:61490109-61490131 CACTGGAAGGAGAGGAGGGGAGG - Intronic
1083305963 11:61762187-61762209 CTGACCACGGAGAGGAGGGGAGG + Intronic
1083843564 11:65317994-65318016 CACAGCAGGGATGGGGGGTGGGG - Intronic
1084165707 11:67373832-67373854 CACAGCACCGAGGGGGGGTGAGG + Intronic
1084433193 11:69122858-69122880 CACAGCAGGGCGGGCAGGTGGGG - Intergenic
1084760336 11:71266687-71266709 TCCAGCACAGAAAGGAGGTGCGG + Intergenic
1086484758 11:87286608-87286630 CACACCACGGGGTGGGGGTGGGG + Intronic
1088028142 11:105211943-105211965 AAGATCATGGAGAGGAGGTGAGG - Intergenic
1088764736 11:112963513-112963535 CAGGGCCCGGAGAGGAGGGGTGG + Intronic
1090405735 11:126474943-126474965 CACAGAAGGGACAGGAGGTGAGG + Intronic
1091116779 11:133020485-133020507 CTCAGCACTGAGAGGAGCAGAGG + Intronic
1091234125 11:134008381-134008403 CAGAGCAGGGAGAGGAGAGGTGG - Intergenic
1091436288 12:475555-475577 CACAGGGCGAAGAGGAGGCGCGG - Intronic
1091755050 12:3045847-3045869 AACAGCAGGGAGAGGTGGTCAGG + Intergenic
1092195660 12:6548342-6548364 CAGAGCAAGGAGAGGAGCGGGGG + Intronic
1092747988 12:11691376-11691398 AAAAGAAGGGAGAGGAGGTGTGG - Intronic
1098340355 12:69444694-69444716 CGCAGCAGGGAGAGAAGGAGAGG - Intergenic
1100217424 12:92466708-92466730 CACAGCACAGAGAGGAAGCAAGG + Intergenic
1101291759 12:103377589-103377611 CCCAGCTCGGGGATGAGGTGGGG - Intronic
1101353768 12:103957267-103957289 CACGTGACGCAGAGGAGGTGGGG + Intronic
1102025028 12:109709623-109709645 CACAGCAATGAGGGCAGGTGAGG + Intergenic
1102904450 12:116663332-116663354 CAGAGCAGGGAGAGGTGGGGAGG - Intergenic
1103416509 12:120745275-120745297 GGCAGCCAGGAGAGGAGGTGAGG - Intergenic
1103527848 12:121579512-121579534 CAGTGCAAGAAGAGGAGGTGGGG + Intronic
1103837004 12:123829623-123829645 CACAGCACGGACAGGAAGGAGGG - Intronic
1104471478 12:129033261-129033283 CACCACCCGGAGGGGAGGTGTGG - Intergenic
1104783764 12:131437101-131437123 GACAGCAGGGGGAGCAGGTGAGG - Intergenic
1104912883 12:132248115-132248137 CACAGGAGGGAGGGGTGGTGGGG - Intronic
1106013109 13:25843831-25843853 TACAGCATAGAGAGGAGGTAGGG + Intronic
1109220222 13:59633981-59634003 TACTGGAGGGAGAGGAGGTGAGG + Intergenic
1112903709 13:104391349-104391371 CATAGCACTGAGAGAAGGTGAGG + Intergenic
1114265700 14:21071401-21071423 CACCGCAGGGAGTGGAGGAGGGG + Intronic
1116336017 14:43657491-43657513 AAATGGACGGAGAGGAGGTGAGG + Intergenic
1117984681 14:61375547-61375569 AACAGCATGGCTAGGAGGTGAGG + Intronic
1118292604 14:64540329-64540351 CGCGGCACGGGGAGGAGGCGTGG - Intronic
1121820262 14:96960023-96960045 CACAGCGCAGAGGGGAGGGGTGG + Intergenic
1122127110 14:99585339-99585361 GAGAGCACAGAGAGGTGGTGTGG + Intronic
1122629203 14:103099610-103099632 CAGAGCCCGCCGAGGAGGTGTGG - Intergenic
1122883879 14:104702024-104702046 CACAGGACGGGGAGGAAGGGTGG - Intronic
1124664909 15:31583991-31584013 CAGAGCACAGAGATGAGATGAGG + Intronic
1124807356 15:32899185-32899207 CACAGCCAAGACAGGAGGTGCGG + Intronic
1127769732 15:62221549-62221571 CACTTCAGGGAGAGGAGGGGTGG + Intergenic
1127770574 15:62226934-62226956 CACAGCAGGGGAAGGAGGAGAGG - Intergenic
1128030263 15:64473811-64473833 CACTGCACTGAGACGGGGTGTGG - Intronic
1129953601 15:79613337-79613359 CACAGCACAGACAGGAGGTGAGG - Intergenic
1130297523 15:82657637-82657659 CACAGCACTGAGAGAGGGTGAGG - Intergenic
1130868540 15:87952495-87952517 CGGGGCAGGGAGAGGAGGTGGGG - Intronic
1131525282 15:93147698-93147720 CAGAGGAGGGCGAGGAGGTGCGG - Intergenic
1132040939 15:98524168-98524190 CACAACAACGAGAGGAGCTGGGG + Intergenic
1132281343 15:100618594-100618616 CACAGCAGGGTGAGAAGGTGAGG - Intronic
1132779581 16:1615012-1615034 CACACCCCGGAGAGGGGCTGGGG - Intronic
1132884438 16:2176421-2176443 CACAGGATGGAGCGGGGGTGGGG + Intronic
1133056967 16:3150212-3150234 CCCAGCGCGGGGTGGAGGTGGGG - Intergenic
1133058326 16:3158552-3158574 CCCAGCACCGAGAGGAGGGCCGG - Intergenic
1133383514 16:5350408-5350430 CACAGCAGGAATGGGAGGTGAGG + Intergenic
1133904616 16:10010686-10010708 CTCAGCTCAGAGAGGAGGAGAGG + Intronic
1135133984 16:19874310-19874332 CTCAGCACTGGGAGGAGGAGTGG - Intronic
1136030500 16:27499355-27499377 CCCAGCAGGGAGAGGTGGAGTGG + Intronic
1136191417 16:28617344-28617366 CTCAGCACAGCGAGGAGGTGTGG - Intronic
1136245745 16:28974933-28974955 CACAGCGCGGAGGGGACGTGCGG - Exonic
1136454220 16:30371230-30371252 GACAGCACGGAGAAGGGGCGGGG + Intronic
1136624481 16:31453656-31453678 CATAGCACGGAGTGGAGATGGGG + Intergenic
1137247495 16:46717597-46717619 CACTGCCTGGAGGGGAGGTGGGG - Intronic
1137686638 16:50391248-50391270 TGCAGCAGGGAGAGGAGGTGGGG + Intergenic
1137946041 16:52734188-52734210 CACAGCCAGGAAAGGAGGAGAGG - Intergenic
1138419531 16:56890253-56890275 CACTGGAAAGAGAGGAGGTGAGG - Exonic
1138818081 16:60225789-60225811 CACAGCACTGAGATGAACTGAGG + Intergenic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139391645 16:66609369-66609391 CACAGCATGGGGAGGAGGCCTGG - Intronic
1139578549 16:67857853-67857875 CACAGCTTGGACAGAAGGTGTGG + Intronic
1140255764 16:73334734-73334756 CACAGGACTGAGAGGAGGAGGGG - Intergenic
1140304775 16:73792859-73792881 CACAGCAGAGAGGGGAGGGGGGG - Intergenic
1140453469 16:75090223-75090245 CACAGCTCGATGGGGAGGTGAGG - Intronic
1141103012 16:81211633-81211655 CAGATCACGGGGTGGAGGTGGGG - Intergenic
1141748938 16:85945518-85945540 CAGAGCACGGAGAGCACCTGGGG + Intergenic
1142108388 16:88318360-88318382 CAGAGCATGGAGAGGAGGAAGGG - Intergenic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1143394093 17:6578079-6578101 CACCTCACAGAGATGAGGTGAGG + Intergenic
1144329355 17:14210372-14210394 CAAAGCACAGCAAGGAGGTGGGG - Intergenic
1146887523 17:36482661-36482683 CACAGCACGTAGGGGAGATTAGG + Intergenic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147329418 17:39688167-39688189 CACAGCAGGGGGACGAGGGGCGG - Intronic
1147333417 17:39712308-39712330 CATAGCACACTGAGGAGGTGGGG - Exonic
1147625334 17:41896430-41896452 CTGAGCACGGATAGGAGGGGAGG + Intronic
1150299979 17:64039803-64039825 CACAGTACACAGGGGAGGTGGGG + Exonic
1150737751 17:67754780-67754802 CACAAGAAGGAGAGGAGGTAGGG - Intergenic
1151246893 17:72802204-72802226 CACAGCCCAGGAAGGAGGTGAGG + Intronic
1151394488 17:73813201-73813223 CACAGAATGGACAGGAGGGGTGG + Intergenic
1151756186 17:76076495-76076517 CACCGCACACAGAGGAGGTGGGG - Intronic
1152300771 17:79494343-79494365 CACAGCTCGGGGAGGAAGGGTGG - Intronic
1152662827 17:81550901-81550923 CACAGCACTGGAAGGAAGTGGGG + Exonic
1152723913 17:81935977-81935999 ATCAGCAGGGCGAGGAGGTGGGG + Intronic
1153807056 18:8717802-8717824 GACAGCAAAGAGTGGAGGTGTGG + Intronic
1154107196 18:11533438-11533460 CACTGCGTGGCGAGGAGGTGGGG + Intergenic
1154163179 18:11995035-11995057 CAGAGCTCGGAGGGGAGGGGAGG + Intronic
1154307081 18:13238581-13238603 CACAGAACTGAGGGGTGGTGTGG + Intronic
1154333428 18:13448172-13448194 CAAAGGCCGGAGAGGAGCTGGGG + Intronic
1157430311 18:47619377-47619399 GCCTGCAAGGAGAGGAGGTGGGG - Intergenic
1158890379 18:61866655-61866677 CACAGCAGGGAGAGGAGACATGG - Intronic
1158950591 18:62491203-62491225 CAAAGCACGGGGAGGAAGGGAGG + Intergenic
1159607022 18:70485425-70485447 CAGAGCACTGAGAGGGAGTGTGG - Intergenic
1159638061 18:70829932-70829954 CAGACCACGCAGAGGGGGTGGGG + Intergenic
1159986005 18:74841457-74841479 CAGAGCAGGGTGAGGAGGTTTGG - Intronic
1160659445 19:291419-291441 CCCCGCGCGGAGAGGAGGGGAGG + Intronic
1160810227 19:1010111-1010133 GTCAGCAAGGAGAGGGGGTGGGG - Exonic
1161320753 19:3639853-3639875 GGAGGCACGGAGAGGAGGTGAGG + Intronic
1163110346 19:15156819-15156841 CAGAGCACAGAGAAGAGTTGAGG + Intergenic
1164150745 19:22548356-22548378 CAGAGCTGGGAGAGTAGGTGAGG + Intergenic
1165025851 19:32960879-32960901 CACAGCACAGGGAGGAGGAATGG + Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165471712 19:36008161-36008183 CAGGGGACAGAGAGGAGGTGGGG + Intronic
1165498723 19:36170678-36170700 CACAGCACTTTGAGAAGGTGAGG - Intergenic
1165865559 19:38934998-38935020 CAAAGCAAGGGCAGGAGGTGGGG + Intronic
1166071760 19:40392295-40392317 GTCAGCACAGAGAGGAGGCGTGG + Intergenic
1166095696 19:40537652-40537674 CACAGCACAGAAAGGATCTGTGG + Intronic
1166273601 19:41734801-41734823 CACAGCACTGAGTGGTGGGGTGG + Intronic
1167079486 19:47269678-47269700 CAGAGCCCTGAAAGGAGGTGAGG + Intronic
1167295283 19:48645955-48645977 AAGAGAACGGAGAGGAGGTGTGG - Exonic
1168287841 19:55343200-55343222 CACAGTCTGGTGAGGAGGTGGGG + Intronic
1168582476 19:57566993-57567015 CACAGGAGGGAGAGGAATTGGGG + Intergenic
926539972 2:14163868-14163890 TAAAGCAGGGAGAGAAGGTGGGG - Intergenic
927571791 2:24166690-24166712 CAAAGCAGGTAGAGGGGGTGGGG + Intronic
928175914 2:29034240-29034262 CACAGCAGGGAGAGAGGATGTGG - Intronic
928613954 2:33017958-33017980 TAGAGCACGGAGATGAGGAGGGG - Intronic
928867307 2:35932481-35932503 CTCAGCACCGAGAGGCTGTGTGG - Intergenic
929421229 2:41791973-41791995 CACACCATGGAGGGGGGGTGTGG - Intergenic
929442399 2:41974213-41974235 CAGGGCAGGGAGAGGAGGAGAGG + Intergenic
930769819 2:55120070-55120092 CACGGCACTGAGAGGTGGGGTGG + Intergenic
931102254 2:59015408-59015430 CTCAGCAGAGAGAGGATGTGAGG + Intergenic
931639566 2:64369935-64369957 CACAGCACGGTGGGGCAGTGGGG - Intergenic
932413544 2:71560766-71560788 CGCTGCAGGGAGGGGAGGTGGGG + Intronic
932491960 2:72128040-72128062 CACAGTGCGGAGGAGAGGTGAGG + Intergenic
932858666 2:75266250-75266272 CACAACAGAAAGAGGAGGTGGGG - Intergenic
933999113 2:87692032-87692054 CATAGGAAAGAGAGGAGGTGGGG - Intergenic
934563300 2:95324070-95324092 CAGCCCACGGAGGGGAGGTGGGG - Intronic
935122166 2:100192518-100192540 CAAGTCACTGAGAGGAGGTGAGG - Intergenic
936041188 2:109150719-109150741 CAGAGCAGGAAGTGGAGGTGTGG + Intronic
936294729 2:111258859-111258881 CATAGGAAAGAGAGGAGGTGGGG + Intergenic
936403228 2:112181906-112181928 GACAGCACGGGGAGGACATGGGG + Intronic
936523879 2:113229839-113229861 CAGAGCAGGGACAGGTGGTGAGG + Intronic
938032569 2:128008121-128008143 CAAAGCAAGGATAGTAGGTGTGG - Intronic
938581009 2:132646382-132646404 CACAGCCCAGAGACTAGGTGAGG + Exonic
939479915 2:142734890-142734912 CGCAGCAAGGAGAGAAGTTGGGG + Intergenic
940006965 2:149016836-149016858 CACAGCAGAGAGGGGAGCTGAGG + Intronic
940970682 2:159893652-159893674 CACCCCAGGGAGAGGAAGTGTGG - Intronic
941698330 2:168577061-168577083 CACAGTTCAGGGAGGAGGTGTGG + Intronic
943575328 2:189625218-189625240 GGCAGCATGGAGAAGAGGTGGGG - Intergenic
944471381 2:200056364-200056386 CAGACCACTGAGAGGAAGTGTGG + Intergenic
944508746 2:200443572-200443594 CAAAGCAAGGAGAGGAGAAGAGG - Intronic
945019425 2:205556374-205556396 CACAGCACATGGAGTAGGTGAGG + Intronic
947803262 2:232945627-232945649 CACAGCTCTGAGAGGGAGTGTGG + Intronic
947999460 2:234555843-234555865 CAGAGCCCAGAGAGGAGATGAGG + Intergenic
948017348 2:234701519-234701541 CACAGCTGGCAGAGGAGGTGAGG + Intergenic
948580803 2:238986270-238986292 CACAGCAAGGAGGGGACGTGCGG + Intergenic
949065231 2:241986260-241986282 CAGTGCAAGGATAGGAGGTGTGG - Intergenic
1168896524 20:1327521-1327543 TGCAGCACTGAGAGGAGGAGTGG - Intronic
1169362977 20:4966969-4966991 CACAGAACTGAGAGGAGGGAAGG + Intronic
1170907654 20:20530406-20530428 CACAACACCTAGTGGAGGTGGGG - Intronic
1171444737 20:25195636-25195658 CGCAGGCGGGAGAGGAGGTGGGG - Intergenic
1171982428 20:31637628-31637650 AACAGCAAGGAGGGGAGGTGTGG + Intergenic
1172901798 20:38340557-38340579 CTCTGCAAGGAGAGAAGGTGGGG + Intergenic
1173795516 20:45856992-45857014 CGCAGCGCGGAGAGGAAGGGAGG + Intronic
1174058897 20:47818645-47818667 CACAGGCCTGACAGGAGGTGGGG + Intergenic
1174873673 20:54206176-54206198 CAGAGCACAGAGGGGAGGGGTGG - Intergenic
1175181809 20:57153821-57153843 CGCAGCACGAGGAGGAGATGTGG - Intergenic
1175295040 20:57902607-57902629 CACAGAAAGGAGAGAAGGTAGGG + Intergenic
1175600361 20:60267760-60267782 CACAGCACATGGAGGAGCTGTGG - Intergenic
1179022891 21:37656175-37656197 CTCAGCAGGGAGAAGGGGTGTGG - Intronic
1180072080 21:45441592-45441614 CAGATCACGGAGAGGAGCAGGGG - Intronic
1180146574 21:45923364-45923386 CACAGCTCTGACAGCAGGTGGGG - Intronic
1182336764 22:29588791-29588813 CTCTGCAGGGAGAGGAGGGGTGG - Intergenic
1183069299 22:35385151-35385173 CCCAGCATGCAGAGGTGGTGGGG + Intronic
1183704947 22:39470475-39470497 CATGGCACGCAGAGGAGTTGGGG + Intronic
1183714304 22:39524726-39524748 CACAGTGAGGGGAGGAGGTGAGG - Intergenic
1184351040 22:43944408-43944430 CCCAGCTTGGAGAGGAGCTGAGG - Intronic
1184635084 22:45821458-45821480 CCTAGCAGGGAGAGGAGGTTGGG - Intronic
1185053318 22:48565002-48565024 CAGAGCACAGACAGCAGGTGTGG - Intronic
1185259087 22:49851785-49851807 CAGAGCCCGGAGAGGGGATGAGG + Intergenic
949437397 3:4044233-4044255 CACAGCAAGGAAAGGAGGAAGGG - Intronic
950188872 3:10962492-10962514 CACAGAAGGGAGAGGAGAAGAGG + Intergenic
950195613 3:11007158-11007180 CACAGCACGCAGAGAAGGAGAGG - Intronic
950515638 3:13463259-13463281 AACAGCACAGAGAGGATGTCAGG + Intergenic
951355330 3:21660138-21660160 AAGAGCAAAGAGAGGAGGTGGGG - Intronic
951702297 3:25508713-25508735 CAGAGCAAGAAGAGAAGGTGGGG - Intronic
952194066 3:31054047-31054069 CACACCAAGGAGTGGAGGTGCGG + Intergenic
954438307 3:50507742-50507764 CACATTAGGGAGAGGAGGAGGGG + Intergenic
959472837 3:106773730-106773752 CAGGGCAAGCAGAGGAGGTGGGG + Intergenic
960089812 3:113627838-113627860 CACAGGAAGGAGAGGGGCTGCGG + Exonic
961556222 3:127698193-127698215 CACAGCCTGGACCGGAGGTGAGG + Intronic
963131228 3:141860050-141860072 CTGAGCCTGGAGAGGAGGTGGGG + Intergenic
963248630 3:143084912-143084934 CTCAGGACGGATAGGAAGTGGGG + Intergenic
963854204 3:150237520-150237542 CACCGCAAGGAGAGAAGGAGGGG + Intergenic
964051909 3:152404010-152404032 CAGAGCACGAAGAAAAGGTGAGG - Intronic
965276578 3:166691069-166691091 CACAGCATAGAGGGTAGGTGGGG - Intergenic
966247446 3:177824923-177824945 CAGAGTGAGGAGAGGAGGTGGGG + Intergenic
966897496 3:184456728-184456750 CCCTGCACGGAGTGGGGGTGAGG - Intronic
966924654 3:184636414-184636436 CTCAGCAAGGAGAGGAGCTGTGG + Intronic
967989519 3:195120813-195120835 AAGAGCACGGAGAGGGTGTGCGG + Intronic
968442231 4:629770-629792 CACAGACGGCAGAGGAGGTGTGG + Intronic
968574630 4:1359895-1359917 CACAGCAGGAAAAGGAGGTGGGG - Intronic
969075867 4:4577250-4577272 CCTAGCATGGGGAGGAGGTGGGG - Intergenic
970767024 4:19562213-19562235 CACAGGACCGAGAAGAGCTGAGG + Intergenic
971424332 4:26501377-26501399 CACAGAAAGGAGATGGGGTGAGG - Intergenic
972907066 4:43763437-43763459 GACAGCAGGCAGAGGAGCTGTGG - Intergenic
976703395 4:87995565-87995587 AGCAGCAGGAAGAGGAGGTGAGG + Intergenic
978832328 4:113102940-113102962 CACAGGGAGGAGGGGAGGTGAGG + Intronic
979303105 4:119110085-119110107 CACAGCAAGGAGAGGGAGTCTGG - Intergenic
981083336 4:140657158-140657180 CTGAGCAAGGAGTGGAGGTGAGG + Exonic
981778581 4:148398621-148398643 CACAGCACAGAAAGGTGCTGGGG + Intronic
983939465 4:173525143-173525165 TATAGCATGGGGAGGAGGTGTGG - Intronic
984126449 4:175816602-175816624 CAGAGAACAGAGAGGAGATGTGG + Intronic
986264548 5:6181024-6181046 CTCAGGATGGAGGGGAGGTGGGG - Intergenic
986341231 5:6791104-6791126 CAGAGCAGGGAGAGGAGATGGGG - Intergenic
993509504 5:88754155-88754177 AACAGCACAGAGAGCAGGAGGGG + Intronic
996774087 5:127116000-127116022 AACAGCCAGGAGAGGAGATGGGG - Intergenic
999694974 5:154180639-154180661 CAAAACACAGAGAGGTGGTGGGG - Intronic
1000684802 5:164235400-164235422 GGCAGCACGGAGAGGAAGGGTGG + Intergenic
1001494624 5:172179198-172179220 CACAGGGCTGAGAGGAGTTGAGG - Intronic
1001560934 5:172668553-172668575 CACACCACAGAGTGGAAGTGGGG - Intronic
1002400014 5:178986467-178986489 CCCAGCACGGCCAGGAGGAGCGG + Exonic
1002773491 6:308946-308968 CACAGAACCTGGAGGAGGTGGGG - Intronic
1002889941 6:1323817-1323839 CCCAGAATGGAGAGGAGCTGAGG - Intergenic
1003014912 6:2460542-2460564 CAGAGCAGGGAGAGGAGGCTGGG + Intergenic
1003365374 6:5469360-5469382 CACAGCAGGGATATGAAGTGTGG - Intronic
1005883200 6:30075387-30075409 CGCAGCAGGGACAGGCGGTGGGG + Exonic
1006743279 6:36324123-36324145 AACAGCAAGGAGAGGAGGTGAGG - Exonic
1007254049 6:40516269-40516291 AACAGAACGGAGGGGAGCTGGGG - Intronic
1007290546 6:40782905-40782927 ATCAGCAGGGAGAGGAGGGGAGG - Intergenic
1007390838 6:41548676-41548698 CGCAGCAGGGGGAGGGGGTGGGG - Intronic
1007671243 6:43555933-43555955 CACAACAAGGAGAGGTGATGAGG - Exonic
1007788325 6:44294830-44294852 CACAGAAAGGAGAGGAGGTGGGG + Intronic
1010037801 6:71346168-71346190 GCCAGCGGGGAGAGGAGGTGAGG - Intergenic
1011508688 6:88076513-88076535 CAGAGGAAGGAGTGGAGGTGGGG + Intergenic
1013372453 6:109482949-109482971 CCCAGCAGGGAGAGGTGGCGCGG + Intronic
1015168402 6:130224440-130224462 CAAAGCACAGATGGGAGGTGTGG + Intronic
1017927689 6:158924594-158924616 CAAAGCATGGCCAGGAGGTGTGG - Intergenic
1018223668 6:161606948-161606970 CACAGCATGGGGGGGAGATGAGG + Intronic
1019109799 6:169700827-169700849 CACAGCAGGGAGAGGAGGTAGGG - Intronic
1019258399 7:66032-66054 CACAGCAGGGAGAGAAACTGAGG - Intergenic
1019637410 7:2083456-2083478 CACAGCACGGAGAGGAGGTGCGG + Intronic
1021486484 7:21173889-21173911 TAAAGCACGGAGCAGAGGTGGGG - Intergenic
1021641779 7:22744574-22744596 CACAGCACTGTGTGGTGGTGTGG + Intergenic
1022425324 7:30263340-30263362 CAGAGCACAGATGGGAGGTGGGG - Intergenic
1024053589 7:45645663-45645685 CACAGCTCAGAGCTGAGGTGGGG + Intronic
1024217018 7:47256395-47256417 CACAGCACCGAGGAGAGGGGAGG + Intergenic
1029449359 7:100632298-100632320 CATCCCACGGAGAGGATGTGGGG + Intronic
1029848572 7:103439436-103439458 CACAGCAAGGAAAGGAGCAGTGG - Intronic
1031045191 7:116879675-116879697 CACAGCAGGGAGGTGAGGAGTGG - Intronic
1031834069 7:126661017-126661039 GATGGCATGGAGAGGAGGTGGGG + Intronic
1034190633 7:149210727-149210749 CACACCAGGGAGGGGAGGGGAGG + Intronic
1034319614 7:150168173-150168195 CACACCTCCTAGAGGAGGTGAGG + Intergenic
1034773143 7:153799046-153799068 CACACCTCCTAGAGGAGGTGAGG - Intergenic
1034818558 7:154196091-154196113 CACAGAACAGAGAGGAGAGGAGG - Intronic
1035044674 7:155955923-155955945 AAGAGCACGGGGAGAAGGTGGGG - Intergenic
1035793180 8:2326217-2326239 CTGGGCAGGGAGAGGAGGTGGGG + Intergenic
1035799624 8:2395488-2395510 CTGGGCAGGGAGAGGAGGTGGGG - Intergenic
1036028597 8:4939727-4939749 TACAGCACAGAGAGTACGTGTGG + Intronic
1036445379 8:8817606-8817628 CACAGCAAGGAGAACAGGAGGGG - Intronic
1037319589 8:17630639-17630661 CCCAGCAGGGAGGGGAGGGGAGG - Intronic
1037826149 8:22161784-22161806 CACACCTGGGAGAGGAGGAGAGG + Exonic
1038457841 8:27689509-27689531 CACAGCACAGAGAGCAGATCTGG + Intergenic
1039100391 8:33935235-33935257 AATAGCAGGGAAAGGAGGTGGGG - Intergenic
1039498416 8:37998496-37998518 CACACGAGGGAGAGGAGGTTTGG - Intergenic
1039597007 8:38799166-38799188 CAAGGCACGGAAAGGAGGAGTGG + Intronic
1039804603 8:40987466-40987488 AAGAGCTCGGAGAGGAGCTGAGG - Intergenic
1041028025 8:53706933-53706955 CACTGAGCTGAGAGGAGGTGAGG - Intergenic
1041397009 8:57401791-57401813 CACAGAAGGGCAAGGAGGTGGGG + Intergenic
1045051214 8:98327619-98327641 CACAACACAGAGATGTGGTGGGG - Intergenic
1047176842 8:122549595-122549617 CTCAGCCCAGAGTGGAGGTGAGG + Intergenic
1049012100 8:139894076-139894098 CACAGCACGCAGGGCTGGTGTGG - Intronic
1049086271 8:140480782-140480804 CACAGCAAGGCGGGGAGGTGCGG - Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049679615 8:143912041-143912063 CACTGCACCGGGAGGAGGTCAGG + Intergenic
1050525550 9:6543354-6543376 GACAGCAGGGAGGGGAGGAGGGG + Intronic
1052846704 9:33342588-33342610 CACAGAAGGGAGAGTAGGTGGGG - Intronic
1056022509 9:82455156-82455178 CACAGCACGGAAAGGACTTAAGG - Intergenic
1057456094 9:95212805-95212827 AACAGAAGGGAGAGGAGATGTGG + Intronic
1058135379 9:101301913-101301935 CACAGCACTGAGAAGAGGCAAGG - Intronic
1060419183 9:123455334-123455356 CACAGGATGGAGAGGCCGTGAGG - Intronic
1060548645 9:124475122-124475144 CATAGCATGGCGAGGCGGTGAGG + Intronic
1060596843 9:124853584-124853606 GCCAGCACGGCGGGGAGGTGAGG + Exonic
1061361432 9:130144816-130144838 CACAGGACGGGGTGGGGGTGGGG - Intergenic
1061563683 9:131423134-131423156 TACAGAAGGGAGAGAAGGTGAGG + Intronic
1061995615 9:134181320-134181342 GAGAGCAGGGAGAGGGGGTGAGG + Intergenic
1062085270 9:134645035-134645057 CACAGCAGGGAGAGGGCTTGGGG - Intronic
1062103172 9:134738857-134738879 CACAGTGTGGAGAGGAGGCGTGG - Intronic
1062347235 9:136120616-136120638 CACAGCAAGGAGCGGGGCTGTGG - Intergenic
1062441112 9:136570248-136570270 CCCAGAACAGAGAGGAGGGGAGG + Intergenic
1062612636 9:137381935-137381957 GAGAGCACGAGGAGGAGGTGAGG + Intronic
1062612646 9:137381973-137381995 GGGAGCACGCAGAGGAGGTGAGG + Intronic
1186201316 X:7157982-7158004 CACAGCAAGGAGAGAAGTGGGGG + Intergenic
1187075729 X:15932497-15932519 CACTGAACAGAGAGGAGCTGGGG + Intergenic
1187963736 X:24590527-24590549 CACAGGAGGGAGAGAAGGAGAGG + Intronic
1189655475 X:43240196-43240218 AACAGCCAGGAGAGGAGGTGGGG - Intergenic
1192582627 X:72297861-72297883 CAGAGGACCGAGAGGAGGTAGGG - Intronic
1193899899 X:87164393-87164415 AGCAGCCAGGAGAGGAGGTGGGG + Intergenic
1194746734 X:97636459-97636481 CACAGAAGAGAGAGGAGGGGAGG + Intergenic
1197383499 X:125775012-125775034 CTCAGCAAAGAGAGGATGTGGGG + Intergenic
1197397209 X:125941348-125941370 CTCAGCAGAGAGAGGATGTGGGG + Intergenic
1198026484 X:132712588-132712610 CACAGTCCTGAGAGGTGGTGTGG + Intronic
1198219448 X:134586229-134586251 CACAGCGAGGGGAGGAGGAGAGG + Intronic
1198366695 X:135946928-135946950 TACAGCATGAAGAAGAGGTGAGG + Intergenic
1200122259 X:153796721-153796743 CACAGCACACAAAGCAGGTGAGG - Intronic
1200124848 X:153808339-153808361 CACAGCTCAGAGAGGACGTACGG + Exonic