ID: 1019641038

View in Genome Browser
Species Human (GRCh38)
Location 7:2103765-2103787
Sequence ACCCCCTGAACCACTGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019641036_1019641038 -1 Left 1019641036 7:2103743-2103765 CCCAGCAGTGTGGCATAAGCAGA 0: 1
1: 0
2: 2
3: 15
4: 191
Right 1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
1019641031_1019641038 11 Left 1019641031 7:2103731-2103753 CCCTGCCCAGATCCCAGCAGTGT 0: 1
1: 0
2: 4
3: 35
4: 310
Right 1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
1019641035_1019641038 5 Left 1019641035 7:2103737-2103759 CCAGATCCCAGCAGTGTGGCATA 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
1019641030_1019641038 14 Left 1019641030 7:2103728-2103750 CCTCCCTGCCCAGATCCCAGCAG 0: 1
1: 1
2: 4
3: 73
4: 658
Right 1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
1019641037_1019641038 -2 Left 1019641037 7:2103744-2103766 CCAGCAGTGTGGCATAAGCAGAC 0: 1
1: 0
2: 1
3: 8
4: 69
Right 1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
1019641032_1019641038 10 Left 1019641032 7:2103732-2103754 CCTGCCCAGATCCCAGCAGTGTG 0: 1
1: 0
2: 7
3: 42
4: 360
Right 1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
1019641034_1019641038 6 Left 1019641034 7:2103736-2103758 CCCAGATCCCAGCAGTGTGGCAT 0: 1
1: 0
2: 0
3: 14
4: 210
Right 1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG 0: 1
1: 0
2: 1
3: 16
4: 182
1019641029_1019641038 17 Left 1019641029 7:2103725-2103747 CCTCCTCCCTGCCCAGATCCCAG 0: 1
1: 2
2: 17
3: 118
4: 1077
Right 1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG 0: 1
1: 0
2: 1
3: 16
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019641038 Original CRISPR ACCCCCTGAACCACTGTGCA CGG Intronic
901547485 1:9969492-9969514 CGCCCATGAACCACTGTGCCTGG - Intronic
901634120 1:10662836-10662858 ACCCCCTGAACCCCTGCCCTGGG + Intronic
903277957 1:22233548-22233570 ACACCCTGAACCTCTGTGCCTGG + Intergenic
903323901 1:22558551-22558573 ACCCCCTGTAGCACCGTGCCAGG - Intergenic
903483600 1:23672987-23673009 TCCTCATGAACCACTGGGCATGG + Intergenic
905291188 1:36922817-36922839 ACTCCCTAAACCCCTGAGCAGGG + Intronic
909061088 1:70880250-70880272 ACTCCCTTAATGACTGTGCAAGG + Intronic
909932243 1:81509745-81509767 ACACCCTGACTCACTGTGCCAGG + Intronic
910481332 1:87661452-87661474 ACCCAATGAACCACTGAGAAGGG - Intergenic
914754907 1:150557140-150557162 ACCCTCAGAATCTCTGTGCAGGG - Exonic
917834744 1:178932464-178932486 ACCCCCTGCACCTCCGTGCAGGG + Intergenic
919471609 1:197986112-197986134 ACCCCCCGTCCCACTGTGTATGG - Intergenic
920088101 1:203432728-203432750 CCCCCCTCAACCAATGTGGAAGG + Intergenic
922095230 1:222437923-222437945 AACCCCTGAACCATAGTGAAAGG + Intergenic
922674965 1:227544267-227544289 ACTGCTGGAACCACTGTGCACGG + Intergenic
1063478062 10:6345988-6346010 ACACACTGAACCACTTTGCTAGG + Intergenic
1063703311 10:8406870-8406892 ACCCACTCACCTACTGTGCATGG + Intergenic
1067226476 10:44379519-44379541 TGCCCCTGAACCACTGTTCTGGG - Intronic
1070620329 10:78004658-78004680 ACCACCGTAGCCACTGTGCACGG + Intronic
1072507284 10:96081019-96081041 ACCACCTTTTCCACTGTGCAAGG + Intergenic
1073262440 10:102200901-102200923 ACCCCCTGCTCCACAGTGCCTGG - Intergenic
1076201636 10:128563611-128563633 ACCCCATTCACCACAGTGCAGGG + Intergenic
1076388149 10:130074206-130074228 TCCCCATCAACCACGGTGCATGG + Intergenic
1076579057 10:131494695-131494717 ACTCCCTGCACCACTGTGTTTGG - Intergenic
1078042607 11:7882650-7882672 ACTGCCAGAACCACAGTGCAAGG - Intergenic
1080850741 11:36067507-36067529 ATCCCCTCAACAACTGAGCAAGG + Intronic
1083264381 11:61539617-61539639 ACCACTTCAACCACTGTGAAGGG + Intronic
1085017802 11:73186594-73186616 ACACTCTGAATCATTGTGCATGG + Intergenic
1085982741 11:81744537-81744559 ACCCCCTGCTGCACTGTGCCCGG - Intergenic
1087045733 11:93842562-93842584 TCACCCTGCACCAGTGTGCAAGG + Intronic
1089859462 11:121575884-121575906 GCCCCCTGATCCTCTGTTCATGG + Intronic
1094368537 12:29710222-29710244 ACAGCCTGAACCACTTTGCCGGG + Intronic
1094807280 12:34106276-34106298 ACTGCTGGAACCACTGTGCACGG - Intergenic
1095580183 12:43788483-43788505 ACCCCTTGCACCAGTGTGCCAGG + Intronic
1097615359 12:61879030-61879052 ACAGCATGAACCACTGTGCCTGG - Intronic
1097866298 12:64561958-64561980 ACGGCATGAGCCACTGTGCATGG + Intergenic
1098526661 12:71494361-71494383 AACCACTGAACCACTGCGCCTGG + Intronic
1101758269 12:107638504-107638526 AGCCCCTGAACCCCTGGGGAAGG + Intronic
1102173583 12:110860215-110860237 ACCCTCTGATCCTCAGTGCAAGG + Intronic
1102595624 12:113990654-113990676 ACACGCTGGGCCACTGTGCAGGG - Intergenic
1103387127 12:120541839-120541861 AACTCTTGAACCACTGTGCCTGG + Intronic
1103749186 12:123147854-123147876 CCTCCCTGACACACTGTGCAGGG - Intronic
1104666805 12:130653402-130653424 ACCCCTTGCACCAGTGTGCCCGG - Intronic
1113842553 13:113368542-113368564 CCGGCATGAACCACTGTGCATGG + Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1117094250 14:52281675-52281697 AGCCCCTGACACACTGTGCCAGG + Intergenic
1117916938 14:60687737-60687759 ACCACCTGAGCCACTGTGATTGG + Intergenic
1121822484 14:96982665-96982687 TCACCCTGAACTACAGTGCATGG - Intergenic
1121903139 14:97712903-97712925 ACCCTCTGAACCACTCAGCAAGG + Intergenic
1125076798 15:35628833-35628855 ACCCTCAAAACAACTGTGCAAGG - Intergenic
1128609165 15:69060075-69060097 GCCCACTGAACCACTTTGCCAGG + Intronic
1128773467 15:70301272-70301294 GACCCCTGAGCCTCTGTGCAAGG + Intergenic
1128780626 15:70356584-70356606 ACCCCCTGAGCCCCTTGGCAGGG - Intergenic
1128896463 15:71378045-71378067 ACAACCTGAACAACTGTACAAGG - Intronic
1129031773 15:72624030-72624052 ACGAACTGACCCACTGTGCATGG + Intergenic
1129877908 15:78988779-78988801 AACCCCTGAACCACAGAGCCGGG - Intronic
1129897144 15:79116963-79116985 AGCACCTGAACAACTGTACATGG - Intergenic
1129897722 15:79121104-79121126 ACAACCTGAATCACTGTACATGG + Intergenic
1130126130 15:81095578-81095600 GGCACCAGAACCACTGTGCAGGG - Intronic
1133302105 16:4788557-4788579 ACGCCCTCAACCACTCTGCTGGG + Exonic
1133679351 16:8106466-8106488 TCACCCTTAACCACTGTGCTAGG - Intergenic
1134202437 16:12210150-12210172 ACACCCTGAACCAGTGTGCCTGG - Intronic
1134634601 16:15782830-15782852 ACCACCTGTCCCACTGTACATGG + Intronic
1138539022 16:57677192-57677214 ACCCCCTGTGCCAATGTGCATGG + Intronic
1139349711 16:66327462-66327484 GCCCGCTGAACCACTCTGCGGGG + Intergenic
1139706461 16:68744276-68744298 TCCCTCTGAACAGCTGTGCAGGG + Intronic
1140315944 16:73896952-73896974 CCTCCCTGAGCCACTGTGCCTGG - Intergenic
1140917618 16:79508152-79508174 AAACCCTGAGCCACTGTGCAGGG + Intergenic
1140957991 16:79885111-79885133 ACTCCATAAACCACTTTGCATGG + Intergenic
1143319096 17:6056435-6056457 GCCCCCTGTACCCCTCTGCATGG + Intronic
1143322252 17:6075791-6075813 TCCCCCTGAAGCACTCTGCAGGG + Intronic
1143514283 17:7411596-7411618 TCCCTCTGGACCACTCTGCAGGG - Intronic
1144832866 17:18141236-18141258 ACAACCTGAGCAACTGTGCATGG - Intronic
1147482652 17:40781704-40781726 ACAGGCTGAACCACTGTGCCTGG + Intronic
1149916442 17:60613946-60613968 ACCCCCTGCTCCACGGTGCCCGG + Intronic
1150568008 17:66360249-66360271 ACCCCCTCAGCCAATGTGAAAGG - Intronic
1153656771 18:7289813-7289835 AGCCCCTGAAACAATGTCCATGG + Intergenic
1156194600 18:34759958-34759980 ACCACTTGAGCCACTGTGCCCGG + Intronic
1157064080 18:44326668-44326690 GCCCCCTGAGCCCCTGTGCAAGG - Intergenic
1157367179 18:47075741-47075763 GCCCACTCAGCCACTGTGCAGGG + Intronic
1158491686 18:57916060-57916082 ACCCCCTGATCCACAGCACATGG - Intergenic
1159538276 18:69742658-69742680 TTTCCCTGTACCACTGTGCAGGG - Intronic
1160929286 19:1562291-1562313 ACCTCGTGATCCACTGTGCCCGG - Intronic
1161081860 19:2314941-2314963 AGCTGCTGAACCACTGTGCCTGG + Intronic
1162690136 19:12423022-12423044 AACCCCTGAGCCATTGTGCTCGG - Intronic
1164564092 19:29313658-29313680 ACCCCCTGAGCCTCTGTGCAGGG + Intergenic
1164578245 19:29418598-29418620 AAGCCCTGAGCCACTGTGGAGGG + Intergenic
1168687868 19:58359151-58359173 ACCCCCAGAAGCACTGGCCAGGG + Intronic
1168715597 19:58525295-58525317 GCCCCCACAACCATTGTGCATGG - Intronic
927983009 2:27386784-27386806 ACCTCGTGATCCACTGTGCCGGG + Intronic
933764261 2:85696147-85696169 TCCCCCAGGATCACTGTGCAAGG - Intronic
933860660 2:86463784-86463806 GACCTCTGAACCACTGTGCCAGG - Intronic
934926403 2:98384727-98384749 ACCCCCAGGACCTCTGTCCATGG - Intronic
935388449 2:102525375-102525397 AGTCCCTGACCCACTGTGGAGGG - Intronic
935657559 2:105438160-105438182 ACCCCCTGTAGCTCTGGGCAGGG + Intronic
935830628 2:106997742-106997764 AACACCTGAAGCACTGTCCACGG + Intergenic
938107349 2:128542192-128542214 AGCCCATGAGCCACTGTGCCTGG + Intergenic
941823930 2:169871486-169871508 GCCCCGTGAGCCACTGTGCCTGG - Intronic
942341883 2:174957709-174957731 ACCTCCTGATCCACTGTGAGGGG + Intronic
943405064 2:187472354-187472376 AGCACCTGAACCAGTGTACATGG - Intronic
944252438 2:197591585-197591607 GCCCCCTGCTCCAGTGTGCACGG - Intronic
946785621 2:223240502-223240524 TCCCCCAGAACCCCTGTCCAAGG - Intergenic
947225316 2:227834274-227834296 AGCCACTGAGCCACTGTGCCTGG + Intergenic
947674606 2:231966453-231966475 AGCCACTGAGCCACTGTGCCTGG + Intronic
947840579 2:233205111-233205133 ACCTCGTGATCCACTGTGCCTGG - Intronic
947933020 2:233979841-233979863 ACAGCCTGTACCACTGTACATGG + Intronic
1170508167 20:17050256-17050278 AGCCTCTGCACCGCTGTGCAGGG - Intergenic
1176165225 20:63669604-63669626 ACCCACTTAACCACTGGGAAGGG + Intronic
1176365517 21:6030301-6030323 ACGCTCTGACCCACTCTGCAGGG - Intergenic
1178306787 21:31497795-31497817 ACCTCATGAGCCACTGTGCTTGG + Intronic
1179280008 21:39925862-39925884 ACTCCCAGAACCACTCTTCAGGG - Intronic
1179758001 21:43508244-43508266 ACGCTCTGACCCACTCTGCAGGG + Intergenic
1181371578 22:22422871-22422893 ACCCAGTGAGCAACTGTGCAGGG - Intergenic
1181453027 22:23036707-23036729 AGGCCCTGGTCCACTGTGCATGG + Intergenic
1182052004 22:27320080-27320102 ACCCACTGAATCCATGTGCATGG - Intergenic
1182520054 22:30880132-30880154 TCTCCCTGAACCCCTCTGCATGG - Intronic
1183811791 22:40263803-40263825 ACCCACTGAGCCACTGAGCTAGG - Intronic
1184907289 22:47497445-47497467 CTCCCCTGAGGCACTGTGCATGG - Intergenic
1184920232 22:47600688-47600710 CCCCCCTCAGCCTCTGTGCACGG + Intergenic
1184920313 22:47601004-47601026 CCCCCCTCAGCCTCTGTGCACGG + Intergenic
950450376 3:13061835-13061857 GCCCCCCGAACCACTGGGCTGGG - Intronic
952957431 3:38565772-38565794 AGCCCCTGAGCCAGTGTTCATGG + Intronic
957515623 3:81247269-81247291 AGCCCCTGCACCTATGTGCATGG + Intergenic
957909309 3:86601946-86601968 ACACACTGAACAACTGAGCAAGG - Intergenic
958634400 3:96724571-96724593 ATCCTCTTAACCACTGGGCATGG - Intergenic
959638699 3:108606209-108606231 GCCCACTGAACCACTCAGCAGGG - Intronic
959786730 3:110308088-110308110 ACTCTCTTAACCACTATGCAGGG + Intergenic
962959444 3:140296944-140296966 AGCCTCTGCACCACTGTGCTGGG + Intronic
965485693 3:169275652-169275674 ACACCCTGAACCTGTGAGCATGG - Intronic
967148656 3:186628000-186628022 CCCACCTGCACCACTGTGCAGGG + Intergenic
967303793 3:188041689-188041711 ACCTCCTGTATGACTGTGCAGGG - Intergenic
968638576 4:1697189-1697211 ACAGCGTGAACCACTGTGCCCGG - Intronic
972074979 4:35076089-35076111 ACAGCCTGAACCACTGTGCTTGG - Intergenic
973545781 4:51980502-51980524 ACACCCTGGACCACTGTAGAGGG + Intergenic
976840611 4:89428547-89428569 ACAGCTTGAACCACTGTGCCTGG - Intergenic
977835301 4:101638601-101638623 AGCCTGTGAGCCACTGTGCATGG + Intronic
983072057 4:163279708-163279730 ACAGCATGCACCACTGTGCATGG - Intergenic
985181493 4:187269063-187269085 ACCTTCTAAACCACAGTGCACGG - Intergenic
987391880 5:17384291-17384313 GCCCACTGAGCCACTATGCAGGG + Intergenic
987807315 5:22785851-22785873 ACCCCCTAAAACAGTGTGTAAGG - Intronic
988380730 5:30494284-30494306 ACCCCCAGCACCACAGGGCAGGG - Intergenic
990267804 5:54097081-54097103 ACCTCATGAGCCACTGTGCCCGG - Intronic
991614670 5:68483635-68483657 ACTCCCTGCACCACTGTTTATGG - Intergenic
991961652 5:72050831-72050853 ACCCCCTGGACCACTGCACCTGG + Intergenic
998047899 5:139004353-139004375 TTCTCCTGAATCACTGTGCATGG + Intronic
1001254949 5:170176356-170176378 CACACCTGAACCACTGTGCTGGG - Intergenic
1004643714 6:17539629-17539651 ACCCCCTGAGCCCGTCTGCATGG - Intronic
1004938210 6:20528816-20528838 CAGCCCTGAACCACTGTGCCTGG - Intergenic
1005220183 6:23577703-23577725 ACATCCTAAACAACTGTGCATGG + Intergenic
1006518712 6:34559056-34559078 ACCCCCTGATCCACCGGGCATGG + Intergenic
1006980088 6:38140643-38140665 ACCCCATGAACAGCTGGGCATGG - Intronic
1009552478 6:65116908-65116930 AGCCCCTAAACCACTGAGGAAGG - Intronic
1012145070 6:95670373-95670395 ACCCCCTGCTCCACGGTGCCCGG + Intergenic
1012738435 6:102981142-102981164 AGCACATGAACCACTGTGCTAGG + Intergenic
1016808799 6:148239444-148239466 ACCAGCTGAACCTCTGTGAAAGG + Intergenic
1017497918 6:154997353-154997375 ACAGCCTGAACAACTGTGCAAGG - Intronic
1019068707 6:169324167-169324189 ATCACCAGAACCACCGTGCACGG + Intergenic
1019641038 7:2103765-2103787 ACCCCCTGAACCACTGTGCACGG + Intronic
1020365043 7:7372062-7372084 ACCTCGTGATCCACTGTGCCTGG + Intronic
1022316221 7:29247723-29247745 ACCGCCTGATCCACTGGGAAAGG + Intronic
1022481242 7:30744407-30744429 ACACCCTGCCCAACTGTGCATGG + Intronic
1024774018 7:52761344-52761366 AGCCTCTGAACCACTGTGTCTGG + Intergenic
1025927898 7:65973948-65973970 CACCCATGAACCACTGTGCTGGG - Intronic
1025990505 7:66493412-66493434 ACCCACAGAAACACTGTGCTGGG + Intergenic
1027213167 7:76166425-76166447 ACCCACAGAAACACTGTGCTGGG + Intergenic
1031646770 7:124235679-124235701 ACAGCATGAACCACTGTGCCCGG + Intergenic
1031963826 7:128013009-128013031 ACCCCCTGCACCTCTGTAGAAGG + Intronic
1032277855 7:130475397-130475419 AAACCCTTAACCACTTTGCAGGG + Intergenic
1032410623 7:131691326-131691348 TCCCCGTGAGCCACTGTGCCCGG + Intergenic
1033171140 7:139085714-139085736 CCAGCCTGAACCACTGTGCCTGG - Intronic
1033390027 7:140918270-140918292 ACCCCCTCTACCCCTGTCCATGG - Intronic
1035242295 7:157540083-157540105 AGCCCCTGAATCACTCTGCTTGG + Exonic
1035718127 8:1769554-1769576 CCCCCCTCACCCAGTGTGCAGGG - Intronic
1036989738 8:13578922-13578944 ACCCCCTCAACCTCTGGGGAGGG - Intergenic
1037981478 8:23257587-23257609 TCCCCCTGAATGACTGTACAAGG + Intronic
1039051225 8:33495945-33495967 ACCTCGTGAGCCACTGTGCCTGG + Intronic
1040423944 8:47265465-47265487 ACAGCGTGAACCACTGTGCCTGG + Intronic
1047230604 8:122995179-122995201 AAACCCTCATCCACTGTGCAGGG - Intergenic
1048327408 8:133450262-133450284 ACCCCCGGAATCACTGTTCCCGG + Intergenic
1048460035 8:134613939-134613961 AGCCCTTGAACCATTGTGCCTGG + Intronic
1049774292 8:144397454-144397476 ACCCGCTGGGCCACAGTGCAGGG + Intronic
1050891438 9:10829591-10829613 AACCCCTGTAGCCCTGTGCAGGG + Intergenic
1051279241 9:15424925-15424947 AACACCTGGAGCACTGTGCAAGG + Intronic
1053075219 9:35127304-35127326 AGCCCCTGACACACTGTGCCAGG + Intergenic
1055207544 9:73751127-73751149 ACCCCCTGCACCACAGAACATGG - Intergenic
1056156145 9:83839660-83839682 ACCCACTGAACCACCGGGCACGG + Intronic
1056354389 9:85783913-85783935 ACCCACTGAACCGCTGGGCACGG - Intergenic
1056782825 9:89564174-89564196 ACCACATGAACCACTGTGCGGGG - Intergenic
1056848506 9:90060468-90060490 ACCTCCTGAAGCTCTGTTCAAGG - Intergenic
1057810048 9:98250666-98250688 ACCCCCTGGACCTCTGTACCTGG - Intronic
1062146165 9:134991063-134991085 GCCCCCTGCTCCACTGTGCCCGG - Intergenic
1188012751 X:25075040-25075062 TGCTCATGAACCACTGTGCAGGG + Intergenic
1189607737 X:42697843-42697865 TCCTCCTGCACCAGTGTGCAGGG + Intergenic
1194001350 X:88433361-88433383 ACCCCCACATCCTCTGTGCAGGG - Intergenic
1195016418 X:100786163-100786185 AGCCCCTGACACACTGTGCCAGG + Intergenic
1196598710 X:117575683-117575705 ACCTCATGAGCCACTGTGCCTGG + Intergenic
1198060962 X:133044709-133044731 ACCCCCTGCTCCACAGTGCCTGG + Intronic
1198232722 X:134707488-134707510 ACCCCGTGAGCCACTGTGCCTGG - Intronic
1202126379 Y:21572437-21572459 GTCCTCTTAACCACTGTGCAGGG - Intergenic
1202152620 Y:21856967-21856989 ATCCTCTTAATCACTGTGCAGGG + Intergenic