ID: 1019645278

View in Genome Browser
Species Human (GRCh38)
Location 7:2125576-2125598
Sequence GCTACAACCCCCACCAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019645274_1019645278 1 Left 1019645274 7:2125552-2125574 CCTGCTGTGGCAAACCCAATTCT 0: 1
1: 0
2: 0
3: 15
4: 117
Right 1019645278 7:2125576-2125598 GCTACAACCCCCACCAGGTGAGG No data
1019645272_1019645278 16 Left 1019645272 7:2125537-2125559 CCAGGTGAGCGAGGGCCTGCTGT 0: 1
1: 0
2: 1
3: 16
4: 147
Right 1019645278 7:2125576-2125598 GCTACAACCCCCACCAGGTGAGG No data
1019645271_1019645278 17 Left 1019645271 7:2125536-2125558 CCCAGGTGAGCGAGGGCCTGCTG 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1019645278 7:2125576-2125598 GCTACAACCCCCACCAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019645278 Original CRISPR GCTACAACCCCCACCAGGTG AGG Intronic
No off target data available for this crispr