ID: 1019644397

View in Genome Browser
Species Human (GRCh38)
Location 7:2121329-2121351
Sequence CCACGGTGCCTGGCAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 1, 3: 71, 4: 429}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019644397_1019644410 5 Left 1019644397 7:2121329-2121351 CCAGCACCTGCCAGGCACCGTGG 0: 1
1: 1
2: 1
3: 71
4: 429
Right 1019644410 7:2121357-2121379 GGCAGGGATGAGGGAGGCTGCGG No data
1019644397_1019644409 -1 Left 1019644397 7:2121329-2121351 CCAGCACCTGCCAGGCACCGTGG 0: 1
1: 1
2: 1
3: 71
4: 429
Right 1019644409 7:2121351-2121373 GGGACAGGCAGGGATGAGGGAGG 0: 1
1: 2
2: 19
3: 152
4: 1234
1019644397_1019644408 -4 Left 1019644397 7:2121329-2121351 CCAGCACCTGCCAGGCACCGTGG 0: 1
1: 1
2: 1
3: 71
4: 429
Right 1019644408 7:2121348-2121370 GTGGGGACAGGCAGGGATGAGGG 0: 1
1: 1
2: 11
3: 101
4: 957
1019644397_1019644407 -5 Left 1019644397 7:2121329-2121351 CCAGCACCTGCCAGGCACCGTGG 0: 1
1: 1
2: 1
3: 71
4: 429
Right 1019644407 7:2121347-2121369 CGTGGGGACAGGCAGGGATGAGG 0: 1
1: 0
2: 4
3: 86
4: 627
1019644397_1019644411 24 Left 1019644397 7:2121329-2121351 CCAGCACCTGCCAGGCACCGTGG 0: 1
1: 1
2: 1
3: 71
4: 429
Right 1019644411 7:2121376-2121398 GCGGATACGCCACACACACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019644397 Original CRISPR CCACGGTGCCTGGCAGGTGC TGG (reversed) Intronic
900345290 1:2207583-2207605 ACACCATGCCTGGCAGGAGCTGG + Intronic
900498005 1:2985150-2985172 CCAGGGAGCCAGGCAGGGGCAGG + Intergenic
901016428 1:6234559-6234581 CCTCGGTGGCGGGCAGGGGCAGG - Intronic
901181720 1:7346707-7346729 CCATGGGGCCTGGCAGGAGGCGG + Intronic
901703048 1:11055700-11055722 CCACCGCGCCCGGCAGGGGCAGG + Intronic
901707833 1:11089668-11089690 CCACTGTGCCTGGCCAGAGCTGG - Intronic
902246432 1:15124083-15124105 CGGCGGTGCCTGGCAGCAGCTGG + Intergenic
902572533 1:17356022-17356044 CCTCAGTGCCCAGCAGGTGCAGG + Exonic
902645921 1:17797866-17797888 CCAATGTTCCTGGCAGGGGCTGG + Intronic
903365811 1:22804946-22804968 CCAGGGTCCCTGGCATGTCCAGG - Intronic
903552377 1:24166862-24166884 CCACAGTGCCTGGCCTGTGATGG + Intronic
904620325 1:31771436-31771458 TCAGGGTGCCTGGCATTTGCAGG + Intergenic
905164878 1:36074353-36074375 CCACTGTGCCTGGCCAGTGAGGG + Intergenic
906534835 1:46545692-46545714 CCCCGATGCCTGGCAGGGCCAGG - Intronic
906565060 1:46793744-46793766 CACCGGTGCCTGTCAGGTGGCGG - Intronic
907135718 1:52137936-52137958 CCATAGTGCCTGGCATGTGGAGG + Intergenic
907196540 1:52691759-52691781 CCACCGTGCCTGGCCTGTGGTGG + Intronic
911468159 1:98281334-98281356 CCACTGGGCCTGGCCTGTGCAGG - Intergenic
911773324 1:101775378-101775400 CCATGGTGCCAGACAGATGCTGG + Intergenic
914025145 1:143905825-143905847 CCACGGTGCCGGGCCGGTAGCGG + Exonic
914350398 1:146835192-146835214 CCGCCGTGCCGGGCCGGTGCTGG - Intergenic
914663582 1:149813540-149813562 CCACGGTGCCGGGCCGGTAGCGG + Exonic
915440648 1:155943430-155943452 ACCCAGGGCCTGGCAGGTGCTGG - Intergenic
915489709 1:156244266-156244288 CCACTGTGCCTGCCAGGCCCAGG + Exonic
916505112 1:165421817-165421839 CCACTGTGCCTGGCTGGCTCTGG + Intronic
917564353 1:176196750-176196772 CCACTGTGCCTGGCCAGTGCTGG - Intronic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
917660402 1:177171833-177171855 CCCTGGTGCCTGGCAGTGGCAGG + Intronic
918484862 1:185018291-185018313 CCACCATGCCTGGCCGGTGTTGG - Intergenic
921127181 1:212188257-212188279 CCACTGGGCCCGGCTGGTGCTGG - Intergenic
922375932 1:224965802-224965824 CCATGGTGCCTGGCAGGTAGTGG + Intronic
922701518 1:227763869-227763891 CCCCGCTCCCAGGCAGGTGCAGG + Intronic
924209959 1:241754603-241754625 CCACCTTGCCTGGCCCGTGCAGG + Intronic
1062926094 10:1316456-1316478 CCACGGTGCATGCCCTGTGCTGG + Intronic
1063210980 10:3881151-3881173 CCACTGTGCCTGGCTGGTTAGGG + Intergenic
1063665893 10:8060385-8060407 CCACGGTGCCTGGCAGGGGCTGG + Intronic
1064031526 10:11886049-11886071 CCTCGGAGACTGGCAGGGGCGGG + Intergenic
1065322532 10:24522707-24522729 CCACTGTGCCTGGCCAGTGAAGG - Intronic
1066559352 10:36652362-36652384 CCACCGTGCCTGGCCTGTGGTGG - Intergenic
1067723639 10:48749867-48749889 CCACGAGGCCTGGCAGGGGCTGG - Intronic
1069876837 10:71568296-71568318 CCAGGCTGCATGGAAGGTGCAGG - Intronic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1071152298 10:82649739-82649761 CCACTGCGCCTGGCTGGTGCAGG + Intronic
1072611102 10:97018248-97018270 CCATGGCACCTGGCAGGAGCAGG + Intronic
1073474079 10:103741570-103741592 CCAGGGTGGCTGGGAGGAGCTGG - Intronic
1073512496 10:104051576-104051598 CCCCGGTGCAGGGCAGGTGGGGG + Intronic
1073583585 10:104688448-104688470 CCACGCTGGCTGGCAGGCGCTGG - Intronic
1073771074 10:106736479-106736501 CCAAAGTGCCTGGCAGGTATTGG + Intronic
1074618355 10:115093071-115093093 CCCCGGTCCCTGTCAGGGGCGGG + Intergenic
1074854620 10:117464393-117464415 GCACAGTGCCTGGCATGTTCTGG + Intergenic
1074923931 10:118047220-118047242 GCCCAGTGCCTGGCAGGAGCAGG + Intergenic
1074945185 10:118274683-118274705 CCACGTTGTGTGCCAGGTGCTGG - Intergenic
1075663263 10:124213006-124213028 CCACGGTGCCTGGCCTGGGATGG - Intergenic
1075726441 10:124613133-124613155 CCAGGCTGCCTGGCAGGACCTGG + Intronic
1075729763 10:124629169-124629191 CCAGCCTGCCTGGCATGTGCTGG + Intronic
1075779561 10:125008232-125008254 CCACCGTGCCTGGCCGGCTCTGG + Intronic
1075866062 10:125719986-125720008 CCACGGTTCCCGGCAGATTCTGG + Intronic
1076024069 10:127098077-127098099 CCACGGTGCCTCCCAGGCACTGG - Intronic
1076110747 10:127857246-127857268 CCATGGTGCCTTGCAGATGCTGG + Intergenic
1076379299 10:130014272-130014294 CCACCGTGCCTGAAAGGTGGTGG + Intergenic
1076779454 10:132716141-132716163 GCAGGGTGCGTGGCGGGTGCAGG - Intronic
1076800531 10:132826006-132826028 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800546 10:132826069-132826091 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800555 10:132826107-132826129 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800564 10:132826145-132826167 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800574 10:132826183-132826205 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800584 10:132826221-132826243 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800594 10:132826259-132826281 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800609 10:132826322-132826344 CCACGGAGCCAGGCAGGAACTGG + Intronic
1076800633 10:132826436-132826458 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800641 10:132826474-132826496 CCACAGAGCCAGGCAGGAGCCGG + Intronic
1076800648 10:132826499-132826521 CCACGGAGCCAGGCAGGAACCGG + Intronic
1076800658 10:132826537-132826559 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800668 10:132826575-132826597 CCACGGAGCCAGGGAGGAGCCGG + Intronic
1076800678 10:132826613-132826635 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800688 10:132826651-132826673 CCACGGAGCCAGGGAGGAGCCGG + Intronic
1076800698 10:132826689-132826711 CCACGGAGCCAGGCAGGAGCCGG + Intronic
1076800706 10:132826727-132826749 CCACGGAGCCAGGCAGAAGCTGG + Intronic
1076800711 10:132826752-132826774 CCACAGAGCCAGGCAGGAGCTGG + Intronic
1076848629 10:133082252-133082274 CCAGGGAGCCAGGCAGGTGTCGG - Intronic
1077216417 11:1397013-1397035 CCAAGGGGCCTGACAGATGCTGG - Intronic
1077237173 11:1487322-1487344 CTGCGGTGCCTGGACGGTGCTGG + Intronic
1077506516 11:2932149-2932171 CCAGGGTGTCTAGCAGCTGCTGG - Intergenic
1078066494 11:8082302-8082324 CCACAGTGCCTGGCAGCAGAGGG - Intronic
1078090674 11:8262805-8262827 CCAGGGTGCCCGGCAGGCGAGGG - Intronic
1080858201 11:36130375-36130397 CCACGGGGGCTGGAAGGGGCTGG + Intronic
1081786755 11:45753098-45753120 CCACCGCGCCTGGCCTGTGCTGG - Intergenic
1082040446 11:47680489-47680511 CCACTGTGCCTGGCCAGTGGTGG - Intronic
1082821017 11:57544725-57544747 GCCTGGTCCCTGGCAGGTGCTGG + Intronic
1083758263 11:64802741-64802763 CCTCCGGGCCAGGCAGGTGCAGG + Intronic
1084021282 11:66419868-66419890 ACAGGGTCCCTGGTAGGTGCAGG + Intergenic
1084398098 11:68927850-68927872 CCCCCGGGGCTGGCAGGTGCTGG + Intronic
1084965066 11:72740167-72740189 CAAAGGTGCCTGGCAGGTGTAGG - Intronic
1085063788 11:73473449-73473471 CCACAGTACCTGGCACCTGCTGG + Intronic
1085503466 11:77042043-77042065 CCAAGATGACTGGCAGCTGCTGG - Intergenic
1086073946 11:82830338-82830360 CCACCGTGCCTGGCCAGCGCAGG - Intronic
1087062657 11:93996974-93996996 CCACTGTGCCTGGCCTGTGTTGG - Intergenic
1088754998 11:112878334-112878356 CCAGGGAGGCTGGCAGCTGCTGG + Intergenic
1089337679 11:117736217-117736239 CCACGAGGCTTGGCTGGTGCTGG + Intronic
1089339164 11:117745925-117745947 CCACCGCGCCTGGCCTGTGCAGG - Intronic
1089381014 11:118031848-118031870 CCACCATGCCTGGCCGATGCTGG - Intergenic
1089468384 11:118701086-118701108 CCACTGTGCCTGGCTGGTGGTGG + Intergenic
1089621074 11:119722546-119722568 CCAGGGAGCGAGGCAGGTGCCGG + Intronic
1089730331 11:120515041-120515063 CCAAGATGCCTTGCAGGTGAAGG + Intronic
1089812887 11:121146057-121146079 CCCCTGAGTCTGGCAGGTGCTGG - Exonic
1091754250 12:3041313-3041335 CCAGGGTGCCTGTTAGGTGGAGG + Intergenic
1091929358 12:4382559-4382581 CCATCATGCTTGGCAGGTGCTGG - Intergenic
1092143692 12:6200662-6200684 GCCCGGTGCCTGCCCGGTGCGGG - Intronic
1092735820 12:11581511-11581533 CCACAGTGCCTGACACATGCTGG + Intergenic
1092860916 12:12718124-12718146 CAAAGGTGCCTGCAAGGTGCCGG + Exonic
1094843469 12:34351511-34351533 ACACCCTGCCTTGCAGGTGCGGG - Intergenic
1095960653 12:47832642-47832664 CCAGGGTGCCTGGGAGCTGGAGG - Intronic
1096496416 12:52041836-52041858 CCAGGCTGCCTGGGAGGGGCAGG - Exonic
1096619787 12:52857076-52857098 CCATGGTGCCTGGCACTTGGTGG - Intergenic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101504877 12:105337034-105337056 CCACCGTGCCCGGCCCGTGCTGG - Intronic
1102256223 12:111416779-111416801 CCACCGCGCGTGGCTGGTGCTGG + Intronic
1103139888 12:118539404-118539426 GCACAGTGCCTGGCACGTGCTGG + Intergenic
1103374172 12:120442270-120442292 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1103399302 12:120632080-120632102 CCACGGTGGCTGGAATGTGGTGG + Intergenic
1103523676 12:121552943-121552965 CCACCGTGCCCGGCTGGTACTGG - Intronic
1103719818 12:122967130-122967152 CCTCAGTGACTGCCAGGTGCTGG + Intronic
1103783918 12:123417870-123417892 CCACTGTGCCTGGCCTGTTCTGG + Intronic
1104487986 12:129168431-129168453 CCACAGGGGCTGGCAGGAGCAGG - Intronic
1104726087 12:131076569-131076591 CCAAGGGCCCTGGCAGGTGCCGG - Intronic
1104864472 12:131944712-131944734 TCCCGGTGCCAGGCAGGTGGGGG + Exonic
1106008225 13:25791600-25791622 CCACTCTGCCTGGAAGTTGCTGG + Intronic
1107453653 13:40535397-40535419 CCATGGTGCCAGGCCGGTTCTGG - Intergenic
1108087355 13:46807724-46807746 CACCGGTGCCTGTCAGGGGCTGG - Intergenic
1108498128 13:51044861-51044883 CAACGAGGCCTGGCAGGTGATGG - Intergenic
1109132866 13:58610821-58610843 CCACTGGGCCTGGCAGGTCTCGG - Intergenic
1109584350 13:64378482-64378504 CCACAGTGCCTGGCTGATGTAGG - Intergenic
1113930908 13:113968376-113968398 CCACCGTCCCGGGCAGGTCCAGG + Intergenic
1114480859 14:23033560-23033582 CCATGGTGCCTAGCAGGTATGGG + Exonic
1116978456 14:51141985-51142007 CCACCGTGCCTGGCCGGGGTGGG + Intergenic
1119330947 14:73793194-73793216 CCACCGTGCCTGGCTGGTTGTGG - Intergenic
1119665670 14:76483347-76483369 GCACAGTGTCTGGCATGTGCTGG + Intronic
1120127137 14:80758232-80758254 CCACCATGCCTGGCAGGTTAAGG - Intronic
1121022875 14:90592419-90592441 CCACCGCGCCTGGCCTGTGCAGG - Intronic
1122248960 14:100424778-100424800 ACAAGGTGCCTGGCAGAAGCTGG - Intronic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122574378 14:102732456-102732478 GCACGGTGCTTGGGAGCTGCAGG - Intergenic
1122873287 14:104651126-104651148 CCACTGTGCCCGGCAGATGCTGG - Intergenic
1122881480 14:104692391-104692413 GCACGGTGCCAGGCAGGTGCAGG + Intronic
1122981755 14:105195272-105195294 CCACTGTGCCTGGGAGCTGGAGG + Intergenic
1122983327 14:105201324-105201346 CCACAGAACCTGGCAGGTGGAGG - Intergenic
1123139436 14:106061109-106061131 CCACGGTGGATGGCAGATGCAGG + Intergenic
1202904332 14_GL000194v1_random:59776-59798 CCATGCTGCCTGGCAGAGGCTGG + Intergenic
1124634722 15:31357701-31357723 CTCTGGTTCCTGGCAGGTGCAGG + Intronic
1124982739 15:34580777-34580799 CCTGTGTGCCTGGCAGGGGCTGG - Intronic
1125220473 15:37327015-37327037 CCCCGGGGCCTGTCAGGGGCTGG - Intergenic
1125548432 15:40525960-40525982 CCACGGTGACTTGCAGGTCATGG - Intergenic
1128516959 15:68348347-68348369 ACATGGGGCCTGGCATGTGCAGG + Intronic
1128545089 15:68561278-68561300 TCACCGTGCCTGGGAGGAGCTGG - Intergenic
1129629809 15:77246292-77246314 CCACTGTGCCTGGCCCCTGCTGG + Intronic
1130320107 15:82834321-82834343 CCACCGTGCCTGGCTGATGCTGG + Exonic
1130402064 15:83566485-83566507 CCATTGTGCCTGGCCAGTGCCGG - Intronic
1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG + Intergenic
1131253326 15:90845215-90845237 CCAGGGGGCCTGGCAGGCCCTGG - Intergenic
1132113155 15:99116960-99116982 CCCCTGTGCCTAGCCGGTGCTGG + Intronic
1132235228 15:100215103-100215125 GCACTGTGCCTGGCAGGTTCCGG + Intronic
1132518216 16:375815-375837 CCACCGCGCCCGGCCGGTGCTGG + Intronic
1133225157 16:4337389-4337411 GCACGGTGCCTGGCAGCAGGGGG - Exonic
1133344139 16:5058950-5058972 CCACCGCGCCTGGCTGGTGCAGG - Intronic
1133730277 16:8572721-8572743 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1134626927 16:15729019-15729041 CCATAGTCCCTGGGAGGTGCTGG + Intronic
1134751469 16:16628663-16628685 CCACCGTGCCTGGCCTGTACAGG - Intergenic
1135246489 16:20861502-20861524 TCACAGTGCCTGGCACATGCTGG + Intronic
1135408796 16:22217738-22217760 CCACCGTGCCTGGCTGGTTTGGG + Intronic
1136291406 16:29274503-29274525 CCACTGTGCCTGGCAGCTGGGGG - Intergenic
1136425326 16:30166261-30166283 CCACCGGGCCTGGCTGGTGAGGG + Intergenic
1136687300 16:32002950-32002972 CCATGGTGGCTGGCAGGGGAGGG - Intergenic
1136787912 16:32946501-32946523 CCATGGTGGCTGGCAGGGGAGGG - Intergenic
1136881869 16:33907288-33907310 CCATGGTGGCTGGCAGGGGAGGG + Intergenic
1138448403 16:57078756-57078778 CCACCATGGCTGGCTGGTGCTGG + Intronic
1138566409 16:57836398-57836420 CCACTGTGCCTGGCCAGTGCAGG + Intronic
1138682689 16:58697532-58697554 CCACAGCGCCTGGCGGGTACTGG - Intergenic
1138905368 16:61324977-61324999 CCACTGTGCCTTGCTGGTGGTGG - Intergenic
1139367125 16:66440416-66440438 CCACAGTGCCTGGCCCCTGCTGG + Intronic
1139458874 16:67106597-67106619 AGAAGGTGCCTGGCAGGAGCAGG - Intergenic
1139612025 16:68066092-68066114 ACTAGGTGCCAGGCAGGTGCTGG + Intronic
1139983640 16:70880344-70880366 CCGCCGTGCCGGGCCGGTGCTGG + Intronic
1140439696 16:74978066-74978088 CCACTGTGCCTGGCCAGTCCTGG - Intronic
1140949270 16:79800576-79800598 CCACTGTGGCTGGCTGGTGTAGG - Intergenic
1141053900 16:80798328-80798350 CCACAGTGCCCGGCCTGTGCAGG + Intronic
1141423773 16:83932783-83932805 CCACGGAGCCTGTTAGGTGGAGG + Intronic
1141816925 16:86417226-86417248 CCAGGGAGCCTGGGAAGTGCGGG + Intergenic
1142097280 16:88248422-88248444 CCACTGTGCCTGGCAGTTGGGGG - Intergenic
1203090142 16_KI270728v1_random:1208158-1208180 CCATGGTGGCTGGCAGGGGAGGG - Intergenic
1142567097 17:847446-847468 GCACGGAGCCTGGCACGTGAAGG + Intronic
1143122001 17:4613972-4613994 CCACCGTGCCTGGCCTATGCAGG - Intergenic
1144887173 17:18471270-18471292 CCAGGCTTCCTGGCATGTGCCGG - Intergenic
1145145043 17:20473025-20473047 CCAGGCTTCCTGGCATGTGCCGG + Intergenic
1145780870 17:27562262-27562284 CCCCAGTGCCTGGCATGTGGTGG + Intronic
1145908850 17:28531239-28531261 CCACGGTGACTGGGAGGTCGGGG + Intronic
1146314963 17:31799655-31799677 CCACCATGCCTGGCTTGTGCAGG - Intergenic
1146590044 17:34121025-34121047 CCACCGTGCCTGGCCAGTACTGG + Intronic
1146736373 17:35242483-35242505 CACCTATGCCTGGCAGGTGCTGG + Intergenic
1146774032 17:35596583-35596605 CCGCCGGGCCTGGCAGGCGCGGG - Intronic
1146905641 17:36616159-36616181 CCACAGGGCCAGGCACGTGCTGG + Intergenic
1147949842 17:44101116-44101138 CCACTGTGCCCGGCTGGAGCAGG - Intronic
1147988069 17:44317917-44317939 GCACGGTGCCTGGCACAGGCAGG + Intronic
1148158388 17:45436366-45436388 CAACGGTGGCAGGCAGGTGGAGG - Exonic
1148905647 17:50910207-50910229 CCACGGGGCCAGGCAGTTGAGGG - Intergenic
1149749993 17:59136449-59136471 CCACTGTGCCTGGCCAGTACTGG + Intronic
1150132831 17:62678551-62678573 CCAGGGGGCCTGCCAGGAGCTGG + Exonic
1150625058 17:66836124-66836146 CCGGCGTGCCTGGCAGGTACCGG - Intronic
1150979889 17:70129111-70129133 CCACTGGGCCTGGAAGCTGCGGG - Intronic
1151151893 17:72095428-72095450 CCAGGCTGCCTGGCCAGTGCAGG + Intergenic
1152145775 17:78567895-78567917 GCACTGTGCCTGGTAGGTGCAGG - Intronic
1152178083 17:78800844-78800866 CCAGGGTCCATGCCAGGTGCTGG - Intronic
1152234401 17:79130940-79130962 GCACGCTGCCTTGCAGGTGCGGG - Intronic
1152467827 17:80475849-80475871 CCGCGGGGCCTCGCAGGCGCGGG + Intronic
1152500891 17:80708408-80708430 CCAAGCTGCCCTGCAGGTGCAGG + Intronic
1152613224 17:81325830-81325852 CCCCGGCGTCGGGCAGGTGCTGG - Intronic
1152634170 17:81423631-81423653 CCAGGGTGCCTGGCTGGAGTGGG + Intronic
1152750619 17:82060854-82060876 CTGCGGTGTCAGGCAGGTGCTGG - Exonic
1152885118 17:82845085-82845107 CCAGGGACCCAGGCAGGTGCTGG + Intronic
1152932382 17:83116417-83116439 CCAGGGCGCCTGTCAGCTGCAGG - Intergenic
1153340383 18:3967250-3967272 CCACAGTGCCTGGCAGTGCCTGG - Intronic
1153976274 18:10270990-10271012 ACACGGCCCCTGGCAGGTGAGGG - Intergenic
1154985498 18:21546832-21546854 CCACCGTGCCTGGCTGGTTTAGG + Intronic
1156395069 18:36691827-36691849 CCTCGGTGCCTTGCATTTGCAGG - Intronic
1156687952 18:39672782-39672804 CCACTGTGCCTGGCTGGGGTGGG - Intergenic
1157419799 18:47537429-47537451 CCACTGTGCCTGGCCTGTCCTGG - Intergenic
1158697749 18:59717820-59717842 CCACTGTGCCTGGCCTGTGATGG - Intergenic
1158745640 18:60196535-60196557 CCATGGTGGCTAGAAGGTGCAGG - Intergenic
1158932389 18:62334450-62334472 ACACAGAGCCTGGCAGGTGGTGG - Intronic
1159348271 18:67235995-67236017 CAATGCTGCCTGGCAGGTGATGG - Intergenic
1160445919 18:78926609-78926631 CCACCGTGCCTGGCAATTTCCGG - Intergenic
1160549494 18:79684481-79684503 CCACCCTGCCTGGCTGGTGCTGG - Intronic
1160745439 19:709100-709122 CCGCGGTGCCGGGCGGGGGCGGG - Exonic
1161676567 19:5653748-5653770 CCACCATGCCTGGCCGGGGCAGG + Intronic
1161683934 19:5693979-5694001 CCTCTGTGGCTGGCAGCTGCTGG - Intronic
1162088170 19:8261130-8261152 CCACGGAGGCTGGGAGGGGCGGG - Intronic
1162098307 19:8324133-8324155 CCAGAGCGCCTGGCAGGGGCTGG - Intronic
1162445678 19:10721077-10721099 CCATGGTGTCTGGCAGCTGCCGG + Intronic
1163038155 19:14583537-14583559 CCACAGTGCCCGGCATGGGCTGG - Intronic
1163039588 19:14592461-14592483 GCACAGTGCCTGGCATGGGCTGG - Intronic
1163801546 19:19368700-19368722 CCACCGTGCCCGGCCTGTGCTGG - Intergenic
1164715931 19:30390411-30390433 CCAGGGTGGCAGGCAGCTGCAGG + Intronic
1164930939 19:32175413-32175435 CCACCGTGCCTGGCTGATGCTGG + Intergenic
1165224847 19:34347512-34347534 CCACTGTGCCTGGCTGATGCTGG + Intronic
1165860156 19:38905207-38905229 CCAGGATGGCTGCCAGGTGCAGG - Exonic
1167045320 19:47045955-47045977 CCGTGGGGCCTGGCAGGCGCTGG - Exonic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167491748 19:49796515-49796537 CCCTGGCCCCTGGCAGGTGCTGG - Intronic
1167836904 19:52080422-52080444 CCCCAGTGCATGGCAGGGGCTGG - Intronic
1167852047 19:52209687-52209709 CTACGGTGGCTGCCAGGGGCTGG - Intronic
1168378132 19:55898066-55898088 CCATGGTGGGTGCCAGGTGCTGG - Intronic
1168378530 19:55900961-55900983 CCACTGTGCCTGGCCGGTCAAGG - Intronic
1168663681 19:58186262-58186284 CTACCGTGCCTGGCAGGGACAGG - Intronic
925135261 2:1522237-1522259 GCACGGTGGCGGGCAGGTGTGGG - Intronic
925135282 2:1522318-1522340 GCACGGTGGCAGGCAGGTGTGGG - Intronic
925135302 2:1522398-1522420 GCACGGTGGCAGGCAGGTGTGGG - Intronic
925135311 2:1522438-1522460 GCACGGTGGCAGGCAGGTGTGGG - Intronic
925171269 2:1751573-1751595 CCACGGTGAGAGGCAGCTGCAGG + Intergenic
925258672 2:2511141-2511163 CCACAGTGCCTGACAGGGTCTGG - Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927544752 2:23942704-23942726 CCACCGTGCCCGGCTGATGCAGG + Intronic
927657287 2:24959959-24959981 CCACAGGGCCTAGCAGATGCAGG + Intronic
927702178 2:25275692-25275714 GCACTGTGCCTGGCATGTGGTGG - Intronic
928851589 2:35754046-35754068 CCACCGTGCCCGGCTGGTACTGG - Intergenic
930097148 2:47573407-47573429 CAGCGATGACTGGCAGGTGCAGG - Intergenic
930873971 2:56193176-56193198 CCACTGTGCCTGGCGTGTTCAGG - Exonic
934166414 2:89298150-89298172 CGATGGTACCTGGCAGGTGGAGG - Intergenic
934200862 2:89884306-89884328 CGATGGTACCTGGCAGGTGGAGG + Intergenic
934517566 2:94998343-94998365 CCGCGGTGCCTGGGAGGGGAGGG + Intergenic
934563743 2:95326999-95327021 CCACAGTGCTCGGCACGTGCCGG + Intronic
934655308 2:96114258-96114280 TCGCGGTCCCTGGCAGGCGCTGG - Exonic
934892636 2:98084042-98084064 CCACGGTGCCTGGCCGGGGAGGG + Intergenic
935268898 2:101416705-101416727 CGACAGGGCATGGCAGGTGCAGG + Intronic
935330846 2:101976609-101976631 CCACGGTCACTGGCAGATTCCGG + Intergenic
936399820 2:112156581-112156603 GCACGGTGCTGGGCAGGTACGGG + Intronic
937346798 2:121131084-121131106 CCACTGTGCCCGGCCTGTGCAGG - Intergenic
938064649 2:128274641-128274663 CCACTGGGCCTGTCAGGAGCAGG + Intronic
940470949 2:154099648-154099670 CCTCCGTGCCTGACCGGTGCTGG - Intronic
941987615 2:171523558-171523580 CCTCGGTGCCAGGCAGCCGCGGG - Intronic
943248174 2:185483238-185483260 CCACTGAGCCTGGCAGGGACTGG - Intergenic
944662034 2:201929242-201929264 CCAGGGTGCCTGGAAGGGCCTGG + Intergenic
945710035 2:213284284-213284306 CCACGGTAACTGGGAGGCGCGGG + Intergenic
945985238 2:216348324-216348346 CCACCGTGCCTGGCCGGTTAAGG + Intronic
946322104 2:218960215-218960237 CGACGGTGGCTCGCAGGTGGCGG - Exonic
946387808 2:219395896-219395918 CCTCAGTGCCTGGCAGGTAGTGG + Intronic
946595196 2:221298324-221298346 CCATGGTGCCTTCCATGTGCTGG - Intergenic
947829763 2:233130661-233130683 CCACGGGGGCGGGCAGGTGGGGG + Intronic
948776468 2:240291428-240291450 CAACAGTGCGTGGCAGGGGCAGG + Intergenic
948945157 2:241215621-241215643 GCTCTGTGCCTGGCAGGAGCAGG + Intronic
949018423 2:241726603-241726625 CGCAGGTGCCAGGCAGGTGCAGG + Exonic
1169105521 20:2991064-2991086 CCACTGTGCCTGGCAGGATGTGG - Intronic
1169732770 20:8804078-8804100 CCACGGTGCCTGGCCTGCCCTGG + Intronic
1170026196 20:11891367-11891389 CCTCGGCGCCTAGCAGGTGGCGG + Intronic
1171087020 20:22247083-22247105 TCTCGGTGCATGGCAGGTGCAGG - Intergenic
1171142341 20:22754123-22754145 CCATGGTGCCTGGCACATGGTGG - Intergenic
1172278739 20:33695569-33695591 CCACCGTGCCTGGCCGGGGAAGG + Intergenic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1174664363 20:52243711-52243733 CCACCGTGCCTGGCAGATGTTGG + Intergenic
1176082802 20:63282377-63282399 CCAAGGTGCCTGGACTGTGCTGG + Intronic
1179172730 21:38985272-38985294 CCACGGTCCCTGGCTGGGCCAGG + Intergenic
1179591499 21:42412252-42412274 CCACGGAGCCCGACAGGTGCTGG - Intronic
1179887463 21:44320312-44320334 CCACTGTGGCTGGCAGGTCCCGG + Intronic
1179944934 21:44666785-44666807 GCAGGATGCCTGGCAGGAGCTGG + Exonic
1179946569 21:44682052-44682074 ACAGGATGCCTGGCAGGGGCTGG + Exonic
1180048239 21:45319569-45319591 GCACCGCGGCTGGCAGGTGCAGG - Intergenic
1180061586 21:45388118-45388140 CCATGGTCCCTGCCAGGAGCTGG + Intergenic
1180063647 21:45402255-45402277 CAAAGGGCCCTGGCAGGTGCAGG + Intergenic
1180232670 21:46436716-46436738 CCACGGGGCCTGGCAGGCGGTGG + Intronic
1181109124 22:20591164-20591186 CCATGGTGCCAGGCAGGACCTGG + Intergenic
1181155857 22:20919980-20920002 CTGCGGTTCCTGGCAGATGCTGG + Intronic
1181579826 22:23821988-23822010 CCACTGTGCCTGGCCAGAGCTGG + Intronic
1182562417 22:31170938-31170960 CCACTGTGCCTGGCATGTGGGGG + Intronic
1183053995 22:35290356-35290378 CCACCGCGCCTGGCTGGTACAGG - Intronic
1183953319 22:41364657-41364679 CCACCGTGCCTGGCCTCTGCAGG - Intergenic
1183961244 22:41413141-41413163 CCACCGTGCCTGGCCGAGGCTGG - Intergenic
1184676439 22:46045650-46045672 CAAGTGAGCCTGGCAGGTGCTGG + Intergenic
1184739261 22:46417669-46417691 CCCAGGTCCCTGGCAGGTGAGGG - Intronic
1184751137 22:46487545-46487567 CCACGGTGCAGTGCAGGTGGGGG + Intronic
1184986844 22:48141620-48141642 CCACGGTGCCTGGGAAGACCAGG + Intergenic
1185288906 22:50014454-50014476 CCACGGGGTGTGGCTGGTGCTGG + Intergenic
1185329606 22:50246262-50246284 CCACGCGGCAAGGCAGGTGCTGG - Intronic
950561222 3:13728036-13728058 CCACTGTGCCCGGCCGGTCCAGG + Intergenic
950572694 3:13811789-13811811 ACACTGGGCCAGGCAGGTGCAGG + Intergenic
951176379 3:19605774-19605796 CCACAGTGCCCGGCAGAAGCAGG - Intergenic
951385734 3:22040003-22040025 CAACGGTGCATGGCGGGAGCAGG - Intronic
952377278 3:32778303-32778325 CCACCGTGCCTGGCCTTTGCTGG + Intergenic
953918876 3:46938213-46938235 CCACTGAGCTGGGCAGGTGCAGG - Intronic
953925595 3:46980846-46980868 GCATGATGCCAGGCAGGTGCAGG - Intronic
954154709 3:48679046-48679068 CCACCCCACCTGGCAGGTGCAGG + Exonic
954312675 3:49782521-49782543 CCACTGTGCCTGGCTTGTGATGG - Intronic
954456991 3:50604999-50605021 TCAAGGTGCCTGCCAGGTGCTGG - Intergenic
954481203 3:50803626-50803648 CCACGCTGTCTGGGAGGTGGGGG - Intronic
954709948 3:52500591-52500613 CCACGGTGCATGGCTGGAGCCGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
954961353 3:54567815-54567837 CCACTGTGCCTGGCTGGAGATGG + Intronic
954977437 3:54709635-54709657 CCACCATGCCTGGCAAGTGATGG - Intronic
956198445 3:66677887-66677909 CCACTGTGCCTGGCCTGGGCTGG + Intergenic
956825568 3:72994681-72994703 ACCTGGTGCCTGGCAAGTGCTGG + Intronic
958733200 3:97980055-97980077 CCACTGGGCCTGGCAGGAGAGGG + Intergenic
958867895 3:99522490-99522512 ACAAGCTGCCTGGCAGGAGCTGG + Intergenic
959423748 3:106160074-106160096 CCACTGTACCTGGCAGGTTTTGG - Intergenic
960910791 3:122647463-122647485 CCACGGTGCCTGGCCTCTGCTGG - Intergenic
960917958 3:122716406-122716428 ACATGGTGCCTTGCAGATGCAGG - Intronic
960986585 3:123284955-123284977 TCACAGTGCCTGGCACGAGCAGG - Intronic
961158344 3:124700227-124700249 CCAGGGAACTTGGCAGGTGCAGG - Intronic
961547414 3:127644863-127644885 CCAGGAGGCCAGGCAGGTGCAGG + Intronic
961657391 3:128450775-128450797 CCACTGTGGCTGGCAGGTGGTGG - Intergenic
962273891 3:133997983-133998005 TCACGGTGCCGGGGAGGTGCTGG + Intronic
962403086 3:135078215-135078237 CCACTGTGCCTGGCAGGGGGAGG + Intronic
966065971 3:175822347-175822369 GCATGGTGCCAGGAAGGTGCTGG - Intergenic
966542912 3:181111689-181111711 CCACTGTGCCTGGCTGATGGTGG - Intergenic
967096446 3:186181243-186181265 CCATGGTGCCTGGCACGTGGTGG + Intronic
967469248 3:189843268-189843290 CCACTGGGCCTGGCAGGTGGTGG - Intronic
968020758 3:195386627-195386649 CAGCGGAGCCTGTCAGGTGCGGG + Intronic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
968549906 4:1216818-1216840 CCACCGTGTCTGGCTGGGGCCGG + Intronic
968567470 4:1321759-1321781 CCATGGTCTCTGGCAGGGGCAGG - Intronic
968641710 4:1718066-1718088 CCACGACCCCTGGGAGGTGCTGG - Intronic
968778446 4:2560228-2560250 CCACCGCGCCTGGCCTGTGCAGG + Intronic
968976430 4:3824535-3824557 CCAAGGTGGCTGGCAGGAGCCGG - Intergenic
969357718 4:6640344-6640366 CCACCGCGCCTGGGAAGTGCGGG + Exonic
969455120 4:7296083-7296105 CCAGGCAGGCTGGCAGGTGCTGG - Intronic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973019729 4:45187646-45187668 CCACTGTGCCTGGCTGCTCCTGG - Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
975521004 4:75300782-75300804 CCACTGAGCCAGGCAGGCGCGGG + Intergenic
976264760 4:83180069-83180091 CCACCGCGCCTGGCTGGTCCTGG + Intergenic
976437038 4:85030024-85030046 CCACTGTGCCTGGCCTCTGCTGG + Intergenic
977032840 4:91908620-91908642 CCACGGCGCCTGGTAGATTCTGG - Intergenic
977813565 4:101386885-101386907 CCACCATGCCTGGCAGTTGCTGG + Intergenic
978764355 4:112389329-112389351 CCACCGTGCCTGGCCTGTGCTGG + Intronic
980541433 4:134201498-134201520 ACCCGGTACCTGGCAGGTTCGGG - Intronic
982291604 4:153788337-153788359 CCTCGGTGGCTGGCAGGAGGTGG + Exonic
982534093 4:156586776-156586798 CCACAGTGCCTGGCAAGTGTTGG - Intergenic
984202675 4:176745424-176745446 CCTCGGTTCCTGGCAGGTTCAGG - Intronic
985253698 4:188047927-188047949 CCACCGTGCCTGGCCTGTGTGGG + Intergenic
989094490 5:37769034-37769056 CCACTGTGCCTGGCCTGTTCAGG + Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
993795246 5:92258708-92258730 CCACGGGGCCTGTCGGGGGCTGG - Intergenic
993934758 5:93986346-93986368 CCACCGTGTCTGGTAGGTGAGGG + Intronic
997955230 5:138274169-138274191 CCAGGGTGCCTGCAAGGGGCTGG - Intronic
998443670 5:142182180-142182202 CCACTGTGCCTGGCCGGGACTGG - Intergenic
998504860 5:142664253-142664275 GCACGCTGCCTGGGAGGTGGGGG - Intronic
999285442 5:150391687-150391709 CCACGGAGCGTAGAAGGTGCAGG + Intronic
999317002 5:150590760-150590782 GCACGGTGCCTGACACGTGAAGG + Intergenic
999709951 5:154309237-154309259 CCACTGTGCCTGGCTTGTGGAGG + Intronic
1001082067 5:168674777-168674799 CCACCGTGCCTGGCTGGTTATGG + Intronic
1001907645 5:175486336-175486358 CCAGGTTGCATGGCAGATGCTGG - Intronic
1002216098 5:177634326-177634348 CCACCGTGCCTAGCCGGTGATGG - Intergenic
1002282342 5:178138911-178138933 CCACTGTGCCTGGCAATTTCTGG - Intronic
1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG + Intronic
1003549901 6:7093869-7093891 CCACGGTGCCCGGCCTGTTCTGG + Intergenic
1003858367 6:10298778-10298800 CCACCATGCCTGGCTGGTTCTGG + Intergenic
1005456004 6:26020609-26020631 CCACGGTGCCCGGCCGGTAGCGG - Exonic
1005651658 6:27890651-27890673 CCACGGTGCCTGGCCTGTAGCGG + Exonic
1006367881 6:33626220-33626242 CCGCCGTGCCTGGCCGTTGCTGG + Intronic
1006392096 6:33764465-33764487 CAACAGTGGCTGGCAGGGGCTGG - Intergenic
1006430923 6:33995216-33995238 CCCCGGGCCCTGGGAGGTGCTGG + Intergenic
1006983271 6:38162307-38162329 CCGCGGGGCCTGGAAGGGGCAGG - Intergenic
1007414314 6:41683199-41683221 CCCCGGTGCCTGGCGGGAACAGG - Intergenic
1007539543 6:42628432-42628454 CCACTGTGCCTGGCCAGTACTGG - Intronic
1007642203 6:43350548-43350570 CCACTGTGCCTGGCCTGTGATGG - Intronic
1010257029 6:73770455-73770477 CCACAGTGCCTGGCCCCTGCTGG - Intronic
1010585578 6:77654300-77654322 CCACAGTGCCTGACAGGTTGGGG + Intergenic
1012043033 6:94234333-94234355 GCACGCAGACTGGCAGGTGCAGG - Intergenic
1014867757 6:126552574-126552596 CCACCGTGCCTGGCCAGTGATGG + Intergenic
1018178983 6:161203683-161203705 CCACAGCGCCCGGCTGGTGCTGG + Intronic
1018724166 6:166597870-166597892 GCACGGTGCCCGGCTGGGGCTGG - Intronic
1019031910 6:169020917-169020939 CCTCAGTGCCTGGCATGTGATGG + Intergenic
1019351511 7:556234-556256 AAACGGTGCCTGGCACGTGGTGG - Intronic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1019927553 7:4203231-4203253 CCACGATGGCTGTCAGGTGAGGG + Intronic
1019969324 7:4527504-4527526 CCACCGTGCCTGTCAAGTGCAGG - Intergenic
1020128354 7:5545660-5545682 CCACGGTGCCTGCTGTGTGCTGG - Intronic
1022442759 7:30447378-30447400 GCTCGGTGACTGGCAGGTGATGG + Intronic
1023011056 7:35925101-35925123 CCACTGTGCCTGGCCAGAGCTGG - Intergenic
1023042924 7:36188081-36188103 CCACTGTGCCTGGCCTGTGCTGG + Intronic
1023513877 7:40981041-40981063 CCACTGGGCCTGGAAGGTGGAGG - Intergenic
1024563052 7:50660562-50660584 CCACGGCACTTGGAAGGTGCTGG - Intronic
1024611600 7:51069458-51069480 CCGCAGTGCATGGCAAGTGCCGG + Intronic
1025998686 7:66544561-66544583 CCACTGTGCCTGGCTGTAGCTGG - Intergenic
1026043198 7:66886163-66886185 CCACAGGGCCTGGTAGGAGCTGG + Intergenic
1026510950 7:71027077-71027099 CCACAGTCCCTGGAATGTGCAGG - Intergenic
1026643709 7:72149824-72149846 CCACGGTGCCTGGCCTGTCCTGG - Intronic
1026830064 7:73605269-73605291 CCACCATGCCTGGCAGGTCTGGG - Intronic
1026991642 7:74589408-74589430 CCACTGTGCCTGGCTGCAGCTGG - Intronic
1027045285 7:74987115-74987137 CCACTGCGCCCGGCCGGTGCTGG - Intronic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027146097 7:75695860-75695882 CCACCGTGCCTGGCTGGTACTGG + Intronic
1027211230 7:76150402-76150424 ACTCGGTGCCTGGCATGCGCCGG - Intergenic
1029008955 7:97238645-97238667 CCACCGTGTCTGGCTGGAGCTGG + Intergenic
1029156499 7:98521264-98521286 ACATGGTGCCTGGCACGTGGTGG + Intergenic
1029157752 7:98529233-98529255 CCACTGCGCCTGGCAGGTTGGGG - Intergenic
1029363720 7:100104228-100104250 CCACTGTGCCCGGCCGTTGCTGG - Intronic
1029387529 7:100253392-100253414 CCACTGCGCCCGGCCGGTGCTGG + Intronic
1029541009 7:101181956-101181978 CCACCGTGCCCGGCCGATGCAGG + Intergenic
1029857865 7:103536862-103536884 CTACGGAGCCTGGCACGTGCTGG + Intronic
1033141915 7:138834863-138834885 CTACGGTGCCTGGGAGGTGGCGG + Intronic
1033183337 7:139202076-139202098 CCACTGTGCCTGGCTGGTAAAGG - Intergenic
1033329928 7:140409405-140409427 CCACCGTGCCTGGCAGTTTATGG - Intronic
1033657655 7:143383774-143383796 GCACAGTGCCTGGCACGTGGTGG - Intronic
1033958271 7:146879650-146879672 CCACAGTCCCTGCCAGGTTCTGG - Intronic
1034490716 7:151391844-151391866 TCACGGTGCGTGGGAGGGGCGGG - Intronic
1034523467 7:151639066-151639088 CCACTGTGCCTGACATGTCCAGG + Intronic
1034732619 7:153400963-153400985 CCACGGAGCTGGGCAGGAGCGGG - Intergenic
1035315102 7:157992718-157992740 CCACGGTGCCTGGGGGCTCCTGG - Intronic
1035481813 7:159192818-159192840 CCAGGGGACCTGGCAGTTGCAGG + Intergenic
1036760123 8:11502932-11502954 CCACAGTGGCTGGCAGCAGCTGG - Intronic
1039019161 8:33186059-33186081 CCACCGTGCCTGGCCTGTGATGG + Intergenic
1039088696 8:33805292-33805314 CCACAGTGCCTGGCCAATGCAGG + Intergenic
1039470212 8:37808662-37808684 CCACTGTGCCTGGCTGGGTCTGG - Intronic
1039885106 8:41650060-41650082 CCCCGGGGCCTGGCGGGTGCCGG + Intronic
1040778663 8:51079166-51079188 CCACCGTGCCTGGTCAGTGCTGG - Intergenic
1041006989 8:53505039-53505061 CCACCGCGCCTGGCCTGTGCTGG - Intergenic
1042246410 8:66712822-66712844 CCGCGGGGCCAGGTAGGTGCGGG + Intronic
1042246658 8:66714892-66714914 GGACAGTGCCTGGCACGTGCAGG + Intronic
1042847670 8:73184918-73184940 CCAGGGCGGCTGGCAGCTGCAGG - Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044624584 8:94224396-94224418 TCAGAGAGCCTGGCAGGTGCTGG + Intergenic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045023593 8:98064815-98064837 CCACCCCGCCTGGCAGGAGCCGG + Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1048385869 8:133912185-133912207 CCTCGGTGCTTGGGCGGTGCAGG - Intergenic
1049073969 8:140379162-140379184 CCACAGGGCCTGCCCGGTGCTGG + Intronic
1049106819 8:140619183-140619205 CGACAGTGGCTGCCAGGTGCGGG - Intronic
1049342569 8:142121057-142121079 GCACAGTGCCTGGCAGGTGAGGG - Intergenic
1049574395 8:143383699-143383721 CCCCAGGGCCTGGCAGGTTCCGG + Exonic
1049773351 8:144393788-144393810 CCAGGGTGGCTGGCAGGGGTAGG + Exonic
1049784441 8:144443875-144443897 CCCGGCTGCCTTGCAGGTGCGGG - Exonic
1051591121 9:18777421-18777443 CCATGGTGAAGGGCAGGTGCAGG - Exonic
1052766474 9:32646495-32646517 CCACTGTGCCTGGCCTGAGCAGG - Intergenic
1052951573 9:34217521-34217543 CCACCGTGCCTGGCTGGTGGCGG + Intronic
1053120079 9:35539694-35539716 CCACAGTGTCTGGCAGGGGCAGG + Intronic
1054782254 9:69175949-69175971 CCACAGTGACTGGCAGGAGTAGG - Intronic
1055465235 9:76558936-76558958 CCAGGTAGCCTGGCAGATGCTGG + Intergenic
1056526040 9:87443942-87443964 CCACCGTGCCTGGCCTGTGATGG - Intergenic
1056640288 9:88364478-88364500 CCATCGTGCCTGGCAGCTGTAGG - Intergenic
1056708992 9:88975573-88975595 CCACTGTGCCCGGCAGTTACTGG - Intergenic
1059441443 9:114309295-114309317 CCTCGGAGCTTAGCAGGTGCAGG - Exonic
1061069627 9:128301185-128301207 CCACTGTGCCCGGCCCGTGCTGG - Intergenic
1062045977 9:134424748-134424770 ACACTGTGCCTGGCTGGTGTTGG + Intronic
1062133245 9:134911637-134911659 CCACGGTGCCCGGCTGGGGATGG + Intronic
1062413094 9:136434528-136434550 CCACGTGGCCAGGGAGGTGCAGG + Intronic
1203563220 Un_KI270744v1:74509-74531 CCATGCTGCCTGGCAGAGGCTGG - Intergenic
1185454963 X:304709-304731 CCACGGCTCACGGCAGGTGCAGG + Intronic
1185494007 X:540558-540580 CCACTGTGCCTGGCCCATGCAGG + Intergenic
1185554376 X:1008870-1008892 CCAACGTGCCTGGCCGGAGCTGG + Intergenic
1186043556 X:5508502-5508524 CCACTGTGCCTGGCTGGAGGTGG + Intergenic
1187167829 X:16821424-16821446 CCACTGTGCCTGGCCCGTGAGGG + Intronic
1187213695 X:17254219-17254241 CCAGGCTGCCAGGCAGCTGCTGG - Intergenic
1188751467 X:33910546-33910568 AAACTGTACCTGGCAGGTGCTGG - Intergenic
1189476331 X:41359041-41359063 CCACTGTGCCTGGCCTGTACAGG + Intronic
1189781338 X:44517068-44517090 CCACCGTGCCCGGCGGGAGCTGG - Intergenic
1189852716 X:45193064-45193086 CCACTGTGCCTGGCAGGCATTGG + Intronic
1190324288 X:49197268-49197290 CCACTGTGCCTGGCGGGAGTTGG + Intronic
1191668629 X:63728715-63728737 ATACAGTGCCTGGCATGTGCTGG + Intronic
1192099209 X:68246090-68246112 CCACTGTGCCTGGCCGGTTATGG + Intronic
1192885825 X:75335241-75335263 CCACCCTGCCTGGGAGGTGAGGG - Intergenic
1193262721 X:79427797-79427819 CCACTGTGCCTGGCCGGGGCTGG + Intergenic
1194014394 X:88601035-88601057 CCACCGCGCCTGGCTGGTGGTGG + Intergenic
1194018716 X:88659663-88659685 CCACCGTGCCTGGCCGTTGCTGG - Intergenic
1195770485 X:108346050-108346072 CCACGGTGTGTGGGGGGTGCGGG - Intronic
1200748402 Y:6922831-6922853 CGACGAAGCCCGGCAGGTGCCGG + Intronic