ID: 1019638972

View in Genome Browser
Species Human (GRCh38)
Location 7:2092556-2092578
Sequence GTGTGTGAGGGGAGGATGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 500}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019638972 Original CRISPR GTGTGTGAGGGGAGGATGCT CGG (reversed) Intronic
900802232 1:4744541-4744563 GGGTGTGAGGGAAGCATGCATGG - Intronic
900995537 1:6121441-6121463 GTGTGTGTGGGGTGGAGGTTGGG - Intronic
901120583 1:6889722-6889744 GTGTGTGTGTAGAAGATGCTGGG + Intronic
901238207 1:7678797-7678819 GTGCGTGAGGGGGTGTTGCTTGG - Intronic
901262531 1:7884821-7884843 GTGTATGATGGGTGGATGATGGG - Intergenic
902373965 1:16021615-16021637 GAGGGAGAGGGGAGGAGGCTGGG - Intronic
902378888 1:16043450-16043472 GAGGGAGAGGGGAGGAGGCTGGG - Intergenic
902529685 1:17082781-17082803 CAGTGTGAGGGGAGGAGGATGGG - Intronic
902601100 1:17540444-17540466 CTGTGGGAGGAGAGGATGCCGGG + Intronic
904131898 1:28281589-28281611 GTGTGTGAGAGGAGGAGGAGAGG + Exonic
904236317 1:29119621-29119643 GTGTGTGTTGGGGGGATGCTTGG + Exonic
904380948 1:30110514-30110536 GTGAGTGATGGGAGGATGGGAGG - Intergenic
905209959 1:36367231-36367253 GAGGGTGAGGGGAGGAGGCCAGG + Intronic
906237643 1:44221488-44221510 GTGAGGGAGAGGAGGATTCTGGG + Exonic
906533113 1:46534801-46534823 GGGTCTGAGGGGAGCATGCAGGG + Intergenic
906717274 1:47979575-47979597 GTGGGGGATGGGAGGATCCTTGG - Intronic
911668015 1:100576097-100576119 ATGTGTGAGGCTAGGATGCAGGG + Intergenic
912455868 1:109796864-109796886 GGCTGTGAGGGGAAGAAGCTGGG - Intergenic
912557648 1:110527889-110527911 GAGGGTGAAGGGAGGATGTTGGG - Intergenic
913148584 1:116017206-116017228 GTGGTTCAGGGGAGGATTCTGGG - Intronic
913230838 1:116739785-116739807 GGGTGTGGGGGCAGGAGGCTGGG + Intergenic
915278994 1:154809605-154809627 ATGTGGGAGGGCAGGAAGCTGGG + Intronic
916417113 1:164602296-164602318 GGGTGTGAGGGGAGATGGCTTGG - Intronic
916468121 1:165092802-165092824 GTGTTTGAAGGCAGTATGCTTGG + Intergenic
916877796 1:168988264-168988286 GTGTGTGAGGGGATGGGACTGGG - Intergenic
917121811 1:171651337-171651359 GTGTGTGTGGGGGGGGTGCGGGG - Intronic
917432754 1:174987600-174987622 GTGTGTGAAGAGAGGAGGATGGG + Intronic
917796709 1:178538099-178538121 GGGTGTGAGGGGGAGATGCAGGG + Intronic
918078800 1:181190259-181190281 GTGGGGAAGGGGAGGACGCTCGG + Intergenic
919050881 1:192509792-192509814 ATGAGTGAGAGGAGGATGATAGG + Intergenic
919809015 1:201397536-201397558 GTGTGTGTGGGGAGGCAGCTGGG - Intronic
919950147 1:202355495-202355517 GTGTGTAGGCAGAGGATGCTAGG + Intronic
919988956 1:202695652-202695674 GTCTGTGAGAGGAAGATGCCAGG - Intronic
920087042 1:203425029-203425051 GTGTGGGATGGGAGGGTGCCAGG + Intergenic
920139306 1:203796076-203796098 GTGGGGGAGGGGAGGAAGGTTGG - Intronic
920305202 1:205014219-205014241 GTGTCTGCGGGGAGGAGGCAGGG - Intronic
920440651 1:205978539-205978561 GTGTTTGAGGGGTGGATGGGTGG + Exonic
920558803 1:206923917-206923939 GTGTGTGAATGTAGGATGCGTGG + Intergenic
920686876 1:208116127-208116149 GCGGGAGAGGGGAGGATGTTTGG - Intronic
920955808 1:210619307-210619329 GAGTGTCAGGGGAGGAAGCTTGG + Intronic
920997462 1:211009146-211009168 GTGTGAGATGAGAGGCTGCTAGG + Intronic
921123165 1:212154157-212154179 GTGTGTGAGGAGATGAGGCTGGG + Intergenic
923051784 1:230395107-230395129 GAGTGTGAGGGGAGGAGGGAGGG - Intronic
923138604 1:231140872-231140894 GTGGGTGTGGGGAGCATTCTGGG + Intergenic
923522420 1:234745840-234745862 GTGGGTGAGGGAAGGATTCTGGG + Intergenic
924025809 1:239831742-239831764 ATGTGGGAGGGGAGGATCTTTGG + Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924679719 1:246219802-246219824 GTGTGTGAGTGCAGGAGCCTGGG - Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1064873531 10:19966821-19966843 ATATGTGAGGGAAGCATGCTGGG - Intronic
1065173336 10:23053386-23053408 GTGTGTGGCAGGAGGATGCAGGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067772244 10:49135141-49135163 GCCCGTGAGGGGAGGATGCCGGG - Intergenic
1068523571 10:58103926-58103948 GTGGATGATGAGAGGATGCTTGG + Intergenic
1069893679 10:71667404-71667426 GTGTGTGAGGGGTGGAGGTGTGG + Intronic
1070555268 10:77522538-77522560 GTGGGTGAGGGGCTGTTGCTAGG - Intronic
1070560585 10:77563727-77563749 ATGTGTTAGGGGAGGATGAGAGG - Intronic
1070846102 10:79523808-79523830 GTCTGTGGGGGGAGGATTCTGGG + Intergenic
1070927696 10:80236502-80236524 GTCTGTTGGGGGAGGATTCTGGG - Intergenic
1071240057 10:83695639-83695661 ATCTGTGATGGGATGATGCTGGG - Intergenic
1071689846 10:87805574-87805596 GTGAGTGAGTGGAGGAGGTTGGG - Intronic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1073047124 10:100646126-100646148 CTGAGGGAGGGGAGGAGGCTGGG + Intergenic
1073110881 10:101062406-101062428 GTGTGTTGGGGGAGGCTACTTGG + Intronic
1073331516 10:102672999-102673021 GAGGCTGAGGGGAGGAGGCTGGG + Intergenic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1074088729 10:110227293-110227315 GTGTGGGAGGGGCGGGTGCGGGG + Intronic
1074123339 10:110509437-110509459 CTGTGCCAGGGCAGGATGCTTGG - Intronic
1074372729 10:112913366-112913388 GTGTGTGAGGGGTGGGTGTGTGG + Intergenic
1074597771 10:114883028-114883050 TTGTGACAGGGTAGGATGCTGGG + Intronic
1074658270 10:115619464-115619486 TTGTGTCAGGGGTGGGTGCTGGG + Intronic
1075647696 10:124107440-124107462 GGGTGTGAGGGGAGGTGGCCAGG + Intergenic
1075709943 10:124525594-124525616 GTGTGTGAAAGGAGGCTGGTGGG + Intronic
1075862893 10:125692723-125692745 CTTTTTGAGGGGAAGATGCTGGG + Intergenic
1076188426 10:128466503-128466525 CTCTGTTAGGGGAGGATGCAAGG + Intergenic
1076762404 10:132611996-132612018 GTGTGGGAGGTGAGGAGGGTAGG + Intronic
1077113018 11:870206-870228 GGCTGTGAGGGGAGGAGGCCTGG - Intronic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1081637441 11:44729804-44729826 GTGTTGGAGGGCAGGGTGCTGGG + Intronic
1083837647 11:65282366-65282388 GTGTGTGATGGGAGGACAGTGGG - Intronic
1084128919 11:67118874-67118896 GTGTGTGGGGGGAGGGCGCGCGG + Intergenic
1085458969 11:76681676-76681698 GTGTGTCAGGGAAGGATTCCTGG + Intergenic
1086358145 11:86027621-86027643 GAGGGTGAGGGGTGGATGGTGGG - Intronic
1087281625 11:96217019-96217041 GAGTGTGAGAGCAGGATGGTGGG + Intronic
1089084116 11:115802422-115802444 GTGGGTGAGGGATGGATGGTTGG + Intergenic
1089085797 11:115815826-115815848 GTGTGTGCAGGGAGGATGCTGGG - Intergenic
1089197894 11:116705856-116705878 CTGGGTGAGGGAATGATGCTGGG + Intergenic
1089330272 11:117684479-117684501 GTGTGTGGGGTGAAGACGCTAGG + Intronic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1090168325 11:124575989-124576011 GTGTCTGTGGGGAGAATGCCAGG - Intergenic
1090642840 11:128744030-128744052 CTCTGTGATGAGAGGATGCTTGG + Intronic
1090730670 11:129570929-129570951 GAATGTGAAGGTAGGATGCTGGG - Intergenic
1090735609 11:129610141-129610163 GTGTGTGAGGGAAACATGTTTGG + Intergenic
1091087161 11:132732634-132732656 GTGTGTAAGGGGAGGCTTCAGGG + Intronic
1091529532 12:1340618-1340640 GGCTGAAAGGGGAGGATGCTGGG - Intronic
1091800352 12:3321076-3321098 AGGTGTGAGGGGCGGAAGCTTGG + Intergenic
1091952643 12:4607712-4607734 GTGTGAGAGGGCAAGTTGCTTGG - Intronic
1091977004 12:4833684-4833706 TTGTGTGAGGACATGATGCTTGG - Intronic
1092589912 12:9943376-9943398 GCGGCTGAGTGGAGGATGCTAGG - Intergenic
1092652659 12:10651058-10651080 GTGTGTGAGGTGTGTATGCAGGG + Intronic
1093667969 12:21836910-21836932 GTGTATGTGGGGAGGATGTGGGG + Intronic
1095338028 12:41051873-41051895 GTTTGTGTGGGGTGGATGTTAGG - Intronic
1095686383 12:45040237-45040259 GTGTTTGAGGGAAGGAAGCACGG - Intronic
1096465974 12:51848066-51848088 GTGTGGGAGGGGTGGGGGCTGGG - Intergenic
1097053793 12:56238552-56238574 GGGTGGGAGGGGAGGGTGCCTGG - Exonic
1097899637 12:64859682-64859704 GTTTCTGAGGGGAGGAGGATGGG + Intronic
1101460771 12:104890987-104891009 GTGTGGGAGGGGAGTAGGATGGG - Intronic
1101995340 12:109521513-109521535 GAGTTTGTGGGGAAGATGCTGGG + Exonic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1103403660 12:120659957-120659979 GTGTGGGAAGGGAGGTTGATGGG + Intronic
1104463707 12:128973943-128973965 GTGTGTGTGGGGGGGGCGCTTGG + Intronic
1106411268 13:29513181-29513203 ATGGGGGTGGGGAGGATGCTCGG + Exonic
1112142804 13:96664577-96664599 GTGAGTGAGAGGAGGAAGATGGG - Intronic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1112917755 13:104572206-104572228 GTGTGTGAGAGGCAGGTGCTGGG - Intergenic
1113636011 13:111919574-111919596 CTGTGTAATGGGAGGATGCCTGG - Intergenic
1114297475 14:21342680-21342702 GTGGATGATGGGAGGTTGCTTGG - Intronic
1117067330 14:52023591-52023613 AAGTGTGAGTGGAGGAAGCTGGG - Intronic
1118106910 14:62670072-62670094 GAGTGGTAGAGGAGGATGCTGGG + Intergenic
1118875893 14:69784723-69784745 GAGAGAGAGGGGAGGCTGCTGGG + Intronic
1119085802 14:71737821-71737843 CTGTGTGTGGGAAGGAAGCTGGG - Intronic
1119732038 14:76957141-76957163 AAGTCTGAGGGGAGGAGGCTGGG - Intergenic
1119758225 14:77133549-77133571 GAAGGTGAGGGGAAGATGCTAGG + Exonic
1121535468 14:94687608-94687630 GTGGGTGGGGGAAGGATACTTGG - Intergenic
1121552634 14:94813943-94813965 GTGTGTGTGGGAAGGAGGGTAGG - Intergenic
1121748101 14:96318739-96318761 ATGGATGAGGGGAGGAGGCTAGG - Intronic
1121781562 14:96625373-96625395 GTGTGTGAGGGGAGGATGAGGGG - Intergenic
1122001830 14:98664803-98664825 GTGTGTCAGAGGAGGGTTCTCGG - Intergenic
1122075097 14:99230771-99230793 GTGTGTGAGGGGTGGGGGCGGGG - Intronic
1122129610 14:99597504-99597526 CTGTGTCAGGGGAGGTTGCGTGG - Intronic
1122242295 14:100376862-100376884 GGGTGGGAGGGGGAGATGCTAGG - Intronic
1122266374 14:100548765-100548787 GTGTGGGAGGGGAGGACGAAGGG + Intronic
1122859220 14:104575085-104575107 GTGTGTGACGTGTGAATGCTCGG + Intronic
1202900764 14_GL000194v1_random:35815-35837 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1123432112 15:20226786-20226808 GTGTGTGAGGGGTGGAGGGGGGG - Intergenic
1123723768 15:23082466-23082488 GTGTTTGAAGGCAGTATGCTTGG - Intergenic
1124214120 15:27792525-27792547 GTGTGGGAGGTGAGGCTGCTTGG - Intronic
1126900598 15:53310440-53310462 GTGTGTGTGGAGAGTATGTTTGG - Intergenic
1127225800 15:56927222-56927244 ATGTATGAGGGAAGCATGCTCGG + Intronic
1127908106 15:63392187-63392209 GTGAGTGGGAGGAGGATGGTTGG - Intergenic
1127981612 15:64039260-64039282 GTGTGTGAAGGGGTGAGGCTAGG + Intronic
1128477033 15:68006182-68006204 GTGTGAGAGTGGTGGAGGCTTGG + Intergenic
1129321515 15:74777605-74777627 CTGGGGGAGGGGAGGAGGCTGGG + Intergenic
1129667446 15:77587470-77587492 GGGTGGGAGGGGAGGAGGCTGGG + Intergenic
1129887172 15:79046775-79046797 GTGTGTGATGGGAGGCTTCTTGG + Exonic
1130459292 15:84148260-84148282 GTGTGTGAGGGGAGCACTATAGG - Intergenic
1130894537 15:88159933-88159955 GTGTGTGTGTGTAGGAGGCTGGG - Intronic
1131015991 15:89058291-89058313 GTGTGGGTGTGGAGGAAGCTTGG - Intergenic
1132234396 15:100208155-100208177 GTGTGCTAGGGGAGGCTCCTGGG - Intronic
1132410791 15:101577074-101577096 GGCTGTGAGAGGAGGCTGCTGGG - Intergenic
1132525307 16:411297-411319 GGGGGAGAGGGGAGGGTGCTGGG + Intronic
1132840224 16:1975254-1975276 GTGTTTGAGGTGGGGATGCCTGG + Exonic
1133026856 16:2992365-2992387 GTGTGTGAGGGGTGGATCTGGGG - Intergenic
1134265218 16:12686628-12686650 ATCAGAGAGGGGAGGATGCTGGG + Intronic
1134434007 16:14238144-14238166 GTGGGTGGGTGGAGGTTGCTAGG + Intronic
1134677459 16:16100485-16100507 GTGTGTGAGGACAGGCTGCATGG + Intronic
1136115144 16:28089719-28089741 GTGTGTGAGGGGTGTATGTGGGG - Intergenic
1136610721 16:31363348-31363370 CTGTGGGAGGGGCTGATGCTGGG - Exonic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136852526 16:33624353-33624375 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1137270654 16:46900513-46900535 GAGTGGGAGGGGAAGACGCTGGG - Intronic
1137396440 16:48118727-48118749 TTGTGTGTGGGCATGATGCTTGG - Intronic
1137740168 16:50762138-50762160 GTGGATGATGGGAGGTTGCTTGG - Intronic
1137964775 16:52919986-52920008 GTGGGGGAGGGAAGCATGCTGGG - Intergenic
1138482578 16:57313321-57313343 GGGTATGAGGGGAGGCTGGTGGG + Intergenic
1139234448 16:65319916-65319938 GTATGTGAGGGGAAGTTTCTGGG + Intergenic
1139446943 16:67003913-67003935 GTGTGGGAGGGGAGCAGGATAGG - Intronic
1139641300 16:68293632-68293654 CTGTGTGAGAAGAGGGTGCTGGG - Intronic
1139805924 16:69565760-69565782 GGGTGGGAGGGGGGGAGGCTGGG - Intronic
1140655214 16:77132651-77132673 TTGTCTGAGAGGAGGCTGCTTGG - Intergenic
1141243530 16:82285213-82285235 GTGGGTGATGGGAGGAGTCTCGG + Intergenic
1141464623 16:84197455-84197477 GGGTGGGAGGGCAGGCTGCTTGG + Intergenic
1141846067 16:86609896-86609918 GTGAGGGTGGGGAGGACGCTGGG + Intergenic
1141849918 16:86638051-86638073 GGGGGTCAGGGGAGGCTGCTGGG + Intergenic
1142128686 16:88422495-88422517 GTGAGTGATGGGTGGATGATGGG + Intergenic
1203095542 16_KI270728v1_random:1252704-1252726 GTGTGTGGGGGGGGGGTGGTTGG + Intergenic
1203114126 16_KI270728v1_random:1472821-1472843 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1142480406 17:215271-215293 GAGAGTGAGGGGAGAATCCTGGG - Intronic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1142630146 17:1220351-1220373 CTGTCTGAGGGGAGGCTGCCTGG - Intronic
1142742737 17:1940571-1940593 GTGTGTTGGGGGAGGAACCTGGG + Intronic
1143225753 17:5301296-5301318 GTGTTTGATTGGAGGAGGCTGGG + Intronic
1143382761 17:6506864-6506886 CTGTGGGAGGGGTGCATGCTTGG - Intronic
1143618877 17:8069794-8069816 GTGTGTTTGGGAAGGAGGCTGGG - Intergenic
1144183601 17:12775056-12775078 GGGGGGGAGGGGAGGAAGCTGGG + Intergenic
1144655312 17:17031321-17031343 GCGTGTGAGTGTTGGATGCTGGG - Intergenic
1144746904 17:17621935-17621957 GTGTGGACGGGGAGGATACTGGG + Intergenic
1145159088 17:20562607-20562629 GTGTGCGAGTGTTGGATGCTGGG + Intergenic
1145176736 17:20707243-20707265 GTGTGTGGAGGGAGGAGGCTTGG + Intergenic
1145767837 17:27471562-27471584 CAGTGTCAGGGGAGGATGGTTGG + Intronic
1146629299 17:34458504-34458526 GCGGGTGAGGGGAGGATGAGAGG - Intergenic
1146762837 17:35493171-35493193 GTGTGTGAGGGGAGGAAGCCAGG - Intronic
1146890674 17:36504526-36504548 GTGGATGAGGGGTGAATGCTGGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147381967 17:40061694-40061716 GTGTGTTAGGGGGAGCTGCTCGG - Intronic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1147975825 17:44247641-44247663 GTGTGTGGGAGGTGGACGCTGGG + Intergenic
1148347164 17:46911006-46911028 GAATGTGAAGGCAGGATGCTTGG + Intergenic
1148677278 17:49452622-49452644 GGGTGGGAGGGGAGGAGGCAGGG + Intronic
1148695742 17:49556945-49556967 GTGTGGGAGCAGAGGGTGCTGGG - Intergenic
1150289132 17:63971665-63971687 GTGGGTGAGGGGAGGGGGCCAGG - Intronic
1151316226 17:73324239-73324261 GTGGGGGTGGGGAGGCTGCTTGG + Intergenic
1152022623 17:77788593-77788615 GTGGATGTGGGGAGGAGGCTGGG + Intergenic
1152324191 17:79626139-79626161 GGAAGTGGGGGGAGGATGCTGGG + Intergenic
1152469015 17:80480751-80480773 GTGGGTGCTGGGAGAATGCTGGG + Intergenic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1152799163 17:82323082-82323104 GTGTGTAGGAGGAGGAGGCTGGG - Intronic
1155325531 18:24660679-24660701 GTGTGTGAGGGCCCAATGCTGGG + Intergenic
1156474250 18:37395590-37395612 GTGAGTGAGGGGTGGATGCTAGG + Intronic
1156505038 18:37585108-37585130 GTGTGTGAGGGCAGGGTGGGAGG + Intergenic
1157126707 18:44963131-44963153 GTGGGGGTTGGGAGGATGCTAGG - Intronic
1157449092 18:47772201-47772223 GGGTGTCAGGGGAGGAGGCAAGG + Intergenic
1157600328 18:48889529-48889551 GTGGGAGAGGGGAGGATGGGCGG + Intergenic
1157777204 18:50404934-50404956 GTGTTTGAAGGCAGTATGCTTGG - Intergenic
1158714669 18:59867521-59867543 GGGTGTGAGGGGGTGGTGCTGGG - Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159039000 18:63305464-63305486 GTGTGTGTGGGGAGGAAAGTAGG + Intronic
1159599662 18:70416678-70416700 GGATGTGAGGGGCGGAGGCTCGG + Intergenic
1160222982 18:76990727-76990749 GTGTGTGCGTGTAGGATGGTAGG + Intronic
1160630195 18:80241669-80241691 GTGTGTGTTGGGAAGAGGCTGGG + Intronic
1160977714 19:1802079-1802101 GTGGGTGAGGGGTGGATGGGTGG - Intronic
1161043750 19:2123623-2123645 GTGTCTGTGGGGTGGATGCATGG - Intronic
1161097823 19:2403394-2403416 GTGTGTGATGGGAAGAAGCCTGG + Intronic
1161528604 19:4773110-4773132 GCATGTCAGGGGAGGAAGCTAGG - Intergenic
1161572341 19:5037467-5037489 CTGTGTGATGGCAGGGTGCTGGG - Intronic
1161657652 19:5525793-5525815 GTGAGGGAGGGGAGGATGGATGG - Intergenic
1161709243 19:5838586-5838608 GAGGCTGAGGGGAGGAGGCTCGG + Intronic
1163508307 19:17720821-17720843 GTGAGTGAAGGGAGGAGGCTGGG + Intronic
1164578647 19:29420839-29420861 GTGTGGGTGGAGAGGAGGCTGGG - Intergenic
1165028962 19:32983563-32983585 GTGTGTGTGGGTATGATACTGGG - Intronic
1165149662 19:33753454-33753476 GTGGGTGGTGGGAGGATGGTGGG - Intronic
1165330420 19:35138769-35138791 GGCTGGGAGGGGAGGCTGCTGGG + Intronic
1165361837 19:35341607-35341629 GTGAGTGAGGGCCGGAGGCTGGG + Intronic
1165482396 19:36072360-36072382 GTGTGTCCGGGGAGGATGGTGGG + Intronic
1167255240 19:48423701-48423723 GTAGATGAGGGGAGGATTCTGGG + Intronic
1167307019 19:48715195-48715217 GTTTGAGGGAGGAGGATGCTGGG + Intronic
1167382025 19:49143770-49143792 GTGTGTGTGGGGTGGAGGCGGGG + Intronic
1167458651 19:49612466-49612488 GGGTGTGGGGTGGGGATGCTGGG + Intronic
1167693626 19:51001863-51001885 TTCTGAGAGGGGAGGAGGCTGGG + Intronic
1167707084 19:51087489-51087511 GTGTGGTAGGGGTGGAAGCTGGG + Intergenic
1167824267 19:51958001-51958023 GTGTTTGAAGGTAGTATGCTTGG + Intergenic
925541692 2:4974330-4974352 TTGTGTGTGGGGAGGGTGCCAGG - Intergenic
925999466 2:9318816-9318838 GTTGGTGAGGGGAGGAGACTGGG + Intronic
926143199 2:10380770-10380792 GTGAGTGAGTGCAGGATGCCAGG - Intronic
927155997 2:20222188-20222210 ATGGGTGAGGGGAGGCTGCTAGG - Intronic
929145314 2:38702411-38702433 GGGTGTGAGGGAGGCATGCTCGG - Intronic
929356330 2:41029146-41029168 GTGTGTGTGTGGAGGGGGCTGGG + Intergenic
929890594 2:45915830-45915852 CAGTGGGAGAGGAGGATGCTTGG - Intronic
930364206 2:50418365-50418387 GTGTGTTGGGGGAGGCTGCAAGG - Intronic
932422967 2:71612249-71612271 GTGTGTGGGGGGAAGAATCTGGG + Intronic
932475498 2:72003370-72003392 GTGTGTGAGGGGCAGAGGCCAGG + Intergenic
932772001 2:74505671-74505693 GTGTGTGAGGGAAGGACCATGGG + Intronic
933170074 2:79115220-79115242 GGGTGTGAAGGGAGGACTCTGGG - Intergenic
933648738 2:84832191-84832213 GTGTGTTTGGGGAGTATGTTTGG - Intronic
934476105 2:94594628-94594650 GCGTGTGTGGCGAGGCTGCTGGG + Intronic
934506091 2:94895741-94895763 GAGTGAGAGGGGAGGAGGCAAGG + Intergenic
934613329 2:95756367-95756389 GCTTGTGAGGGGAGGGTTCTTGG + Intergenic
934768596 2:96894367-96894389 GTGGGTGTGGGGAGGATGAGTGG - Intronic
934907287 2:98216457-98216479 GTATGTGAGGGCAGGAGGTTGGG + Intronic
935115528 2:100132233-100132255 GTGTGTGTTGTGAGGATACTTGG - Intronic
935121139 2:100184768-100184790 GTGGGTAATGCGAGGATGCTGGG + Intergenic
935345736 2:102106119-102106141 GGGTGTGAGGAGTGGATGGTGGG + Intronic
935840007 2:107098721-107098743 GTGGGTGAGGGGAGGAGTCTGGG + Intergenic
936244807 2:110817294-110817316 CTCTGTGAGGGGAGGCAGCTTGG + Intronic
937089607 2:119197061-119197083 GGGGGTGAGGGGAGGATGGAGGG + Intergenic
937140585 2:119596471-119596493 GAGTCTGAGTAGAGGATGCTGGG - Intronic
937718599 2:125063943-125063965 GTTTGTGTGGGGAGGGTGGTTGG + Intergenic
937831563 2:126430045-126430067 GGGTGCCAGGGGAGGATGTTGGG + Intergenic
937835821 2:126469485-126469507 GTGTGTGCAGGGAGAATGGTGGG - Intergenic
938132807 2:128732000-128732022 GTCTTTGAAGGGAGGAGGCTTGG + Intergenic
938227301 2:129627020-129627042 GCATGTGAGGGGAGCATGATTGG - Intergenic
938692748 2:133807442-133807464 CTATGTGTGGGGAGGATGCCAGG - Intergenic
940210712 2:151253853-151253875 TTGTGAGTGGGGAGCATGCTGGG - Intronic
941200161 2:162498484-162498506 GTGTGTGTGGGGGGGAGGGTGGG + Intronic
942535276 2:176956553-176956575 GTGTGTGAAGGGCTTATGCTAGG - Intergenic
943012832 2:182472577-182472599 GTGAATGATGGGAGGTTGCTTGG + Intronic
944046023 2:195413211-195413233 GTTTGTGTGGGGAGGATGGTTGG - Intergenic
944225336 2:197343848-197343870 GAGTGGGAGGGAAGGAGGCTTGG + Intergenic
946436764 2:219662080-219662102 GTGTGTGGAGTGAGGGTGCTGGG + Intergenic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
948581056 2:238987332-238987354 TTGCGGGAGGGGAGGATGCAAGG - Intergenic
1168753072 20:297553-297575 GGGAGCGAGTGGAGGATGCTGGG + Exonic
1168965566 20:1895931-1895953 GGGTGTGAGGGGAGGAGGTGAGG + Intronic
1169005473 20:2203777-2203799 GTGTGTGAGGTGAGGAATATCGG - Intergenic
1169138645 20:3213651-3213673 ATGTGTGTGGGGAGGATGTAGGG - Intronic
1170055637 20:12199802-12199824 GTGTGTGAGAGTAGGGAGCTGGG + Intergenic
1170548328 20:17454005-17454027 CTGTGTCAGGGTGGGATGCTGGG + Intronic
1170914927 20:20613607-20613629 GCGTGAGAGGGGAGGAGGCAGGG - Intronic
1171055359 20:21901451-21901473 GTGTGTGGGGATATGATGCTAGG - Intergenic
1171435109 20:25116250-25116272 GAGGGTGAGTGGAGGAAGCTGGG - Intergenic
1172445943 20:34993471-34993493 GTGGGTGTGGGAAGGAGGCTGGG + Intronic
1172841250 20:37903662-37903684 GAGTGTGTGGGGAGGAGGTTCGG - Intronic
1172997606 20:39082812-39082834 GTGTGTGAGGGGATGTGGCCAGG + Intergenic
1173768613 20:45637522-45637544 GGGTCTGAGGGGTGGATGCTGGG - Intergenic
1173866211 20:46314068-46314090 GTGTGTGTGGGGAGTGTGGTAGG - Intergenic
1174200290 20:48802342-48802364 GTGAGTGAGGGGAGAATGGGTGG - Intronic
1175131698 20:56794326-56794348 GTGGCTGAGGGAGGGATGCTGGG - Intergenic
1175353805 20:58346145-58346167 GTGGCTGAGAGCAGGATGCTGGG - Intronic
1176376867 21:6091182-6091204 CTGCGGGAGGGGAAGATGCTGGG - Intergenic
1176620138 21:9050593-9050615 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1178153968 21:29830294-29830316 GTGTGTGTGGGGAGGTGGGTGGG - Intronic
1178908140 21:36652922-36652944 GTGCGTGGGGGGTGGATGCAGGG - Intergenic
1179140740 21:38722799-38722821 GGGTGCGAGGAGAGGATCCTTGG + Intergenic
1179256006 21:39715885-39715907 GTGTGTGTGGGGGGGTGGCTGGG + Intergenic
1179490466 21:41737906-41737928 GTGTGTGTGTTGAGGATGATGGG + Intergenic
1179648813 21:42793326-42793348 GTGCGAGAGGGGATGGTGCTGGG + Intergenic
1179746608 21:43447062-43447084 CTGCGGGAGGGGAAGATGCTGGG + Intergenic
1179801368 21:43812955-43812977 GTGTGTGGGGGGGGGAGCCTCGG - Intergenic
1179891639 21:44338689-44338711 GTGAGGGAGGGGAGGAGGCCGGG - Intronic
1179926093 21:44534496-44534518 GTGTGAGAGGGAGGGCTGCTGGG + Intronic
1181055904 22:20260400-20260422 GTGTGGGAGGGAACGTTGCTGGG + Intronic
1181269775 22:21652343-21652365 GTGTCTGAGGAGGGGATCCTGGG + Intronic
1181423464 22:22817884-22817906 GTGTGTGAGGAGAGGATGTGTGG - Intronic
1181466483 22:23113270-23113292 CTGTGGGAGAGAAGGATGCTGGG - Intronic
1181593168 22:23896844-23896866 CTGTGTGAGGGCAGGAGGGTTGG + Intronic
1181818644 22:25458797-25458819 GTGTGTGTGGGGAGCCTGATAGG + Intergenic
1182099719 22:27649355-27649377 GAGTGAGAGGGTAGGATGCATGG + Intergenic
1182821425 22:33219923-33219945 CTGTGTGAGGGGAGGATTCCAGG - Intronic
1183337868 22:37260959-37260981 GTGTGTGAGCGAAGGCTCCTTGG - Intergenic
1183607030 22:38871974-38871996 GTGGGGGTGGGGAGGATGCGGGG + Intronic
1183652941 22:39169454-39169476 GTGGGTGTGGGGTGGATCCTGGG - Intergenic
1184033664 22:41908838-41908860 GTGTGTGATGTGGGGAGGCTAGG - Intergenic
1184033677 22:41908884-41908906 GTGTGTGATGTGGGGAGGCTAGG - Intergenic
1184378465 22:44130016-44130038 TTGAGGGAGGGGAGGCTGCTGGG + Intronic
1184657187 22:45947748-45947770 GGGTGTGAGGTGAGGATGGTGGG + Intronic
1184842837 22:47062684-47062706 GTGGGTGAGGGGAGAAGCCTGGG + Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185104345 22:48858860-48858882 GGGTGGGAGGGAAGGATGGTTGG - Intergenic
1185197642 22:49482296-49482318 GTGTGTGAAGGGAGGCGGCCGGG - Intronic
1185288682 22:50013603-50013625 GTGTGTGGGGGGGGGATGGCGGG + Intergenic
1185355495 22:50367146-50367168 ATGTGGGAGCGGAGGATGCCTGG + Intronic
949232163 3:1763113-1763135 GGGAGAGAGGGGAGGAAGCTTGG + Intergenic
949887848 3:8710579-8710601 GGGTGTGAGAGTAGGGTGCTAGG + Intronic
950709981 3:14807122-14807144 TTGTGTGTGGGGAGGGTCCTGGG + Intergenic
950922222 3:16705959-16705981 GTGAGTGAGGGGAGGCTGAAGGG - Intergenic
951614210 3:24523166-24523188 GTGTGTGGGGGGGGGAGGGTGGG + Intergenic
952346568 3:32493263-32493285 TGGTGTGAGGTCAGGATGCTTGG + Intronic
953403751 3:42649975-42649997 AGGTGTCAGGGGAGGACGCTGGG + Intergenic
953506478 3:43490789-43490811 GTGTGTGTGGGGGTGGTGCTGGG - Intronic
954128919 3:48549824-48549846 GTGTGGGGGGAGAGGTTGCTGGG - Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954433050 3:50481470-50481492 GGGAGTGAGGGGTGGATACTAGG + Intronic
954580532 3:51700689-51700711 GTTTGGGAGGGAAGGAAGCTGGG - Intronic
955271236 3:57501704-57501726 GTGTGTGAGGTCAGGATGTATGG - Intronic
957835921 3:85589143-85589165 TTGTGTGTGGGGAGGAGGCTGGG + Intronic
958065676 3:88542475-88542497 GTGTGTGTTGGGATGATGGTGGG + Intergenic
960510220 3:118540598-118540620 GTGTTTGAAGGCAGTATGCTTGG - Intergenic
960682351 3:120262677-120262699 GTGTGTGCAAGGAGGGTGCTGGG + Intronic
960763545 3:121098927-121098949 CTGTGAGGTGGGAGGATGCTGGG - Intronic
961170067 3:124791232-124791254 GTGTGCGAGGGGAGCTTCCTGGG - Intronic
961368397 3:126415399-126415421 GGTTGTGAGTGGTGGATGCTGGG - Intronic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961756764 3:129132401-129132423 GGGTGTGAGTGGAGGCTGATGGG - Intronic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
962003987 3:131329838-131329860 GGGAGTGAGGGGAGGAAGGTAGG + Intronic
962103332 3:132365496-132365518 GTGAGTGAAGGGAGGGTGATAGG + Intronic
964727768 3:159832550-159832572 GTGTGTTAGGGGTGGAAGCTGGG - Intronic
965071997 3:163925923-163925945 GTGTGTGAGAGGAGGTAGCCAGG - Intergenic
965224305 3:165968692-165968714 GTGTGTTAGTGAAGGATTCTGGG - Intergenic
966613697 3:181892498-181892520 TTGTGTGTGGGGCGGAGGCTGGG + Intergenic
966633503 3:182106127-182106149 GTGTGTATGGCGAGGATTCTGGG - Intergenic
967273069 3:187746594-187746616 GTGTGTGTGGGGGGGAGGGTGGG + Intergenic
967917024 3:194586324-194586346 GTTTGTGAAGGGAGGAGGCTGGG + Intergenic
968224105 3:196962259-196962281 GTGTTTGAAGGCAGTATGCTTGG + Intronic
968250116 3:197202002-197202024 GGGTGGGAGGGGTGGATGATAGG + Intronic
968610359 4:1554215-1554237 GAGGGTGAGGGGTGGTTGCTGGG - Intergenic
969092821 4:4708254-4708276 GGGTGTGGGGGAAGGATTCTGGG + Intergenic
969384272 4:6832785-6832807 GTGTAGGAGGGAAGCATGCTAGG + Intronic
970676110 4:18452164-18452186 GTGGGTGGTGGGAGGATGTTAGG + Intergenic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
973584604 4:52377590-52377612 GGGTCTGAGGTGGGGATGCTAGG - Intergenic
973857580 4:55028780-55028802 ATGTCTGAGGGGAGGAGGATGGG - Intergenic
974026721 4:56739316-56739338 TTGTGTGGTGGGAGGAGGCTGGG - Intergenic
974598544 4:64045277-64045299 GTGTGTGTTGGGGGGATGTTTGG - Intergenic
974921884 4:68252179-68252201 GTCTGTGAGAGTAGGATGTTAGG - Intergenic
976836465 4:89380320-89380342 GGGTGAGAGGAGAGGAAGCTGGG - Intergenic
979507043 4:121510367-121510389 GTGTGAGGGGTGAGGAGGCTGGG - Intergenic
982659788 4:158192881-158192903 GTGAGTGAGGGGAGTATTGTAGG - Intergenic
983162640 4:164435433-164435455 GTGAATGATGGGAGGTTGCTTGG + Intergenic
984596326 4:181672560-181672582 GTGTGAGAGAGAAGGAAGCTGGG - Intergenic
984875716 4:184365764-184365786 GTGGGTGAGGGAAGGAGGGTGGG - Intergenic
985386972 4:189458283-189458305 GTGGGTGAGGAGAGGATCCTGGG - Intergenic
985547668 5:518236-518258 GAGTGTGAAGGGATGAAGCTGGG + Intronic
985983458 5:3490840-3490862 GTGTGTGTAGGGGGGAAGCTAGG - Intergenic
986355117 5:6916183-6916205 CTGTCTGAGTGGAGGATGTTGGG + Intergenic
986675737 5:10183607-10183629 GGGTGGGAGGGCAGGAGGCTAGG + Intergenic
986806143 5:11310745-11310767 GTGTGTGAGGTGAGAGTGCTTGG - Intronic
986806159 5:11310872-11310894 GCGTGTGAGGTGAGGGTGCATGG - Intronic
986806177 5:11310993-11311015 GTGTGTGGGGTGAGGGTGCATGG - Intronic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
989474417 5:41857552-41857574 GTGGGTGAGGGGAAAATGTTGGG + Intronic
989786355 5:45336169-45336191 GAGAGGGAGGGGAGGATACTAGG + Intronic
989988779 5:50736131-50736153 GTGGGTGGGGGGAGGTTTCTTGG - Intronic
990976311 5:61564696-61564718 ATGTGAGAGGGGATGATGCAAGG + Intergenic
991049356 5:62255802-62255824 GTGTGTGAGGGGTGGAGGCGGGG - Intergenic
991245199 5:64503091-64503113 TTGTGAGGGGTGAGGATGCTTGG - Intergenic
991404183 5:66285675-66285697 GTGTGTAAGGAGCGGATGGTTGG + Intergenic
992939047 5:81743800-81743822 GTGTGTAAGGGAGTGATGCTGGG + Intronic
993617073 5:90125904-90125926 GTCTGTGATGAGAGAATGCTTGG - Intergenic
993777013 5:92012346-92012368 GTGTGTGGGGGGGGGAGGCGGGG - Intergenic
994175278 5:96703575-96703597 GTGTGTAAGTGGAGAATGCCGGG - Intronic
994721834 5:103389535-103389557 GTGTGTGTGGGCAGGGGGCTGGG + Intergenic
996198887 5:120645376-120645398 GTGTGTGGGGGGGGGATGGGTGG - Intronic
996404792 5:123094472-123094494 GTGTGTTATGGGATGAGGCTGGG - Intronic
997205615 5:132047323-132047345 GTCAGGGTGGGGAGGATGCTGGG + Intergenic
997337923 5:133120837-133120859 GTGTGTGTGGGGAGGCTTCCAGG - Intergenic
997875555 5:137543655-137543677 GTGTGTAAGGAGAGGAGGGTAGG + Intronic
999097152 5:148990017-148990039 GAGTGAGAGGAGAGGTTGCTTGG - Intronic
1000116607 5:158159831-158159853 GTGGGTAGGAGGAGGATGCTGGG - Intergenic
1000173055 5:158722866-158722888 GTCTTTAAGGGGAGGATGTTGGG + Intronic
1000236233 5:159363524-159363546 GTGGGTGATGGTAGGTTGCTTGG - Intergenic
1001522525 5:172404810-172404832 GTTGGTGAGGGGGGCATGCTGGG + Intronic
1001592243 5:172873498-172873520 GTGAGTGAGTGAAGGATGCAGGG - Intronic
1001638716 5:173230733-173230755 GTGGAAGAGGGGAGGATGCCAGG - Intergenic
1001923046 5:175615810-175615832 GGCTGTGAGGGGAGGAGGATGGG + Intergenic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002429585 5:179195229-179195251 GGGTGTGGGAGGAGCATGCTGGG - Intronic
1002458404 5:179359542-179359564 GTGTGTGAGGTGTGGAAGGTAGG - Intergenic
1003165321 6:3672336-3672358 GTGGGTGAGGGGTGGGGGCTGGG - Intergenic
1003840700 6:10116303-10116325 GACTGTGAAAGGAGGATGCTTGG + Intronic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004740334 6:18454120-18454142 CTGTGTGAGGTTATGATGCTTGG - Intronic
1004934323 6:20492352-20492374 GTGTGTGAGGGGAGGAGGCCAGG - Exonic
1005825502 6:29629229-29629251 GTTTCTGAGGGGAGGGTGCCTGG + Intronic
1005843189 6:29757988-29758010 GGGTGAGAGAGGAGGCTGCTGGG + Intergenic
1005912772 6:30325967-30325989 GTGGGTGAGGTGATGAGGCTGGG - Intergenic
1006068453 6:31479259-31479281 GGGTGAGAGAGGAGGCTGCTGGG - Intergenic
1006081997 6:31573100-31573122 GGGGGAGAGGGGTGGATGCTTGG - Intronic
1007171149 6:39864571-39864593 GTGTGTGGGGGGTGGGGGCTGGG - Intronic
1007189639 6:40002725-40002747 TTGTAGGAGGGGAGGATGTTTGG - Intergenic
1007364900 6:41384478-41384500 GTGAGTGAGGGAAGGGGGCTTGG - Intergenic
1012423973 6:99094348-99094370 GTGGGTGAGAGGAGGGTGCCAGG + Intergenic
1012959277 6:105605578-105605600 GTGTGCCAGGGAAGGATGTTTGG - Intergenic
1014007878 6:116442220-116442242 GTGGGGGAGGGGAGGGTGATAGG + Intergenic
1015594608 6:134854466-134854488 GTGTGTGTGGGGTGGGTGATGGG - Intergenic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1017991530 6:159493285-159493307 GTGAGTGAGGAGACGCTGCTGGG - Intergenic
1018057001 6:160060814-160060836 GTGTGTGTGGTGTGTATGCTTGG + Intronic
1018245966 6:161824109-161824131 GTCTGTGCGAGGAGGATCCTTGG - Intronic
1019638972 7:2092556-2092578 GTGTGTGAGGGGAGGATGCTCGG - Intronic
1019721589 7:2575539-2575561 GTGCGGGAGGGGAGGGTACTGGG + Intronic
1020005638 7:4782637-4782659 GTCTGTGAGGTGAGGGGGCTGGG - Intronic
1020219957 7:6228479-6228501 GTGTGGGAGGGTAGGATTCAGGG + Intronic
1021716602 7:23468306-23468328 GTGTGTGTGTTGATGATGCTGGG - Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022812868 7:33886429-33886451 TTTTGTGAGGGGAGGTTGCTTGG - Intergenic
1023967785 7:44971983-44972005 GCGTGAGTGGGGAGGGTGCTCGG - Intronic
1024359704 7:48455223-48455245 GAGTCTGAGGGGAGGGTACTCGG - Exonic
1024832601 7:53479004-53479026 GTGGGTGAGGGGAGTATGTGTGG - Intergenic
1024987967 7:55212284-55212306 GTGTGGCAGGGGAGGGTTCTAGG + Intronic
1027655894 7:80930436-80930458 GAGTGTGGGGGGAGGGTGGTGGG - Intergenic
1028916114 7:96261051-96261073 GCCTGAGAGGGGAGGGTGCTTGG - Intronic
1029239732 7:99151072-99151094 TTGTGTGAGGGAGGGATGCTAGG + Intergenic
1029491915 7:100875329-100875351 GTGGGGGAGGGGAGGAGCCTGGG + Intronic
1031701035 7:124926946-124926968 GTGGATGATGGGAGGTTGCTTGG + Intronic
1032173383 7:129604370-129604392 GCCTGTCAGGGGAGGATGGTGGG + Intergenic
1032839936 7:135705673-135705695 GTATGTGAGAGGTGGAGGCTGGG + Intronic
1033447105 7:141432872-141432894 GGGTCTGAGGGGCGGATTCTGGG + Intronic
1034701492 7:153099944-153099966 GTGTGTCAGGTGAGAATGATGGG + Intergenic
1035059186 7:156056588-156056610 GGGTGTGGGGTGAGGATGCCGGG + Intergenic
1035243138 7:157545112-157545134 GTGTGTGTGGGGTGTATGCATGG + Intronic
1035296778 7:157871981-157872003 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296784 7:157872007-157872029 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296796 7:157872054-157872076 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296809 7:157872126-157872148 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296831 7:157872228-157872250 GTGTGTGTGGGGAGGACACTGGG - Intronic
1035296842 7:157872280-157872302 GCGTGTGTGGGGAGGACACTGGG - Intronic
1035296848 7:157872306-157872328 GGGTGTGTGGGGAGGACACTGGG - Intronic
1035296856 7:157872332-157872354 GTGTGTGGGGGGAGGACACTGGG - Intronic
1035296864 7:157872358-157872380 GTGTGTGGGGGGAGGACACTGGG - Intronic
1035296872 7:157872384-157872406 GTGTGTGGGGGGAGGACACTGGG - Intronic
1035296884 7:157872436-157872458 GCGTGTGTGGGGAGGACACTGGG - Intronic
1035407614 7:158609832-158609854 GTGTGTGAGGGGAGTGTGAGGGG + Intergenic
1036482000 8:9148297-9148319 GTCTGTCAGGAGAGGAGGCTGGG - Intronic
1036599954 8:10251670-10251692 GTGGGTGTGGGGAAGATGGTTGG - Intronic
1037389624 8:18380137-18380159 GTGTGTGACTTGAGGATGCTTGG - Intergenic
1037807990 8:22069111-22069133 ATGTGTGAGGGGAGGGAGTTAGG - Intronic
1038455148 8:27668024-27668046 GTGAGTGGAGGGAGGATGCAGGG - Intronic
1039446127 8:37634433-37634455 GTGGATGATGGGAGGTTGCTTGG + Intergenic
1040564689 8:48555138-48555160 GGGGGTGAGGAGAGGAAGCTGGG - Intergenic
1040601447 8:48888374-48888396 GTGAGTCAGGAGAGGATGCAGGG - Intergenic
1040606576 8:48939227-48939249 GTCGGTGAGGGGAGGGGGCTGGG - Intergenic
1041077654 8:54183964-54183986 TTCTGTGAGGGGAGGAAGGTTGG - Intergenic
1041162695 8:55061211-55061233 GTATGTGAGGGGAGGTTGTGCGG - Intergenic
1041948465 8:63473641-63473663 GTATGTGAGGAAAGTATGCTAGG - Intergenic
1042021015 8:64371222-64371244 GGGGGAGAGGGGAGGATGCTGGG + Intergenic
1042730276 8:71925932-71925954 GTGTATGAGGGCAGGATGAAAGG + Intronic
1043610875 8:82061546-82061568 GTGCATGAGGAGACGATGCTAGG + Intergenic
1044469714 8:92552517-92552539 GTGTGTGTGGGGGGGGTGTTGGG - Intergenic
1045082552 8:98643379-98643401 GTGTGAGATGGGAACATGCTTGG - Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1047606243 8:126477699-126477721 TTGTGGTAGGGGAGGATGCCGGG + Intergenic
1048184752 8:132229557-132229579 GTGTCTGTGGGGAGGCTTCTAGG + Intronic
1048307880 8:133296467-133296489 GTGTGTGGGGGGAGGGTCCAGGG - Intronic
1049361784 8:142215518-142215540 GTGTGTGTGGGGAGGCTGAGGGG - Intronic
1049553755 8:143272311-143272333 GTGAGTTAGGGGAGCAAGCTAGG - Intronic
1050492241 9:6200291-6200313 TTCTGTGAGGGGAAGATGATGGG - Intergenic
1050975685 9:11935383-11935405 GAGTGGGAGGGGAGGGTGCAGGG + Intergenic
1051774649 9:20621203-20621225 GCGTGGGAGGGGAGGTGGCTGGG + Intronic
1053017051 9:34667835-34667857 TGGTGTGAGGGGCAGATGCTGGG + Intergenic
1053348546 9:37395994-37396016 GTGTGGGAGGGGAGGGGGCCGGG - Intergenic
1053488746 9:38483556-38483578 GTGTGTGAGCGATGGAAGCTGGG + Intergenic
1054337843 9:63823456-63823478 GTGTGTGTGGGGAGTATGTATGG - Intergenic
1054355016 9:64051943-64051965 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1055594411 9:77850627-77850649 GAGTGGGAGGTGAGGAGGCTAGG - Intronic
1056567346 9:87785690-87785712 GTGTTTGAAGGCAGTATGCTTGG - Intergenic
1057291488 9:93810056-93810078 CTGTGTTACGGGACGATGCTCGG + Intergenic
1057439863 9:95075067-95075089 GTGTGGGAGGGAAGGAGACTGGG - Intronic
1057744345 9:97739564-97739586 GTTTGGGAGGGGATGCTGCTAGG - Intergenic
1057809486 9:98246817-98246839 GAGTTTGCGGGGAGGAAGCTGGG + Intronic
1057950831 9:99368076-99368098 GTTTATGTGGGCAGGATGCTGGG - Intergenic
1058797989 9:108516975-108516997 GTGTGTGGGGGGAGGGGGCAAGG - Intergenic
1059277187 9:113107017-113107039 GTTTGTGAGGGGCGGATCCTGGG - Intergenic
1059279064 9:113117534-113117556 GTTTGTGAGGGGCGGATCCTGGG + Intergenic
1061218666 9:129236434-129236456 GGGTGGGTGGGGAGGATGCTGGG + Intergenic
1061420124 9:130468904-130468926 GAGTGTGAGGGGAGGCACCTCGG + Intronic
1062012538 9:134274771-134274793 GTGCCTGAGGGGAGGAGGCATGG + Intergenic
1062133664 9:134913454-134913476 GTGATTGAGGGGGGGATGATAGG + Intronic
1062252565 9:135605620-135605642 GTGTGGCAGGGGAGGGTGATTGG + Intergenic
1062273553 9:135720537-135720559 GTGTGTGGGGGCAGGATGATGGG - Intronic
1062355633 9:136160707-136160729 GTGTGGGAGGGGAGGTTCCCAGG + Intergenic
1203743348 Un_GL000218v1:21048-21070 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1185886667 X:3789421-3789443 GTGTGTGTGGGGAGGGAGCAGGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186285749 X:8042342-8042364 ATGTGTCAGGAGAGAATGCTTGG - Intergenic
1187280972 X:17858596-17858618 GTGTGTGAGGAGCTGTTGCTGGG - Intronic
1187607889 X:20906060-20906082 GTGTCTGTGGGGGGGATGCAGGG + Intergenic
1188006898 X:25021734-25021756 GAGTGGGAGAGGAGGATGCCTGG - Intergenic
1190216151 X:48480727-48480749 GGGTGTGAGGAGAGGATGCGGGG + Intronic
1190257254 X:48772862-48772884 GTGATGGAGGGGAGGATGGTAGG + Intronic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1192020316 X:67384305-67384327 GTTTCTGTGGGGAGGATGATTGG - Intergenic
1192180540 X:68913056-68913078 GTGTGTCAGGGGAGATTGTTGGG - Intergenic
1192670026 X:73130244-73130266 GTGTGTGCGTGTAGGATGGTAGG - Intergenic
1192941218 X:75913449-75913471 GTTTGTGCAGGGAGGATGATGGG + Intergenic
1193416911 X:81236861-81236883 GTGTGTGAGGGAAGGACGGAGGG + Intronic
1195654205 X:107319658-107319680 GTGTGGGGGGGGGGGATGATAGG + Intergenic
1195668549 X:107450879-107450901 GCGTGTGACGGGGGGTTGCTGGG - Intergenic
1195742119 X:108075473-108075495 TTGTGTGAGGGGAGGCAGATGGG + Intronic
1195862969 X:109400699-109400721 GTGAGTGAGTGGTGGATGGTGGG - Intronic
1196053268 X:111328129-111328151 GTGTATGAGGGGAATTTGCTTGG - Intronic
1197353255 X:125402987-125403009 GAGGGTGAGGGGATGATGCAAGG - Intergenic
1197853386 X:130888992-130889014 GTGTGTTGGGGGAGGATTCAAGG + Intronic
1198314240 X:135450585-135450607 GAGTTTCAGGGGAGGATGCAGGG - Intergenic
1198983840 X:142427597-142427619 GTGGGGGAGTGGAGGCTGCTAGG + Intergenic
1199780177 X:151051348-151051370 GGGTGTGGGGTGAGGATTCTAGG + Intergenic
1200015957 X:153164082-153164104 GTGTGGGAAGGGAGGAAGGTGGG - Intergenic
1200153176 X:153961443-153961465 GGGTGTGCGGGGAGCAAGCTGGG - Intronic
1201156875 Y:11138519-11138541 GAGTGAGAGGGGAGGAGGCAAGG - Intergenic
1202379762 Y:24265865-24265887 GTGTGTGAGGGGAGCACTATAGG + Intergenic
1202491020 Y:25404256-25404278 GTGTGTGAGGGGAGCACTATAGG - Intergenic