ID: 1019643421

View in Genome Browser
Species Human (GRCh38)
Location 7:2116550-2116572
Sequence GTGGCAGGCCAGAGGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 464}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019643411_1019643421 1 Left 1019643411 7:2116526-2116548 CCTGGATAAGGCAGGTACCCACA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG 0: 1
1: 0
2: 0
3: 45
4: 464
1019643407_1019643421 16 Left 1019643407 7:2116511-2116533 CCCAGGTGGGCAGGGCCTGGATA 0: 1
1: 0
2: 5
3: 34
4: 290
Right 1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG 0: 1
1: 0
2: 0
3: 45
4: 464
1019643400_1019643421 28 Left 1019643400 7:2116499-2116521 CCCCAGCAAGACCCCAGGTGGGC 0: 1
1: 0
2: 1
3: 29
4: 235
Right 1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG 0: 1
1: 0
2: 0
3: 45
4: 464
1019643401_1019643421 27 Left 1019643401 7:2116500-2116522 CCCAGCAAGACCCCAGGTGGGCA 0: 1
1: 0
2: 2
3: 22
4: 175
Right 1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG 0: 1
1: 0
2: 0
3: 45
4: 464
1019643406_1019643421 17 Left 1019643406 7:2116510-2116532 CCCCAGGTGGGCAGGGCCTGGAT 0: 1
1: 0
2: 7
3: 40
4: 346
Right 1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG 0: 1
1: 0
2: 0
3: 45
4: 464
1019643402_1019643421 26 Left 1019643402 7:2116501-2116523 CCAGCAAGACCCCAGGTGGGCAG 0: 1
1: 0
2: 7
3: 28
4: 248
Right 1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG 0: 1
1: 0
2: 0
3: 45
4: 464
1019643408_1019643421 15 Left 1019643408 7:2116512-2116534 CCAGGTGGGCAGGGCCTGGATAA 0: 1
1: 0
2: 3
3: 28
4: 349
Right 1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG 0: 1
1: 0
2: 0
3: 45
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019643421 Original CRISPR GTGGCAGGCCAGAGGGTTGG GGG Intronic
900120682 1:1047475-1047497 GAGGAAGGCCAGTGGGTAGGTGG - Intronic
900176209 1:1292521-1292543 GCAGCAGGCAAGAGAGTTGGGGG + Exonic
900348750 1:2224893-2224915 TTGGCAGGGAAGAGGGTGGGGGG - Intergenic
900598181 1:3491803-3491825 TGGGCTGGCCAGAGGGGTGGGGG + Intronic
900993166 1:6107106-6107128 GTGGAAGGACGGAGGGATGGAGG + Intronic
900993545 1:6108637-6108659 GTGGAAGGACAGAGGCATGGAGG + Intronic
901633995 1:10661218-10661240 GGAGGAGGCCAGGGGGTTGGAGG - Intronic
902251392 1:15155975-15155997 GAGGCTGGCCTGTGGGTTGGTGG + Intronic
902299859 1:15494056-15494078 GTGCATGGCCAGAGGGGTGGTGG - Intronic
902395320 1:16129344-16129366 GGGGCAGGGAAGAGGGCTGGGGG + Intronic
902632304 1:17712290-17712312 GTGGCAGGTCAGAGGCTGAGAGG + Intergenic
903006311 1:20301154-20301176 GTGGCAGGTCTGAGGGCTGTAGG + Intronic
904392732 1:30196492-30196514 GGGGCAGGCCTGGGGGTGGGAGG - Intergenic
905314407 1:37072597-37072619 CTGGCTGGGCAGAGGGTTGGGGG - Intergenic
905325591 1:37149503-37149525 GTGGCAGGCAGGAGGCCTGGTGG + Intergenic
905468603 1:38175128-38175150 GGGGCAGGCAAGAGGGAGGGAGG + Intergenic
905852296 1:41283182-41283204 GTGGAAGGCTAGAGAGTGGGGGG + Intergenic
906107054 1:43300910-43300932 GTGGCAGGGTAGGGGGTGGGAGG - Intergenic
907220846 1:52905922-52905944 GTGGCAGGAGAGAGCGGTGGGGG + Intronic
907385537 1:54123054-54123076 GTGCCAGGCCAAAGGCTGGGTGG - Intergenic
907518075 1:55006025-55006047 GTCACAGCCCAGGGGGTTGGTGG - Intronic
908703305 1:66924911-66924933 AGGGGAGGGCAGAGGGTTGGTGG + Intronic
909095625 1:71284198-71284220 GTTGCAGATCAGAGGGTTGTAGG + Intergenic
910569645 1:88684818-88684840 GTGGCAGGCCAGGGCTTTGGCGG - Intronic
912487958 1:110043902-110043924 GTGGCAGGCCTGAGGGTGTGAGG - Intronic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915201692 1:154234624-154234646 GTCTCAGGCCAGAAGGATGGTGG + Exonic
915224648 1:154403662-154403684 ATAGCAGGCGAGAGGGCTGGTGG + Intergenic
915316110 1:155030011-155030033 GGGGCAGGGCAGCGGGGTGGGGG + Intronic
915891625 1:159779303-159779325 GTGGGAGGTCAGGGGGTTGGGGG + Intergenic
916052873 1:161048463-161048485 GAGGGAGACCAGAGGGCTGGAGG - Exonic
916785835 1:168086524-168086546 GTGGCAGGGCAGAGAGTGGCTGG - Intronic
917459207 1:175214575-175214597 GTGGCAGGGGACAGGGGTGGGGG + Intergenic
917931291 1:179824472-179824494 GTGGATGGCCAGAGGCTGGGTGG + Intergenic
918682793 1:187375995-187376017 GTGGCTGGCCAGAGGGAGAGTGG - Intergenic
919451145 1:197774974-197774996 CCGGCCGGCCAGAGGCTTGGGGG + Intronic
922781586 1:228256920-228256942 GTGGCAGGTCAGTGCTTTGGGGG + Exonic
922782550 1:228264385-228264407 GTGGCAGGTCAGTGCTTTGGAGG + Exonic
923519196 1:234722853-234722875 GTGGCAAGGCAGAGGTCTGGAGG + Intergenic
1063200323 10:3781239-3781261 GGGTCAGGACAGAGGGTTGCTGG - Intronic
1064048835 10:12042887-12042909 GTGGCGGGCGGGAGGGCTGGCGG - Intronic
1064379817 10:14831304-14831326 GTGGGAGTCCAGGGGGTTGAAGG - Intronic
1064472638 10:15652812-15652834 GAGGCAGGACAGTGGCTTGGAGG - Intronic
1065111984 10:22449328-22449350 GTGACAGGCCAAGGAGTTGGAGG + Intronic
1065462272 10:25981494-25981516 AGGGCAAGCCACAGGGTTGGAGG + Intronic
1067069172 10:43119813-43119835 GTGGCAGGCCAGGGTGTGGGTGG - Intronic
1067101298 10:43336634-43336656 GTGGCAGGCCTGAGGGTCCTGGG - Intergenic
1067766746 10:49092696-49092718 GTGGCAGGCCAGAGTGGTCTTGG - Intronic
1068522085 10:58088022-58088044 GTGGGTGGGGAGAGGGTTGGGGG - Intergenic
1069423731 10:68271364-68271386 TTGGCAGGGCAGAGAGCTGGGGG - Intergenic
1069598695 10:69689245-69689267 GGGGCAGGACAGATGGTGGGTGG + Intronic
1069601030 10:69708247-69708269 GTGGCAGGCCAGAGTGGTTTTGG - Intergenic
1069613841 10:69793436-69793458 GGGGGCGGGCAGAGGGTTGGGGG + Intergenic
1069873470 10:71547381-71547403 GTGCAAGGCCAGAGGGCTGGAGG + Intronic
1069942385 10:71964515-71964537 GGGGCGGGCCGGAGGGATGGAGG - Exonic
1069994171 10:72332480-72332502 ATGGCAGGCCTGAGGGTGTGGGG + Intergenic
1070605175 10:77893490-77893512 CTGCCAGGCCAAGGGGTTGGGGG + Intronic
1070727819 10:78804001-78804023 GTGGCAGGCCTGTGGGTAGCGGG - Intergenic
1072583414 10:96760211-96760233 GGGGCCTGTCAGAGGGTTGGGGG + Intergenic
1072609791 10:97010617-97010639 GTGGGTGGCCAGAGGGAGGGTGG + Intronic
1073441194 10:103553763-103553785 GTGGGAGGACAGAGGGGTAGGGG - Intronic
1074224462 10:111470431-111470453 GGGGCAGGACATAGGCTTGGGGG - Intergenic
1074472737 10:113742209-113742231 GGGGAAGGCCAGAGGGTGGGGGG - Intergenic
1075212792 10:120505254-120505276 GAGGCTGCCCTGAGGGTTGGGGG + Intronic
1075776610 10:124993172-124993194 TTGGCAGGCCAGAGGCACGGAGG + Intronic
1076273177 10:129174528-129174550 GCAGCAGGCCTGGGGGTTGGGGG - Intergenic
1076870358 10:133189848-133189870 GTGGCATCCCCGAGGGCTGGGGG - Intronic
1076997785 11:307360-307382 GGTGCAGGTCAGAGGGTTGGCGG - Intergenic
1077305533 11:1867131-1867153 GTGGTCAGCCAGTGGGTTGGTGG + Intronic
1077473765 11:2776836-2776858 CTGGCAGGCCTTAGGGTCGGGGG + Intronic
1077494656 11:2881010-2881032 TTGGCAGGGCAGAGGGATGTTGG - Intergenic
1077540407 11:3143972-3143994 GTAGCAGGACAGAGGGTCGATGG + Intronic
1079721120 11:23816092-23816114 GTGGCAGGCAAGAGAGTGCGTGG + Intergenic
1079961370 11:26928142-26928164 CTTGCAGGCGAGATGGTTGGTGG + Intergenic
1080428786 11:32179585-32179607 GAGGCAGGCCAGAGTTGTGGGGG - Intergenic
1080485680 11:32704494-32704516 GAGGGAGGCCAGAGGGCTGAGGG + Intronic
1081598636 11:44476571-44476593 GTGGGAGGACAGTGGGTTGCAGG + Intergenic
1081606175 11:44528361-44528383 GTGGCAGGGAAGAGGCTTTGGGG - Intergenic
1083278294 11:61609969-61609991 GTGACAGTGCAGAGGGATGGGGG + Intergenic
1083451918 11:62752026-62752048 ATGGCAGCTCAGAAGGTTGGTGG - Exonic
1083733392 11:64665978-64666000 GTGTCAGGGCAGAGGGTTCTGGG - Intronic
1083784615 11:64936716-64936738 GTGGCAGGGCCGGGGGTTTGGGG + Intergenic
1084572224 11:69966566-69966588 GTGGGAGGCGAGTGGGATGGAGG + Intergenic
1084677687 11:70645811-70645833 GTGGCAGGGCAGGGGGTCAGAGG - Intronic
1084777950 11:71389545-71389567 GTTGGAAGCCAGAGGCTTGGCGG + Intergenic
1085276267 11:75302163-75302185 CTGGCAGGCCAGAGGGGTCAGGG + Intronic
1087159874 11:94938221-94938243 GTGGCAGTCAAGAGGGTTAAGGG - Intergenic
1087475073 11:98624047-98624069 GTGGCAGGCCAGAGTGGTCTTGG + Intergenic
1088811472 11:113395477-113395499 GTGGGAGGACTGAGGGTTGGGGG + Intronic
1089122566 11:116147740-116147762 GTGGCAGGCCAGGGTGTTCTTGG - Intergenic
1089269278 11:117290459-117290481 GTGCCAGGGCTGAGGGTTTGGGG - Intronic
1089493983 11:118899363-118899385 GTTGGAGCCCAGAGGGGTGGGGG + Exonic
1089698614 11:120230832-120230854 CATGCAGGCCAGAGGGTTGAGGG + Intergenic
1090458043 11:126866616-126866638 GTGGCAGGCCAGAGTGGTCTCGG - Intronic
1091317582 11:134625309-134625331 GTGGCAAGACAGAGGGTGAGAGG + Intergenic
1091441900 12:517481-517503 GTGGGAGGCGAGGGGGTTGGAGG + Intronic
1092502104 12:9058595-9058617 GTCACAGACAAGAGGGTTGGGGG - Intergenic
1093100629 12:15024442-15024464 ATGGCAGGGTGGAGGGTTGGAGG - Intergenic
1093411823 12:18877122-18877144 GGGGCAGGGCATAGGGATGGAGG + Intergenic
1093724266 12:22485315-22485337 GTGGCAGGCTGGAGGGAAGGTGG + Intronic
1096156797 12:49345600-49345622 GGCGCAGGGCAGAGGGTCGGAGG + Intergenic
1096496566 12:52042420-52042442 GTGGCAGGCCAGAGGGCCTATGG + Intronic
1096808139 12:54152888-54152910 GTGGCAGGCCACTGGGTGAGGGG + Intergenic
1097009394 12:55941462-55941484 ATGGCAGGCGCGGGGGTTGGGGG - Intronic
1097055844 12:56248700-56248722 GGGGCAGGGCACAGGGTTTGTGG - Intronic
1101455130 12:104824203-104824225 GTGGCAGGCCAGGGTGTTCTTGG - Intronic
1101767895 12:107719820-107719842 GGGGCTGGACACAGGGTTGGTGG + Intergenic
1102031228 12:109741205-109741227 GTGGCAGGACACAGGGTTCCTGG + Intronic
1102433436 12:112901395-112901417 GGGGCAGGTCACAGGGCTGGTGG + Intergenic
1102519536 12:113470014-113470036 CTGCCAGGCCAGAGGTTTAGGGG - Intronic
1102546990 12:113664410-113664432 GGAGCAGGCCTGGGGGTTGGGGG + Intergenic
1102589711 12:113948043-113948065 GGGGCAGGCCCCAGGCTTGGAGG + Intronic
1102707172 12:114892102-114892124 GTGGCGTGACTGAGGGTTGGGGG + Intergenic
1103411021 12:120711129-120711151 CTGGCCTGCCAGAGGGCTGGGGG - Intronic
1104384593 12:128339303-128339325 ATGGGAGCCCAGGGGGTTGGAGG + Intronic
1105284743 13:18994817-18994839 GGGCCAGGCCAGAGAGATGGAGG + Intergenic
1106285963 13:28318251-28318273 GTGACAGGCCTGAGGGAAGGGGG + Intronic
1106319398 13:28624101-28624123 GTGGCAGGCCAGGGTGTTCTTGG - Intergenic
1107988282 13:45794635-45794657 GTGGCAGGCAAGAGAGTGTGTGG - Intronic
1108065751 13:46576103-46576125 GTGGCAGGCTTGAGGCTTGCTGG + Intronic
1108500893 13:51068820-51068842 CTGGCAGGCCTGGGGGGTGGGGG - Intergenic
1108762105 13:53580534-53580556 GTGGCAGGCAAGAGAGTGTGTGG + Intergenic
1110072287 13:71191937-71191959 GTGGCATGCCAGAGGGGTCTTGG + Intergenic
1112081617 13:95978011-95978033 GTGGCCTGCCAGGGGGTAGGGGG + Intronic
1112282163 13:98072725-98072747 TTGTCAGTCCAGAGTGTTGGAGG + Intergenic
1113086382 13:106573352-106573374 TTGGCGGGGCAGGGGGTTGGGGG + Intergenic
1113510800 13:110853628-110853650 GTGGGAGGCGGGAGGGTCGGAGG - Intergenic
1113773965 13:112931816-112931838 GGGGCAGGCCAGAGGGACGCAGG + Intronic
1117274038 14:54174330-54174352 GTGGCAGGTCAGAGTCTTAGGGG - Intergenic
1117591018 14:57268574-57268596 GTGGCAGGCCCGGGGTTTGCAGG - Intronic
1118613973 14:67562696-67562718 CAGGAAGGCCAGAGGGGTGGAGG - Exonic
1120148069 14:81001553-81001575 GGGGCTGGACACAGGGTTGGTGG - Intronic
1120211949 14:81641920-81641942 GTGGCAGGCCAGAGTGGTCTTGG + Intergenic
1120218411 14:81705205-81705227 GTGGCAGGCCAGAGTGGTTTCGG + Intergenic
1121504285 14:94464531-94464553 GCTGCATGCCAGAGGGATGGTGG + Intronic
1121658655 14:95618021-95618043 GTGGCAGGACAGAGGGGAGATGG + Intergenic
1121801514 14:96778050-96778072 GTGGAAGTGCAGAGGGTTTGGGG - Intergenic
1122116682 14:99531114-99531136 GTGGCAGGCCAGGGGAGAGGTGG + Intronic
1122365491 14:101192628-101192650 GGGGAAGGCAAGAGGGTTTGAGG + Intergenic
1122689054 14:103522962-103522984 GTGGGCGGCCAGGGTGTTGGGGG - Exonic
1122917897 14:104867211-104867233 GGGACAGGGCAGAGGGATGGAGG - Intronic
1122957368 14:105076931-105076953 GGGGCAGGCCAGAGGGCGGGTGG + Intergenic
1123996061 15:25718750-25718772 GAGGCAGGACAGAGGGTGGCAGG + Intronic
1124554118 15:30709545-30709567 GTGACAGGGCACAGGGTTGAGGG - Intronic
1124657519 15:31521123-31521145 ATGACAGGCCGGAGGGTTCGCGG + Intronic
1124677128 15:31696126-31696148 GTGACAGGGCACAGGGTTGAGGG + Intronic
1125119521 15:36137868-36137890 GGGGCCTGTCAGAGGGTTGGGGG - Intergenic
1128301234 15:66567569-66567591 GAGGGAGGCCAGGGGGTGGGTGG + Intergenic
1128648665 15:69395118-69395140 GTGGCAGGGCACAGGGCAGGAGG + Intronic
1128885773 15:71286306-71286328 ATGGAAGGGCAGAGGGTGGGAGG - Intronic
1129300198 15:74621046-74621068 GAGGCAGGGAAGAGGGATGGGGG - Intronic
1129372477 15:75106202-75106224 GTGGGTGGCCAGAGGGCTCGTGG + Intronic
1130672021 15:85921074-85921096 TTGGCAGGCCAGAGGGTCTGTGG - Intergenic
1130923080 15:88365385-88365407 GAGGGAGGGCAGAGGGGTGGGGG + Intergenic
1130927395 15:88395931-88395953 GTGGCAGGCCAGGGTGTTCTTGG + Intergenic
1131344226 15:91631138-91631160 GGGCCAGCCCAGAGGGTGGGTGG + Intergenic
1131558673 15:93420665-93420687 CTGGCAGGTGACAGGGTTGGAGG + Intergenic
1132734354 16:1378231-1378253 TGGGCAGGCCTGCGGGTTGGGGG - Intronic
1132833493 16:1941234-1941256 GTGAGAGGCCACAGGGGTGGGGG - Intronic
1134631933 16:15762647-15762669 GGGGGAGGCCAGTGAGTTGGGGG - Intronic
1136269965 16:29142607-29142629 GGGGCAGGCAAGAGGCTGGGGGG - Intergenic
1137541044 16:49361938-49361960 GTGGCAGGCAAGAGAGCTGGTGG - Intergenic
1137716351 16:50600760-50600782 GTCTCAGGCCTGAGGGCTGGAGG + Intronic
1137719770 16:50621290-50621312 GTGTCAGGCCAGAGGGCAGATGG - Intronic
1137736235 16:50725940-50725962 TAGGAAGGACAGAGGGTTGGTGG - Intronic
1138337639 16:56265752-56265774 GTGGGAGGCAAGATGGTTTGGGG + Intronic
1138499086 16:57427491-57427513 GTGTCAAGCGAGAGGGGTGGAGG + Intergenic
1138514205 16:57526994-57527016 GTCACAGGCCAGAGGGCTGTGGG - Intronic
1138950437 16:61906373-61906395 GTGGGTGGCCAGAGGGTTTGAGG - Intronic
1140409049 16:74730302-74730324 GTGGCAGGGGTGGGGGTTGGGGG + Intronic
1140476203 16:75240293-75240315 GGGGCAGGCCTGAGGCTTGGAGG + Intronic
1140910821 16:79450513-79450535 CTATCAGGCCAGGGGGTTGGGGG - Intergenic
1141610553 16:85178772-85178794 GTGGCCGGAGAGAGGGGTGGTGG + Intronic
1141664262 16:85457744-85457766 GTGGCAGGCTGTAGGGGTGGAGG + Intergenic
1142743170 17:1942225-1942247 GTGGGAGGCCAGGAGGTTTGGGG - Intronic
1143189890 17:5033502-5033524 GAAGCAGGCAAGGGGGTTGGCGG + Exonic
1143379913 17:6489582-6489604 GAGGCAGGGCTGAGGGGTGGAGG - Intronic
1143651973 17:8268877-8268899 GGGGAGGGCCCGAGGGTTGGGGG + Intronic
1143985945 17:10914306-10914328 TTGGGAGGCCAGGCGGTTGGGGG + Intergenic
1144887993 17:18476973-18476995 GTGGCAGGAGATAGGGGTGGGGG + Intronic
1145144215 17:20467330-20467352 GTGGCAGGAGACAGGGGTGGGGG - Intronic
1145790739 17:27625098-27625120 GTGGGAGGCCAAAGGGATGATGG - Exonic
1146592383 17:34138598-34138620 GTGGCAGGCACTAGGGTTGGTGG - Intronic
1146678666 17:34791639-34791661 GTGGCAGGGGGCAGGGTTGGGGG - Intergenic
1146759120 17:35460677-35460699 GTGGCAGCCCAGCGGGGCGGGGG - Intergenic
1146824632 17:36011983-36012005 GTGGCAGGCCAGAGTGGTCTTGG - Intergenic
1146897447 17:36554615-36554637 TTGGGAGGCCAGTGGGGTGGGGG - Intronic
1147276725 17:39324018-39324040 TTGGGAGGCCAGGGGGTGGGGGG - Intronic
1147384671 17:40074264-40074286 GTGGCAGGTGGGAGGGCTGGGGG - Exonic
1147945726 17:44079096-44079118 GTGGCAGGCCAGAGGTCTGAGGG - Intronic
1148215908 17:45833939-45833961 GGGGCAGCCCAGAGGCTGGGTGG + Intronic
1149073116 17:52567267-52567289 GTAGCAAGGTAGAGGGTTGGGGG - Intergenic
1149279396 17:55085551-55085573 GTGGCAAACTAGAGGGATGGTGG - Intronic
1149318180 17:55458509-55458531 GTGGCAGGCCAGGGTGGTGTCGG - Intergenic
1149776964 17:59365788-59365810 GTGGCTGGACAGTGAGTTGGAGG + Intronic
1150011483 17:61508630-61508652 GTGGCAGGAGAGAGGGAGGGTGG + Intergenic
1150472059 17:65445913-65445935 GGGGCCTGTCAGAGGGTTGGGGG + Intergenic
1151605051 17:75130707-75130729 CGGGCAGGCCAGAGGCCTGGAGG + Intronic
1152495456 17:80668140-80668162 GTAGCAGGCCTGAGGGGTAGCGG + Intronic
1152584371 17:81182417-81182439 GTGGCTGGCCACAGGCCTGGAGG + Intergenic
1152645070 17:81465066-81465088 GCAGCAGGCCAGGGGTTTGGGGG - Exonic
1152655140 17:81515729-81515751 GTAGCCGGCCAGGTGGTTGGCGG - Intronic
1152661697 17:81545401-81545423 CTGGCAGTGCAGAGGGTTAGCGG + Intronic
1152716849 17:81904370-81904392 GTGGCAGGACACCGTGTTGGGGG + Exonic
1153631296 18:7072857-7072879 GTGGGAGGCTGGAGGGCTGGAGG + Intronic
1154204407 18:12325060-12325082 GTTGCAGGCCAGACGGGTGCAGG + Exonic
1154378927 18:13832345-13832367 CTGGCTGGTCAGAGGGTTAGTGG - Intergenic
1155061545 18:22233279-22233301 GTGTGAGGCCAGAGGCTAGGTGG - Intergenic
1155182064 18:23356477-23356499 GTGGCAGGAGAGAGTGGTGGTGG - Intronic
1155412047 18:25557178-25557200 GAGGCAAGCCAGAGGACTGGTGG - Intergenic
1155556136 18:27021171-27021193 GTGGGAGGTGAGAGGGTAGGAGG + Intronic
1155928659 18:31684608-31684630 ATGGGAGGCCAGAGAGTCGGGGG + Exonic
1156497937 18:37538113-37538135 CCGGGAGGCCAGAGGGATGGCGG + Intronic
1156551972 18:38027696-38027718 GTGGCAGGCCAGAGTGGTCTTGG + Intergenic
1156574504 18:38298965-38298987 GTGGCAGGGGTGGGGGTTGGAGG + Intergenic
1157051274 18:44168513-44168535 GGGGCCTGCCAGAGGGTTGGGGG + Intergenic
1157197173 18:45629020-45629042 GTGGCAGGACTTAGGCTTGGAGG + Intronic
1157200223 18:45653481-45653503 GTGGCAGGGCAAAAGCTTGGGGG + Intronic
1158891068 18:61872124-61872146 ATGGCAGGACCAAGGGTTGGAGG + Intronic
1159884456 18:73891022-73891044 GAGCCAGGCCTGAAGGTTGGTGG + Intergenic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160415017 18:78703692-78703714 GAGGCAGGACAGAGGCATGGCGG + Intergenic
1160563888 18:79775048-79775070 GGGGCTGGGGAGAGGGTTGGTGG + Intergenic
1161237745 19:3206197-3206219 GGGCCAGGCCAGTGGGTGGGTGG + Intronic
1161273639 19:3404011-3404033 GGGGCAGGCCAGGGGCTGGGGGG - Intronic
1161313486 19:3607340-3607362 GTGGGAGGACAGAGGGATGGGGG + Intergenic
1161314239 19:3610437-3610459 GAGGCAAGGCAGAGGGGTGGGGG + Intergenic
1161470934 19:4456515-4456537 CTGGCTGGCCAGAGGGTGGTGGG - Intronic
1161990800 19:7682975-7682997 GGGTCTGGCCATAGGGTTGGGGG + Exonic
1162806487 19:13140260-13140282 GTGGCAGGCCAGGAGGCGGGGGG - Exonic
1162818373 19:13209124-13209146 GAGGCAGGTCAGTGGGTTGGGGG + Intronic
1163369229 19:16892785-16892807 GGGGCAAGGCAGAGGGTTGGAGG + Intergenic
1165610385 19:37146569-37146591 GTGGCAGGGCTGAGGGTTCTGGG - Intronic
1165613621 19:37179116-37179138 GTGGCAGGGCTGAGGGTTCTGGG - Intronic
1165809783 19:38605527-38605549 GTGGAGGGCGGGAGGGTTGGGGG - Intronic
1166214725 19:41327674-41327696 GGGGCAGGGCAGGGGGTTTGGGG - Intronic
1166605805 19:44141720-44141742 GTGGGAGAGCAGAGGTTTGGTGG + Exonic
1167355158 19:48999163-48999185 GTGACAGGCAAGAGGGGTGGGGG + Intronic
1167375581 19:49109235-49109257 GTGGGAGGCCAGAGGGAGAGCGG + Intergenic
925017633 2:543768-543790 GTGGGAGGCTGGAGGGTGGGAGG + Intergenic
925049220 2:798151-798173 GTGGCAGGCCAGAGTGGTCTTGG + Intergenic
925131827 2:1499225-1499247 GTGGAAGGTCAGAGGGCAGGCGG - Intronic
925905521 2:8537654-8537676 GTGGCAGGGCCCAGGGTGGGAGG - Intergenic
926123487 2:10257287-10257309 GTGGGAGGGCAGATGGGTGGGGG - Intergenic
926240458 2:11081115-11081137 GGGGGAGGCCAGAGGGAGGGAGG - Intergenic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
926694767 2:15763492-15763514 GTGGGAGGGCAGTGGGCTGGTGG + Intergenic
927515705 2:23670510-23670532 ATGTCAGGCCTGGGGGTTGGGGG - Intronic
927751802 2:25676172-25676194 GAGTCAGGGCAGAGGGGTGGTGG - Intergenic
929324766 2:40595926-40595948 CTGGCAGGCCAAAGGACTGGAGG + Intronic
930017830 2:46983133-46983155 GTGGTAGGCCAGGGAGGTGGTGG + Intronic
931630890 2:64297663-64297685 GTGGTAAACCAGAGGGCTGGGGG - Intergenic
932368130 2:71166242-71166264 GTGGCAGGACATAGGGGTGGGGG - Intergenic
932421378 2:71603410-71603432 GAGCCAGGCCAGAGGGTGGGTGG + Intronic
932497367 2:72153074-72153096 GGTGCAGGCCAGAGGCTGGGAGG - Intergenic
934566530 2:95344609-95344631 GAGGCAGAGAAGAGGGTTGGAGG + Intronic
934615535 2:95768380-95768402 GAGGCAGGCCAGAGGGGATGGGG + Intergenic
934645364 2:96056178-96056200 GAGGCAGGCCAGAGGGGATGGGG - Intergenic
934838769 2:97612267-97612289 GAGGCAGGCCAGAGGGGATGGGG - Intergenic
935800082 2:106687054-106687076 GTGGCAGGCAAGAGAGATTGTGG + Intergenic
936060577 2:109293234-109293256 GAGGGAGGACAGAGGGATGGTGG + Intronic
937059183 2:118968989-118969011 GTGGCAAGAAAGAGGATTGGGGG + Intronic
937205659 2:120235506-120235528 GGGGCCTGCCAGGGGGTTGGGGG + Intergenic
937283234 2:120734950-120734972 GTGGCAGGCCCGGGGGTGTGGGG + Intergenic
937899963 2:127012285-127012307 GTGGCAGGGAAGAGGGGTGGTGG + Intergenic
937900267 2:127014472-127014494 GTGGATGGCCTGAAGGTTGGTGG - Intergenic
938082205 2:128376268-128376290 GTGGCAGTCCAGAAGGTGGGAGG + Intergenic
939583560 2:143980188-143980210 GGGGCCTGTCAGAGGGTTGGTGG - Intronic
940456536 2:153908682-153908704 GTGGAAGACCAGATGGTTGTAGG + Intronic
940819412 2:158335568-158335590 GTGGCAGGCAAGAGAGCTTGTGG + Intronic
941897582 2:170644938-170644960 GGTGCAGGGCAGGGGGTTGGGGG + Intronic
942248235 2:174026338-174026360 CTGGCTGCCCACAGGGTTGGTGG - Intergenic
943701807 2:190995448-190995470 GTGGCAGGCAAGAGAGTTTGTGG + Intronic
945227266 2:207544717-207544739 GGGGCCTGTCAGAGGGTTGGGGG - Intronic
946108592 2:217393880-217393902 GTGTGAGGGCAGAGGGGTGGAGG - Intronic
946160824 2:217834995-217835017 GCCCCAGGCCTGAGGGTTGGGGG - Intronic
946832577 2:223741308-223741330 GTGGCAGGCCAGAGTGGTCTTGG + Intergenic
947839294 2:233197475-233197497 CTGGCAGGGCAGAGAGATGGTGG - Intronic
947910486 2:233797736-233797758 GGGGCCTGCTAGAGGGTTGGGGG - Intronic
948279548 2:236736353-236736375 GTGGCAGGGCAGGGGGTGGCTGG + Intergenic
948672879 2:239579730-239579752 GTGGCAGGCAAGAGCGTTTGTGG + Intronic
1170705416 20:18740019-18740041 GTGGGAGGGGATAGGGTTGGAGG + Intronic
1171522042 20:25783544-25783566 GGGACAGGCCAGAGGGCTGCAGG - Intronic
1171529793 20:25845489-25845511 GGGACAGGCCAGAGGGCTGCAGG - Intronic
1171554783 20:26072339-26072361 GGGACAGGCCAGAGGGCTGCAGG + Intergenic
1172277848 20:33690207-33690229 GCGGGAAGCCACAGGGTTGGGGG - Intergenic
1172762560 20:37332573-37332595 GCGGCAGGGAAGAGGGGTGGTGG + Intergenic
1172809460 20:37636997-37637019 GTGGCAGGGCAGGGGGGTGACGG - Intergenic
1172836949 20:37879207-37879229 GAGGCAGGGCTGAGGGTGGGCGG - Intergenic
1173006224 20:39141678-39141700 GTGGCAGGGTTGAGGGTGGGTGG + Intergenic
1173226525 20:41165391-41165413 GTGGTAGGCCAGTGGGTGTGAGG + Intronic
1173676343 20:44838933-44838955 GTGGAAAGGCAGAGGGCTGGAGG + Intergenic
1173943637 20:46932931-46932953 GTGGCAGGACAGAGAGGGGGTGG - Intronic
1174000733 20:47372719-47372741 GGGGCAGGGCAGAGGGGTGCAGG - Intergenic
1174172865 20:48627975-48627997 GAGGGAGGACAGCGGGTTGGCGG + Intronic
1174413248 20:50349626-50349648 GAGCCAGGCCAGGGGTTTGGGGG - Intergenic
1175033197 20:55975183-55975205 ATGGCAGGGCAGAGGTGTGGTGG - Intergenic
1175044604 20:56093369-56093391 GTGGCAGGCAAGAGAGCTTGTGG + Intergenic
1175831128 20:61965940-61965962 GTGGCAGGCCAGGGGAGGGGCGG - Intronic
1176138579 20:63535743-63535765 GCGGGAGGCCAGGTGGTTGGAGG - Intronic
1176178141 20:63738176-63738198 CTGGCAGGCCGCAGGGCTGGGGG - Exonic
1176655845 21:9588532-9588554 GGGACAGGCCAGAGGGCTGCAGG - Intergenic
1177607470 21:23400248-23400270 GTGGCAGGCAAGAGAGCTTGTGG + Intergenic
1179349962 21:40599374-40599396 GAGGCCAGCCAGGGGGTTGGGGG - Intronic
1179994447 21:44967502-44967524 GTGGCAGAACAGTGAGTTGGGGG - Intronic
1181022141 22:20109213-20109235 CTGGCAGGCCAGCCTGTTGGTGG + Intronic
1181041259 22:20193748-20193770 GTGGCAGGAGCCAGGGTTGGGGG - Intergenic
1181186275 22:21107203-21107225 ATGGCATGTCAGGGGGTTGGGGG - Intergenic
1181899276 22:26139455-26139477 GTGCCAGGCCAGAGTGTTATTGG - Intergenic
1183725170 22:39584549-39584571 ATGGGAGACCAGAGGGCTGGGGG + Intronic
1183880373 22:40822077-40822099 TTGGGAGGCCAGGGGGTGGGGGG - Intergenic
1183952015 22:41357504-41357526 AGGGCAGGCCAGGGGGGTGGGGG + Exonic
1184032947 22:41905479-41905501 GCGGCAGGCCAGCAGGATGGCGG - Exonic
1184258447 22:43300846-43300868 CTGGCAGGCCTGGGGGTTTGGGG - Intronic
1184570136 22:45317799-45317821 GTGGCAGGCCAGAGCTCTGCAGG + Intronic
1185001959 22:48251700-48251722 GTGGCAGGGCTGAGGGCTGGAGG - Intergenic
949385535 3:3497879-3497901 TGGCCAGGCCAGAGGGGTGGTGG - Intergenic
949461827 3:4302792-4302814 TTGGCAGGGCAGGGGTTTGGAGG + Intronic
949737508 3:7190930-7190952 GGTGGAGGCCAAAGGGTTGGTGG - Intronic
949892821 3:8745888-8745910 GTGGCAGGGCAGGGGGTGGTGGG + Exonic
950425835 3:12924320-12924342 GGTGCATGCCAGAGGGTGGGCGG + Intronic
951955271 3:28246371-28246393 GTGCCATGGCAGTGGGTTGGGGG + Intronic
952518358 3:34128831-34128853 GGGGCCTGTCAGAGGGTTGGGGG + Intergenic
952904383 3:38129916-38129938 GTGGCAGGCGCCAGGGTGGGAGG + Intronic
954318466 3:49814084-49814106 GTGTCAGACCTGAGGGTGGGAGG + Intergenic
954424975 3:50438458-50438480 GAGGCTGGGCAGAGGGTTCGGGG - Intronic
954431083 3:50471145-50471167 GTGGCTGGGTAGAGGGGTGGAGG + Intronic
955058036 3:55473699-55473721 GTAGCAGGCCTGATGGATGGAGG - Intronic
956719985 3:72109159-72109181 GTGGTAGGCCGGATGGTGGGAGG - Intergenic
957991016 3:87627604-87627626 GTGGCAGGCCAGAGTGGTCTTGG - Intergenic
958759150 3:98286959-98286981 GTGGAAGACCAGATGGTTGTAGG + Intergenic
959420036 3:106117508-106117530 GTGGCAGGCCAGAGTGGTCTTGG + Intergenic
959454295 3:106539880-106539902 GTGGCCTGTCAGGGGGTTGGGGG + Intergenic
960722431 3:120638098-120638120 GTGGCAGGCAAGAGGGAAGCTGG - Intronic
961628044 3:128277056-128277078 GTGCCAGGCCAGAGGGTGAGAGG - Intronic
962349218 3:134644533-134644555 ATGGCAGGCCAGAGTGGTAGTGG - Intronic
963102958 3:141623304-141623326 GTGGAGGGACAGAGGGCTGGGGG - Intergenic
963397916 3:144757158-144757180 GTGGGGGGCCAGGGGGTGGGAGG - Intergenic
963793158 3:149604788-149604810 CTGGCAGGCCAGAAGGCAGGTGG + Intronic
965793557 3:172414282-172414304 GTGAAAGGCCAGAAGGATGGAGG + Intergenic
965938338 3:174144067-174144089 GTGGCATGTCAGAGGGTGGGAGG - Intronic
968089775 3:195892796-195892818 GAGGCAGGCAAGAGGGAGGGCGG - Intronic
968443033 4:634096-634118 CTGGGAGGCCAGAGGGGTGGAGG + Intronic
968531270 4:1093022-1093044 GTGGTAGGGCAGAGGCTGGGTGG + Intronic
968653450 4:1768944-1768966 GTGCCAGGCCTGTGGGTGGGGGG - Intergenic
968674810 4:1871611-1871633 GTGGGAGGCCTGAGGGGCGGCGG + Intronic
968726710 4:2251291-2251313 GTGCCTGGCCAGGGGGATGGGGG - Intronic
968964104 4:3760775-3760797 GTGGCAACCGAGAGGGTCGGGGG + Intergenic
969336782 4:6515371-6515393 GTGCCAGGCCAAAGGCTGGGAGG + Intronic
969339171 4:6529629-6529651 GTGCCAGGGAAGAGGGATGGGGG - Intronic
969453233 4:7286687-7286709 GTGCCAGGCCAGAAGGCAGGAGG - Intronic
969478762 4:7435864-7435886 TGGGCAGGCCAGAGGTTTGATGG + Intronic
969872217 4:10111677-10111699 GTGGCATGACAGAGGGCTTGAGG - Intronic
969952219 4:10849425-10849447 GTGGAAGACCAGATGGTTGCAGG + Intergenic
970641323 4:18069492-18069514 GTGGCAGGGAAGAGAGGTGGAGG - Intergenic
971254242 4:24999715-24999737 ATGGGATGCCAGAGGTTTGGCGG - Exonic
971585696 4:28402998-28403020 GTGGCAGGCCAGAGTGGTCTGGG + Intergenic
971612607 4:28744860-28744882 GGGGTAGGTCAGAGGGTGGGGGG - Intergenic
972023247 4:34341858-34341880 GTGGCAGGCAAGAAAGTTTGTGG + Intergenic
972659742 4:41104631-41104653 GTGGCAGGGCCAAGGGTGGGAGG - Intronic
974817205 4:67020738-67020760 GTTGGAGGCCAGAGGCTTGGAGG - Intergenic
976219745 4:82746875-82746897 GTGGTAGGCCAGAGGGGTCTTGG - Intronic
978416466 4:108482159-108482181 GCTGAATGCCAGAGGGTTGGGGG + Intergenic
978968106 4:114767815-114767837 ATTGCAGGGCAGAGGGTGGGAGG + Intergenic
981298750 4:143163299-143163321 CTGGTAGGTCAGAGGGTTGTTGG - Intergenic
981563407 4:146072207-146072229 GTGGCAGAAAAGAGGGCTGGTGG - Intergenic
981876093 4:149547472-149547494 TTGCCAGGGCTGAGGGTTGGAGG + Intergenic
982211252 4:153038624-153038646 GTGGCAGAGAATAGGGTTGGGGG - Intergenic
984336107 4:178393534-178393556 GGGGCCTGCCAGGGGGTTGGGGG - Intergenic
984702950 4:182829956-182829978 GGGGGAGGCTGGAGGGTTGGGGG - Intergenic
984864787 4:184272195-184272217 GAGGGAAGCCAGAGGGTTGAGGG - Intergenic
985522048 5:378536-378558 GGGGAAGGCCGGAGGCTTGGAGG - Intronic
985918034 5:2942149-2942171 GGGGCCTGTCAGAGGGTTGGGGG - Intergenic
986433589 5:7705601-7705623 GATGCAGGGCAGAGGGGTGGGGG + Intronic
986713343 5:10503552-10503574 GTGCCAGGCCTGAGGGCTGCAGG + Intergenic
988410580 5:30880746-30880768 ATGGCTTGTCAGAGGGTTGGTGG - Intergenic
988974286 5:36499852-36499874 GTGGCAGGCAAGAGTGTATGCGG + Intergenic
990601633 5:57364702-57364724 GCAGCAGGCCAGAGGGTGGGTGG + Intergenic
992397064 5:76378127-76378149 GTGGCAGGGAAGAGGGTTCCTGG + Intergenic
992639180 5:78753656-78753678 GTGGCAGGGAAGATGGTTTGTGG + Intronic
993188053 5:84645695-84645717 GTGGCAGGCCAGAGTGGTCTTGG - Intergenic
993733904 5:91453019-91453041 GTGGAAGCCCAGAGGGCTGAAGG - Intergenic
994259803 5:97643945-97643967 GTTGAAGGTCAGAGGGTTGTAGG - Intergenic
998231915 5:140366269-140366291 GAGCCAGGGAAGAGGGTTGGGGG + Intronic
998484023 5:142486160-142486182 GTGGCAGACCAGAGAGCTGCTGG + Intergenic
999300368 5:150486573-150486595 GTGGGAGGACAAAGGGTAGGGGG + Intronic
1000532782 5:162444515-162444537 GTGGCAGGCCAGGGTGTTCTTGG - Intergenic
1000870680 5:166573389-166573411 CTGTCAGGCCATAGTGTTGGGGG - Intergenic
1001975341 5:175994175-175994197 GGGGCAGGCCAGAGGGGAGCTGG - Intronic
1002000831 5:176195470-176195492 GAGGCAGTCCAGAGGGGTGAGGG + Intergenic
1002242092 5:177849595-177849617 GGGGCAGGCCAGAGGGGAGCTGG + Intergenic
1002253505 5:177943500-177943522 GAGGCAGTCCAGAGGGGTGAGGG - Intergenic
1003897536 6:10622005-10622027 GGGACTGGCCTGAGGGTTGGGGG - Intronic
1005004914 6:21278320-21278342 GAGGCAGGAGAGAGGGTGGGAGG + Intergenic
1006175063 6:32116578-32116600 GGGCCAGGCCAGAAGGGTGGAGG + Intronic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007814504 6:44511364-44511386 CTGGGAGGCTAAAGGGTTGGGGG + Intergenic
1011531530 6:88327555-88327577 GTGCCAGGCTGGAGGTTTGGTGG + Intergenic
1011818657 6:91224081-91224103 GTGGCCGGTCAGAGGGTGGGGGG + Intergenic
1012474026 6:99602040-99602062 GTGACAGAGCAGGGGGTTGGGGG + Intergenic
1013633878 6:112010292-112010314 GTGGCAGGTGGAAGGGTTGGAGG + Intergenic
1014048729 6:116926552-116926574 CTGGCGGCCCAGAGAGTTGGTGG + Intronic
1014284852 6:119485711-119485733 AGGGCAGGCCAGCAGGTTGGAGG + Intergenic
1014908266 6:127057353-127057375 GTGGCAGGCAAGAGAGTTTGTGG + Intergenic
1014961704 6:127694836-127694858 TTGGAGGGCCAGAGAGTTGGAGG - Intergenic
1015007855 6:128305991-128306013 GTGGCAGGACAGAGTGAAGGGGG + Intronic
1016692812 6:146958189-146958211 GTGGCAGTCTAGAGGGAAGGTGG + Intergenic
1019428724 7:988875-988897 GTGGGAGGAGAGAGGGTGGGAGG - Exonic
1019643421 7:2116550-2116572 GTGGCAGGCCAGAGGGTTGGGGG + Intronic
1019655979 7:2196035-2196057 GTGGCCAGCCAGATGGATGGAGG + Intronic
1020035633 7:4961349-4961371 ATGGCAGGGCTGAGGGCTGGGGG + Intergenic
1020092690 7:5350217-5350239 GAGGCTGGCCAGTGGGTCGGGGG + Intronic
1020281720 7:6653371-6653393 GTGGAAGCCCAGCGGGTGGGAGG - Exonic
1020687100 7:11309577-11309599 GTGGAGGGACAGAGGGTTAGAGG + Intergenic
1022992716 7:35724667-35724689 GTGGCAGGCCAGAGTGGTCTTGG - Intergenic
1023264764 7:38393380-38393402 GAGGCAGGCCCTGGGGTTGGAGG + Intronic
1023819943 7:43975054-43975076 GTGGCTGGTCAGAGGGGTCGAGG + Intergenic
1023868946 7:44252460-44252482 GGGGCAGGGGAGAGGGCTGGAGG + Intronic
1023876492 7:44289110-44289132 GAGGCAGGCACGAGGGTTGGGGG - Intronic
1024069705 7:45775509-45775531 GAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1024231799 7:47368703-47368725 GTGGCTGTCCAGAGGGGTGTAGG - Exonic
1024702001 7:51913773-51913795 ATGGCAAGACAGAGGGTTGACGG + Intergenic
1025613892 7:63101682-63101704 GTGGCAGGGCCAAGAGTTGGAGG - Intergenic
1029551176 7:101237876-101237898 GGGGCAGCCCAGAGGCTGGGGGG - Intronic
1029748218 7:102528507-102528529 GTGGCTGGTCAGAGGGGTCGAGG + Intergenic
1029766165 7:102627594-102627616 GTGGCTGGTCAGAGGGGTCGAGG + Intronic
1030314326 7:108098404-108098426 CTGGCAGCCCAGGGGGTCGGTGG + Exonic
1031643212 7:124190624-124190646 TTGGCTGGGGAGAGGGTTGGGGG + Intergenic
1031750317 7:125563682-125563704 GTGGCAGGCCAGAGTGGTCTTGG - Intergenic
1031915245 7:127556810-127556832 GTGGCAGGCCAGAGAGCATGTGG - Intergenic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1032198858 7:129805167-129805189 GGGGCAGGCCTGCGGGATGGGGG + Intergenic
1032542505 7:132715040-132715062 GTGGCAGGAGAAAGGGCTGGGGG - Intronic
1033343012 7:140506570-140506592 GTGACTGGCCAGGGGTTTGGAGG - Intergenic
1033767060 7:144505632-144505654 GTGGCAGGCCAGAGTGGTCTTGG - Intronic
1033988564 7:147256207-147256229 GTGACAGGCCCTATGGTTGGTGG + Intronic
1034099321 7:148437592-148437614 GTGGCAGGCCAGAGTGGTCTTGG + Intergenic
1034265521 7:149778925-149778947 ATGGCTGGCCAGAGGGTAAGTGG + Intergenic
1035606161 8:930946-930968 GGGGAAGGGCAGAGGTTTGGGGG + Intergenic
1037513844 8:19610430-19610452 GTGGCAGGCCAGAGTGGTCTTGG - Intronic
1038395509 8:27242957-27242979 GGGGCAGACCAGAGGGATGGTGG - Intronic
1038660566 8:29493145-29493167 GAGGCAGGCCAGTGGGAAGGAGG - Intergenic
1038730963 8:30127374-30127396 GTGGGAGGCCAGAGGTCAGGAGG + Intronic
1039170936 8:34744025-34744047 GGGGCCTGCCAGGGGGTTGGGGG + Intergenic
1039306844 8:36272521-36272543 GTGGCAGGCCAGAGTGCTCCTGG - Intergenic
1039411965 8:37362406-37362428 GGGGAATGCCAGAGGGTGGGAGG + Intergenic
1039900895 8:41751922-41751944 GTGGTAGGCAGGGGGGTTGGAGG - Intronic
1040763495 8:50878206-50878228 AGGGCAGGCCAGCAGGTTGGAGG + Intergenic
1041623490 8:59999769-59999791 GCGGCAGGCTGGAGGGCTGGAGG - Intergenic
1041693528 8:60713657-60713679 TTTGGAGGCCAGAGGTTTGGAGG + Intronic
1044605072 8:94041329-94041351 GTGGCAGGGCAGGGGAGTGGGGG - Intergenic
1045058949 8:98394965-98394987 GTGGCAGGCGAGAATGGTGGAGG - Intergenic
1046446299 8:114324934-114324956 GGGGCCTGCCAGAGGGTGGGGGG + Intergenic
1047515096 8:125547056-125547078 GTGGCAGTCCAGAGTGGAGGAGG + Intergenic
1047541278 8:125768773-125768795 GTGGAAGACCACAGGGTTTGGGG + Intergenic
1047605050 8:126466409-126466431 GTGGCAGGAGTGAGGGTGGGGGG + Intergenic
1048206603 8:132420409-132420431 GTGGCAGCCCAGAAGGTGGATGG - Intronic
1049023180 8:139971351-139971373 GTGCCAGGCCAGGAGGTTGGGGG - Intronic
1049164451 8:141117629-141117651 GAGGCAGGGCAGAGGCCTGGAGG - Intronic
1049289200 8:141792489-141792511 GTGTCAGGCCTGTGGGATGGTGG + Intergenic
1049330246 8:142046605-142046627 GTGGCAGGAGGGAGAGTTGGTGG + Intergenic
1049582311 8:143418289-143418311 GTGGCTGGGTAGGGGGTTGGAGG - Intergenic
1049645766 8:143734966-143734988 GTGGCAGGGGCGAGGGGTGGTGG - Intergenic
1049660302 8:143816867-143816889 GTGGCGGGGGAGAGGGTAGGGGG - Intronic
1050624852 9:7492486-7492508 GTGGCAGGCAATAGAGTTTGGGG + Intergenic
1051571764 9:18566746-18566768 GTGACAGGCCTGAGGGATGATGG + Intronic
1052122657 9:24737960-24737982 GTGGCAGGCCAGGGTGGTGTTGG - Intergenic
1052362108 9:27573043-27573065 GGGGAAGGCCGGAGGGTGGGCGG - Intronic
1052840623 9:33289117-33289139 GTGGCAGGCCAGGAGGCAGGGGG - Intergenic
1056321473 9:85439386-85439408 GTGGCCTGTCAGGGGGTTGGGGG + Intergenic
1057167841 9:92942368-92942390 CTGGCAGGTCAGAGTGCTGGTGG - Intergenic
1058507258 9:105678676-105678698 GTGGAAGGGCAGAGGGTCGGAGG + Intergenic
1058687253 9:107489648-107489670 GTGGGGGGCCAGAGGGGCGGGGG + Intronic
1059398098 9:114051537-114051559 GTGGCAGGTCTGAGGTGTGGTGG - Exonic
1060424338 9:123492235-123492257 GTGTCAGGACAGAGGCTTGCTGG + Intronic
1060915977 9:127390914-127390936 CTGGCAGGCCTGAGGGTCTGGGG - Intronic
1060939797 9:127536665-127536687 GTGGTAAGCCTGAGTGTTGGAGG - Intronic
1061185298 9:129049428-129049450 ATGGGATGCCAGAGGGATGGAGG + Exonic
1061420983 9:130472724-130472746 GTGGCTGGCCTGAGTGTTGTGGG - Intronic
1061491001 9:130944397-130944419 GTGGAAGGGTAGAGGGCTGGAGG + Intergenic
1062025092 9:134336547-134336569 GTGGCCGGCCGGAGCCTTGGTGG + Intronic
1062081206 9:134624625-134624647 GAGGCAGACCAGATGGCTGGTGG - Intergenic
1062101090 9:134728887-134728909 GTGTCAGGGTAGAGGGTTGGGGG + Intronic
1062357268 9:136170819-136170841 GTGGCTGACCAGAGGGTGGGCGG - Intergenic
1062425691 9:136505168-136505190 GCGGCTGGCCAGTGGGCTGGAGG - Intronic
1062480124 9:136747246-136747268 GTAGCTGGGCAGAGGGCTGGTGG + Intronic
1062626531 9:137445535-137445557 CAGGCACGCCTGAGGGTTGGGGG + Intergenic
1203633562 Un_KI270750v1:91993-92015 GGGACAGGCCAGAGGGCTGCAGG - Intergenic
1185786820 X:2897972-2897994 GGGGCCAGCCAGAGGGGTGGAGG - Intergenic
1186334730 X:8574117-8574139 GTGGCTGGGCTGAGGGGTGGAGG - Intronic
1186364342 X:8875486-8875508 GTGGCAGGTCAGGGAGTAGGAGG + Intergenic
1187387366 X:18860928-18860950 CTGGTAGAACAGAGGGTTGGGGG - Intergenic
1187531622 X:20102462-20102484 GTTACAGGCCAGAGAGATGGGGG + Intronic
1188040636 X:25366924-25366946 GGGGCAGGGCGGAGGGTGGGCGG - Intergenic
1188166537 X:26870814-26870836 TTGGAAGGCCAGTGGGTTGGGGG - Intergenic
1188660628 X:32753494-32753516 GTGGCAGTGCAGAGGGTTTGTGG - Intronic
1192099053 X:68244413-68244435 GTGGTGTGCCAGAGGGTGGGAGG - Intronic
1192296572 X:69855605-69855627 GTGGAAGACCAGATGGTTGTAGG + Intronic
1196606520 X:117663388-117663410 GTGTCAGGACCCAGGGTTGGTGG - Intergenic
1197525091 X:127551437-127551459 GAGGCTGGGCAGAGGGTGGGAGG - Intergenic
1198386662 X:136135266-136135288 GTGGCAGGCCAGGGGGGTCTTGG + Intergenic
1198707577 X:139465410-139465432 GATGCAGGCCTGAGGGCTGGAGG + Intergenic
1200149072 X:153942711-153942733 GTGGAGGGCCTGAGGGCTGGAGG - Intronic
1200827277 Y:7658243-7658265 GTGCCAGGCCAAAGGTCTGGGGG + Intergenic
1201044825 Y:9871277-9871299 GTGGCAGGCCAGGGTGTTCTTGG - Intergenic
1202232599 Y:22671527-22671549 GTGCCAGGCCAAAGGTCTGGGGG - Intergenic
1202310557 Y:23524631-23524653 GTGCCAGGCCAAAGGTCTGGGGG + Intergenic
1202560245 Y:26145963-26145985 GTGCCAGGCCAAAGGTCTGGGGG - Intergenic
1202584158 Y:26406665-26406687 GAGGCAAGCCAGTGGGTTGCAGG + Intergenic