ID: 1019641681

View in Genome Browser
Species Human (GRCh38)
Location 7:2106775-2106797
Sequence GGACTCATGACAGCTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019641681_1019641688 3 Left 1019641681 7:2106775-2106797 CCCTCCCCAGCTGTCATGAGTCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1019641688 7:2106801-2106823 CTGCAGCCGGCTCTCTCAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 168
1019641681_1019641689 4 Left 1019641681 7:2106775-2106797 CCCTCCCCAGCTGTCATGAGTCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1019641689 7:2106802-2106824 TGCAGCCGGCTCTCTCAGCTGGG No data
1019641681_1019641692 29 Left 1019641681 7:2106775-2106797 CCCTCCCCAGCTGTCATGAGTCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1019641692 7:2106827-2106849 CCAGTCACCCTTCAGCCCCCAGG No data
1019641681_1019641686 -10 Left 1019641681 7:2106775-2106797 CCCTCCCCAGCTGTCATGAGTCC 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1019641686 7:2106788-2106810 TCATGAGTCCATGCTGCAGCCGG 0: 1
1: 0
2: 1
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019641681 Original CRISPR GGACTCATGACAGCTGGGGA GGG (reversed) Intronic
900026752 1:280579-280601 CCACTCATGACAGAAGGGGAAGG - Intergenic
900151140 1:1179842-1179864 GGACTGCTTACATCTGGGGAGGG - Intronic
900373312 1:2342038-2342060 GCACTCCTGAGAGCTGGGGAGGG - Intronic
900636492 1:3668718-3668740 AGAGTGATGAGAGCTGGGGACGG + Intronic
900702928 1:4059134-4059156 GGACTCATGGGCCCTGGGGAGGG + Intergenic
901490407 1:9593685-9593707 GGACCAATGACAGCTGAGCAGGG - Intronic
901884649 1:12214576-12214598 GGACTCCTGACAGCCAGGCAAGG - Intergenic
902531449 1:17093453-17093475 GGACTCAGGCCTCCTGGGGATGG - Intronic
902608862 1:17585427-17585449 TGCTTCATGACACCTGGGGAAGG + Intronic
902837115 1:19054356-19054378 GGACTCATGGCAGGCGGGGCTGG + Intergenic
902997586 1:20238749-20238771 GGAGTGATGGCAGCTGGGAAGGG + Intergenic
903559677 1:24217962-24217984 GCACTCCTGACATTTGGGGAGGG + Intergenic
904471282 1:30737952-30737974 TGACACCTGCCAGCTGGGGATGG - Intronic
906313025 1:44767318-44767340 GGGCCCAGGGCAGCTGGGGAGGG + Exonic
906594423 1:47062476-47062498 AGACTCATTGCAGCTGGGGAGGG + Intergenic
907925219 1:58949617-58949639 AGATTTATGACAGCGGGGGAAGG - Intergenic
912391574 1:109306823-109306845 TGACCCATGGCAGGTGGGGAGGG - Intronic
912543590 1:110434986-110435008 GGACTCCAGTCAGCTGGTGAAGG + Intergenic
913971842 1:143422503-143422525 GGGCTCAGGACAGCTGGGCGGGG - Intergenic
914066221 1:144248116-144248138 GGGCTCAGGACAGCTGGGCGGGG - Intergenic
914112932 1:144718238-144718260 GGGCTCAGGACAGCTGGGCGGGG + Intergenic
914336130 1:146716498-146716520 GGCAGCATGACAGCTGAGGATGG - Intergenic
915503814 1:156339322-156339344 AGACTCAGGACAGCGGGAGAGGG - Intronic
921688888 1:218124245-218124267 GCATTCATGGCTGCTGGGGAAGG - Intergenic
923429920 1:233910040-233910062 GGAATCATGCCAGCTGCAGAAGG - Intronic
1063125611 10:3134187-3134209 GAACTCATCTGAGCTGGGGATGG - Intronic
1063806526 10:9649933-9649955 GGACTCATGACAGCTACTGTAGG - Intergenic
1064112708 10:12552421-12552443 GGACTCTTCCCAGCTGGGTAAGG - Intronic
1066495084 10:35934772-35934794 AGACACATAACAGGTGGGGAGGG + Intergenic
1067933129 10:50583391-50583413 GAACTGATGATAGCTGGGAATGG - Intronic
1069323690 10:67204863-67204885 GGCCACATGACAGATGGGCAGGG + Intronic
1070153135 10:73817614-73817636 GGACTCCTGAGGACTGGGGAGGG - Intronic
1071261874 10:83927410-83927432 GGTCTCATGACAGCTGCCGTTGG + Intergenic
1072535435 10:96359308-96359330 GGACTCCCGTCAGCTGGGGATGG - Intronic
1073595542 10:104796004-104796026 AGACACATGACAGCTCAGGAAGG - Intronic
1074002901 10:109390157-109390179 GGACTTCTGACAACTGGGGCTGG + Intergenic
1074769221 10:116722643-116722665 AGACTGATGACAGCTGGGTAGGG - Intronic
1075017950 10:118924718-118924740 GGACTCTAGTCATCTGGGGAGGG - Intergenic
1075997463 10:126890205-126890227 AGACTCACTGCAGCTGGGGAAGG - Intergenic
1076406006 10:130212905-130212927 AGATTTATGACAGCTGGGAAAGG - Intergenic
1076414001 10:130271902-130271924 GCACTAATGACAGCTTTGGAGGG - Intergenic
1076659619 10:132046993-132047015 TGACTCAGGAGAGCTGGGGCAGG - Intergenic
1076668561 10:132106456-132106478 GGACTCATGGCAGGAGGGGGAGG - Intronic
1076898977 10:133327854-133327876 GGACTCAGGACAGGAGGAGAAGG - Intronic
1076915567 10:133421736-133421758 GAACCCAGGCCAGCTGGGGAAGG + Exonic
1077033271 11:480082-480104 TGACCCCTGACAGCTGGTGAGGG + Intronic
1077090585 11:776769-776791 GGTCTCAGGGCAGCAGGGGAGGG - Intronic
1077340868 11:2025778-2025800 TGACCCATGACGGCTGTGGAGGG + Intergenic
1077438065 11:2554005-2554027 CGCATCATGACAGCTGGGCATGG - Intronic
1078846810 11:15125918-15125940 TGAGTCTTGACAGGTGGGGAGGG + Intronic
1079102883 11:17552527-17552549 GGACACAGGACAGGTGGGGGAGG - Intronic
1079335318 11:19565525-19565547 GGAGTCAGGACATCTGAGGAAGG + Intronic
1080437656 11:32261169-32261191 TGACTGATGACAGTTGGGGGAGG - Intergenic
1083902368 11:65649874-65649896 GGACCCAGGAGAGCAGGGGAGGG + Intronic
1084119373 11:67059964-67059986 GGATTCAGGGCAGCAGGGGAGGG + Intronic
1084959382 11:72708349-72708371 CCACTCATGCCAGCTGGGGGAGG + Intronic
1085225520 11:74917075-74917097 GGGCTTATGACAGTTGTGGATGG + Intronic
1085637896 11:78172255-78172277 GGACACAGGACTGCAGGGGAAGG + Exonic
1086147502 11:83568778-83568800 GAACTCATGACAACCTGGGAGGG - Intronic
1086543248 11:87938245-87938267 GGACTCATTACTGCTGGGCAGGG + Intergenic
1086908522 11:92445322-92445344 GGAATCATGATCTCTGGGGATGG + Intronic
1087911054 11:103753820-103753842 TTACCCATAACAGCTGGGGAGGG + Intergenic
1088271019 11:108034592-108034614 GGACTCATGGCAGCTTGGAAAGG + Intronic
1202823853 11_KI270721v1_random:80967-80989 TGACCCATGACGGCTGTGGAGGG + Intergenic
1091585894 12:1816456-1816478 GGACCCAGGTCAGCTGGGGCAGG - Intronic
1091698088 12:2641458-2641480 GGTCTCAGGACAGCTGGGTGGGG + Intronic
1091793079 12:3282655-3282677 GGACTCAGGCCAGCCGGGCACGG - Intronic
1092178154 12:6425148-6425170 TCAATCATGGCAGCTGGGGAAGG - Intergenic
1096475382 12:51906535-51906557 TGACACAAGGCAGCTGGGGAGGG - Intergenic
1096567831 12:52496129-52496151 GGACTCATGAGAGGTGATGAAGG + Intergenic
1102234100 12:111283446-111283468 TGACTCGTGGCAGCTGTGGAAGG - Intronic
1104694316 12:130852039-130852061 GGACCCAAGACAGATGGGAATGG + Intergenic
1104748464 12:131224063-131224085 AGACACAGGACAGCTGGGGAAGG + Intergenic
1105885537 13:24638219-24638241 GGTCTCCTGTCAGTTGGGGATGG - Intergenic
1106507152 13:30381073-30381095 GCAATGATGACAGCTAGGGATGG + Intergenic
1107114669 13:36733932-36733954 GTACTCATGACAGAAGGTGAAGG - Intergenic
1108494077 13:51007247-51007269 GGACACACAACAGCAGGGGAGGG + Intergenic
1111889433 13:94063203-94063225 TGTCTCATGGCAGCTGGGCAGGG - Intronic
1113698756 13:112367000-112367022 GGCCTCATGACTGCTGGGGGGGG - Intergenic
1117667392 14:58070839-58070861 GGATTCAAGGGAGCTGGGGATGG - Intronic
1118419248 14:65582500-65582522 ATACTTAGGACAGCTGGGGATGG - Intronic
1118430181 14:65710882-65710904 GCACTCATGGCAGATGGTGAAGG + Intronic
1122081181 14:99268971-99268993 GGACTGGTGGCAGCTGGGCATGG - Intronic
1122113080 14:99515086-99515108 GGACCCATGGCAGCTGGGCCAGG + Exonic
1122855899 14:104559943-104559965 CCACTCTTGACAGATGGGGAAGG + Intronic
1122906502 14:104804045-104804067 GGTCTCGAGACAGCTGGGGGAGG + Exonic
1123164603 14:106314541-106314563 GGACTCACGACCACTGGGGAAGG - Intergenic
1126450581 15:48804115-48804137 GGACTGTGGCCAGCTGGGGAAGG + Intronic
1128535167 15:68485003-68485025 ACCTTCATGACAGCTGGGGAAGG + Intergenic
1129175465 15:73836867-73836889 GGCCTCATTGCAGCTGGGGGTGG - Intergenic
1129742327 15:77995347-77995369 AGACTGCTGACAGCTGGAGACGG - Exonic
1129754108 15:78085595-78085617 TTGCTCATGACAGCTGGAGAAGG - Intronic
1130381539 15:83376288-83376310 GGCCTCTTGTCAGCTGGTGATGG - Intergenic
1130608654 15:85340357-85340379 GGACTCCTGTCATCTGGGGGAGG + Intergenic
1131075350 15:89492101-89492123 GGAGTCACCAAAGCTGGGGAGGG - Intronic
1134425640 16:14141510-14141532 GGACTCATCAGAACTGTGGAAGG - Intronic
1137543036 16:49377797-49377819 GGCCTCATGACAGCACGGGGAGG + Exonic
1140874508 16:79138214-79138236 GGAGTCATTCCAGTTGGGGAAGG + Intronic
1141566787 16:84907763-84907785 GGCCTCATGACAGCGAGAGATGG + Exonic
1141611214 16:85182163-85182185 GGACTCCTGGCAGCGGGGGGCGG - Intronic
1142066953 16:88068190-88068212 GGGCTCCTGAGAGCTGGGGATGG + Intronic
1144082817 17:11780239-11780261 GGAAACCTGAGAGCTGGGGAGGG + Intronic
1144357698 17:14461709-14461731 GAACACACGACAGCAGGGGATGG - Intergenic
1144698241 17:17320410-17320432 GGACCCATAAGACCTGGGGATGG + Intronic
1144811225 17:18000680-18000702 GGCCTGATGACGGCTGTGGAAGG - Intronic
1145996628 17:29108576-29108598 GGACTCCTGACAGCTAGCCAAGG + Intronic
1147316713 17:39624424-39624446 GGACTCCTGAGAGCTGGAGGAGG - Intergenic
1147640902 17:41998893-41998915 GAAGTTATCACAGCTGGGGATGG + Intronic
1149481864 17:57009966-57009988 GGACTCATGAATCCTGGGTATGG - Intergenic
1150565022 17:66331137-66331159 GGACTCATGTTATCAGGGGAAGG + Intronic
1151727177 17:75891971-75891993 GGACCCAGGACAGCAGGGGGAGG + Intronic
1152073303 17:78144710-78144732 GGACTCATGCCAGCTGGGAGAGG + Intergenic
1152401798 17:80070934-80070956 GGACTTCTGGCTGCTGGGGAGGG - Intronic
1155315412 18:24566342-24566364 GAATGCATGACAGCAGGGGAAGG - Intergenic
1157712426 18:49859142-49859164 GGGCTCATTACAGGTGGGGCTGG - Intronic
1159462553 18:68739401-68739423 GGCATCATGGCAGCAGGGGATGG - Intronic
1160158157 18:76449372-76449394 AGCCTCATGACAGGTGGGGCAGG - Intronic
1160995670 19:1881002-1881024 CCACCCATGCCAGCTGGGGATGG + Exonic
1161114440 19:2488919-2488941 GGACTCCTGCCTGCTAGGGAGGG - Intergenic
1161273448 19:3403207-3403229 GGCCACATGAAAGCTTGGGAAGG + Intronic
1161650886 19:5484168-5484190 GAACACATGACAGCAGGGGCTGG - Intergenic
1165132798 19:33643410-33643432 GGGCTCAGGAGAGCTGGGGAGGG - Intronic
1166248176 19:41545907-41545929 AGACTCCAGACAGGTGGGGAAGG - Intergenic
1166285864 19:41827848-41827870 GTGCTCAGGACAGCTGTGGAAGG + Intergenic
1166734775 19:45077566-45077588 GGGCTGAGGACAGCTGGGGGAGG - Intergenic
1167791867 19:51688366-51688388 GGAATCCTGGCAGCTGGAGACGG - Intergenic
926051208 2:9746003-9746025 GGGCTCAGGACCGCTGGGGGTGG + Intergenic
927202950 2:20589816-20589838 AGACTCCTCACAGCTGGGGGCGG + Intronic
927488096 2:23502932-23502954 GGACTCAGGTCTGTTGGGGATGG + Intronic
927571330 2:24163347-24163369 AAACAGATGACAGCTGGGGAGGG + Intronic
928049116 2:27969865-27969887 GGACTACTGACATTTGGGGATGG - Intronic
929876815 2:45803674-45803696 GTACTCATTACCGCTGAGGATGG - Intronic
932797379 2:74708465-74708487 TGTCTCATTACAGCTGGTGAGGG - Intergenic
934176532 2:89583435-89583457 GGGCTCAGGACAGCTGGGTGGGG - Intergenic
934286842 2:91657796-91657818 GGGCTCAGGACAGCTGGGTGGGG - Intergenic
934766175 2:96881384-96881406 TCACTGAGGACAGCTGGGGAAGG + Intronic
935816834 2:106853618-106853640 AGACTCATGTGAGCTGGGGCTGG + Intronic
936073601 2:109387536-109387558 GGCCCCATCACATCTGGGGAAGG - Intronic
936247227 2:110838847-110838869 GGGCACACGACAACTGGGGAGGG - Intronic
943038895 2:182780290-182780312 GAACTCATTACCACTGGGGAAGG - Exonic
947481452 2:230504109-230504131 GCTCTCAAGACAGGTGGGGAGGG + Intronic
1170546566 20:17439897-17439919 GGACCCGTGACAGCTGTGGTTGG - Intronic
1173393076 20:42652544-42652566 GGACTCATGAGTGAAGGGGAGGG - Intronic
1175033745 20:55980207-55980229 GGACTCAGGAAGGTTGGGGAGGG - Intergenic
1176410472 21:6447097-6447119 TGCCTCATGACAGCTGGTGTAGG - Intergenic
1179088823 21:38244718-38244740 GGACTCAAGTAAGTTGGGGAGGG + Intronic
1179457833 21:41511675-41511697 GGAAGCATGACAGCTGGTCATGG + Intronic
1179558181 21:42193954-42193976 GTGTTCATGACAGATGGGGAGGG + Intergenic
1179685965 21:43055419-43055441 TGCCTCATGACAGCTGGTGTAGG - Intronic
1180067824 21:45421352-45421374 GGCCTCAGGAGAGCTGGGAAGGG + Intronic
1180920369 22:19518527-19518549 GGGTTCATGCCAGCTGGGGTGGG + Intronic
1183742137 22:39674662-39674684 GCAGTCAAGACAGCGGGGGAGGG - Intronic
1184411193 22:44327455-44327477 GGGCTCATGATAACTGGGGTGGG + Intergenic
1184453439 22:44596296-44596318 GGGCTCATGTCAGATGGTGACGG - Intergenic
1184988383 22:48151573-48151595 TAACTCAAGAAAGCTGGGGAGGG + Intergenic
949815546 3:8054182-8054204 GGCCTCCTTTCAGCTGGGGATGG + Intergenic
950265539 3:11570266-11570288 GGCCTCCTGGCAGCTTGGGATGG - Intronic
950290357 3:11779190-11779212 CCACTCATGGCAGATGGGGAAGG - Intergenic
950375653 3:12570135-12570157 GGACTGTGGAAAGCTGGGGAGGG - Exonic
953407635 3:42667312-42667334 GGTCTCAGGCCAGCTGGCGATGG + Intergenic
955740887 3:62090794-62090816 GGACTCTTAGCATCTGGGGAAGG - Intronic
959445874 3:106438691-106438713 TCACTCATGAAAGGTGGGGAGGG + Intergenic
960575217 3:119222533-119222555 TGACACGTTACAGCTGGGGAAGG - Intronic
960812043 3:121634920-121634942 GGACACAAGTCAGCTGGGCATGG - Intronic
961739039 3:129020966-129020988 GGCCTCATGAGAGCTGGGAGGGG + Intronic
966911006 3:184560088-184560110 GAAATCAAGATAGCTGGGGAAGG + Intronic
967144493 3:186594999-186595021 GAACTCATGAGAGCTGTGCATGG + Intronic
968922360 4:3528900-3528922 GGACGCTTGAGAGCTGGGGTGGG + Intronic
971533939 4:27724289-27724311 GGACTCATGCCATTTGAGGATGG + Intergenic
975358224 4:73433315-73433337 GAACTCATGACATCTTTGGAGGG - Intronic
975998508 4:80343497-80343519 GAACTCAAGACGGCTGGGCATGG + Intronic
977591560 4:98832946-98832968 GGACTCATAACATGTGGGCAAGG + Intergenic
978245702 4:106569965-106569987 GGCCTCATTCCAGCTGGCGATGG + Intergenic
979511818 4:121562962-121562984 AGACTCTTGGCAGCTGGTGATGG - Intergenic
979790034 4:124768205-124768227 GGGCTCATGGCAGAAGGGGAAGG + Intergenic
981958857 4:150511202-150511224 GGACTAATGACAGCTGTTGAGGG - Intronic
985533610 5:448590-448612 GGGCACGTGACGGCTGGGGATGG - Intronic
985559165 5:573773-573795 GTACTCCTGACAGCTCTGGAAGG + Intergenic
985789018 5:1915493-1915515 GTAGTCAGGACAGCAGGGGATGG + Intergenic
986242414 5:5972918-5972940 GGACTCACCAAAGCAGGGGAAGG + Intergenic
989355583 5:40540133-40540155 GAACTAATGGCAGCTGGGCATGG - Intergenic
993589091 5:89771680-89771702 ACACTAATGGCAGCTGGGGATGG - Intergenic
994879015 5:105461972-105461994 GGCCTCATGACAGAAGGTGAAGG + Intergenic
995540655 5:113183027-113183049 GGAAGAATGAGAGCTGGGGAGGG + Intronic
995995366 5:118291808-118291830 GTACACATGTCAGCTGGGGTTGG + Intergenic
996761386 5:126989501-126989523 AGATTCATGGCATCTGGGGAGGG - Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
997653921 5:135541781-135541803 TGACCCATGACAGTTGTGGAAGG + Intergenic
998003218 5:138640605-138640627 GGGCAGAAGACAGCTGGGGACGG - Intronic
1000373646 5:160560012-160560034 TGCCTCCTGACAGTTGGGGAGGG + Intergenic
1001381825 5:171310628-171310650 GGGCTCACGAAAGATGGGGATGG - Intronic
1001529620 5:172453321-172453343 GGCCTCATTACAGCAGGGAAGGG - Intronic
1001669127 5:173459405-173459427 GGATCCCTGACAGCTGGGGATGG + Intergenic
1001809883 5:174619502-174619524 TGACAGATGACTGCTGGGGAGGG + Intergenic
1002368818 5:178733530-178733552 GGAGACATCTCAGCTGGGGAGGG + Intergenic
1002532030 5:179852952-179852974 GGAATCAGGGCAGCCGGGGAAGG - Intronic
1007235555 6:40389118-40389140 ACAGTCAGGACAGCTGGGGATGG + Intergenic
1007641448 6:43343279-43343301 AAAATCATGACAGCTAGGGAGGG + Intronic
1009841595 6:69083733-69083755 TGGCTCATGAAAGCTGGAGATGG - Intronic
1010149438 6:72713306-72713328 GAACTTATGACGGCTGGGGAAGG - Intronic
1011220823 6:85052879-85052901 CCACTCATGACAGAGGGGGAAGG + Intergenic
1011419518 6:87156203-87156225 GGACGGATGAAAGCAGGGGAAGG - Intronic
1015130246 6:129801561-129801583 GGAGTCATTACAGCTGGGGAGGG + Intergenic
1015487151 6:133785889-133785911 TCACTCATGAAAGTTGGGGATGG - Intergenic
1018674179 6:166205016-166205038 GGAATGATGGCAGCTGGGGCTGG - Intergenic
1018710511 6:166495329-166495351 TGTCTCGTGACAGCTGGGGAAGG - Intronic
1019639158 7:2093935-2093957 GAACTCATGACAGCAAGGCAGGG + Intronic
1019641681 7:2106775-2106797 GGACTCATGACAGCTGGGGAGGG - Intronic
1019963742 7:4482568-4482590 GGATTCAGGACAGCTTGGTAAGG + Intergenic
1023348571 7:39296570-39296592 GGAGTCAGGAGACCTGGGGAAGG - Intronic
1023542464 7:41280473-41280495 ACACTCATGGCAGCTGGGGATGG - Intergenic
1024300612 7:47884817-47884839 TCACTCATGACAGCTGGGCAAGG + Intronic
1025016669 7:55444626-55444648 GAACACATGGGAGCTGGGGAGGG - Intronic
1026551564 7:71373351-71373373 TGACTCAGGTCAGCTGGTGAAGG + Intronic
1026584588 7:71646051-71646073 GGACTGATGGAACCTGGGGAGGG - Intronic
1027245584 7:76364970-76364992 TGACTCATCACAGCTGGGTGGGG - Intergenic
1027684052 7:81259324-81259346 GCACTCATGACAAAAGGGGAGGG + Intergenic
1029375384 7:100174242-100174264 GAGCCCATCACAGCTGGGGAGGG + Intronic
1029620044 7:101684676-101684698 GGAATGATGACACCTGGGGACGG + Intergenic
1029716404 7:102329638-102329660 GGACTGCTCACGGCTGGGGATGG - Intergenic
1029723034 7:102382845-102382867 GGACTGCTCACGGCTGGGGATGG - Intronic
1036970032 8:13345242-13345264 GAATACATGACAGTTGGGGAAGG - Intronic
1038128297 8:24699133-24699155 GGAATCAGGAAAGCTGGAGAGGG + Intergenic
1038634025 8:29271085-29271107 TGACTAATGACAGGTGGAGAAGG - Intergenic
1039616037 8:38955733-38955755 GGACTGATCACAGGTGGGGTTGG - Intronic
1039959888 8:42238182-42238204 GGACTCATTACTGCTAGGCAGGG - Intergenic
1040404381 8:47086059-47086081 GGAAGCAAGACAGCTGGGGTGGG + Intergenic
1041776700 8:61530467-61530489 GGATTCAGGAGAGCTGGGGCAGG - Intronic
1041875189 8:62679614-62679636 GGAATCATGACAGAAGGTGAAGG + Intronic
1042387669 8:68196676-68196698 GATCTCATGAAAACTGGGGATGG - Intronic
1044845241 8:96373805-96373827 TGGCTGATGCCAGCTGGGGAAGG + Intergenic
1045153289 8:99434818-99434840 GGAATCATGACAGCTGAGACTGG - Intronic
1046898063 8:119494553-119494575 ATACTCACAACAGCTGGGGATGG + Intergenic
1047648048 8:126889624-126889646 GGACTCATGGCATGTGGGGTGGG + Intergenic
1047792322 8:128216880-128216902 GAACTCATGACAGCAGGGACAGG + Intergenic
1053173199 9:35905351-35905373 GCACTCATCACTGCTGGGCAGGG + Intergenic
1055250904 9:74304127-74304149 GGACACTTGACAGTTGGGGTGGG + Intergenic
1055405452 9:75969054-75969076 GGCATCATCACAGCTGAGGATGG + Intronic
1056841950 9:90004859-90004881 AGACTCCTTCCAGCTGGGGAAGG - Intergenic
1057308834 9:93928640-93928662 GGACCTGAGACAGCTGGGGAGGG + Intergenic
1059485911 9:114626700-114626722 GGCATCATGACATCTGGAGAAGG - Intronic
1060544200 9:124450839-124450861 GGCCTCATGCCACCTGGTGACGG - Intergenic
1060785967 9:126451739-126451761 GGACTCATGTCATCTGGAGGGGG + Intronic
1061495840 9:130973744-130973766 GCACCCATGACAGCTGGGGCAGG - Intergenic
1061882096 9:133573720-133573742 GGACTCATGGCCGCCTGGGAAGG + Intronic
1185695189 X:2188750-2188772 GGAATCATCACAGCAAGGGAGGG + Intergenic
1186210534 X:7245796-7245818 AGTCACATGAAAGCTGGGGATGG + Intronic
1187533230 X:20115315-20115337 GTACTCATGAGAGGTGGGGAGGG - Intronic
1188556447 X:31417560-31417582 GTACTAATGACTGCAGGGGAGGG + Intronic
1189035600 X:37491707-37491729 GGACTTCTGACAGGTGGGGGTGG - Intronic
1189998416 X:46661500-46661522 GGACTCACCACATCTGTGGAAGG + Intronic
1192029642 X:67495492-67495514 GGAATCATGGCAGAAGGGGAAGG - Intergenic
1197767963 X:130071300-130071322 GGACTCAGGTGAGGTGGGGAGGG - Intronic
1200267141 X:154652734-154652756 GGAATCAAGACAGCTGGGTGGGG - Intronic