ID: 1019645593

View in Genome Browser
Species Human (GRCh38)
Location 7:2127193-2127215
Sequence GGCACTCCCATGACTAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019645593_1019645607 26 Left 1019645593 7:2127193-2127215 CCTTTGCTAGTCATGGGAGTGCC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1019645607 7:2127242-2127264 TACTTATGACAAGGGGGAGATGG No data
1019645593_1019645603 20 Left 1019645593 7:2127193-2127215 CCTTTGCTAGTCATGGGAGTGCC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1019645603 7:2127236-2127258 CTCCCCTACTTATGACAAGGGGG No data
1019645593_1019645600 18 Left 1019645593 7:2127193-2127215 CCTTTGCTAGTCATGGGAGTGCC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1019645600 7:2127234-2127256 CCCTCCCCTACTTATGACAAGGG No data
1019645593_1019645602 19 Left 1019645593 7:2127193-2127215 CCTTTGCTAGTCATGGGAGTGCC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1019645602 7:2127235-2127257 CCTCCCCTACTTATGACAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 77
1019645593_1019645598 17 Left 1019645593 7:2127193-2127215 CCTTTGCTAGTCATGGGAGTGCC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1019645598 7:2127233-2127255 GCCCTCCCCTACTTATGACAAGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019645593 Original CRISPR GGCACTCCCATGACTAGCAA AGG (reversed) Intronic
901354268 1:8629837-8629859 GGCACTGCCATGCTTTGCAAAGG - Intronic
904872669 1:33629651-33629673 TGCACTCCCATCAGTACCAATGG + Intronic
908552907 1:65227632-65227654 GTCACTCCCAAGAATAGTAAAGG - Exonic
911390140 1:97231330-97231352 AGCAGTCACATGACTAGCAATGG - Intronic
914347067 1:146808956-146808978 GCCACTCCCCTCACTTGCAAGGG - Intergenic
915833848 1:159157340-159157362 GGCACTGCCCAGACTATCAAGGG - Intergenic
918206292 1:182312420-182312442 GGAATTCCCATGACAAGCAGGGG - Intergenic
919776196 1:201195472-201195494 GGCTCTGCCAAGACTAGGAAGGG - Intronic
1065574267 10:27102373-27102395 GGAACTCCCATGCCTATCTAAGG + Intergenic
1066167823 10:32807685-32807707 GGCTCTCCCATGGCTAGGATTGG - Intronic
1073296915 10:102445938-102445960 GGTACTCAAATGACTTGCAAAGG + Intergenic
1079181309 11:18196152-18196174 GACACCCCCATGACTAGGAGTGG - Intronic
1082122243 11:48391785-48391807 GTCACTCCTTTGACTAGGAAAGG + Intergenic
1094567618 12:31614294-31614316 GTCACTCCCAAGAATAGTAAAGG + Intergenic
1097257855 12:57694300-57694322 TGCCCTCCCATGACAGGCAACGG - Exonic
1098081138 12:66786719-66786741 GGTCCTCACATGACTAGGAAGGG + Intronic
1098942429 12:76552857-76552879 AGCACTTCCATTACTACCAATGG + Intronic
1099951960 12:89313608-89313630 GGTATTCCAATGCCTAGCAAGGG - Intergenic
1103890928 12:124238644-124238666 GTCACTCGCATGAGTTGCAAAGG - Intronic
1105866099 13:24461039-24461061 GGCAACCCCATGACTAGCTAGGG + Intronic
1106801859 13:33264119-33264141 GGCACTTGCATGACTGGCAGTGG - Intronic
1106925028 13:34605061-34605083 CCCACTCGCATGACTGGCAAGGG + Intergenic
1119080804 14:71691654-71691676 GCCACTCCCATGCCTAGGGATGG - Intronic
1121727438 14:96162998-96163020 GGCACTTTCATGACTTGCATGGG + Intergenic
1133241351 16:4416247-4416269 GGCACTCCCGTGACTCGCTCTGG - Intronic
1134767661 16:16774984-16775006 GGAACTCCCTTTCCTAGCAAAGG - Intergenic
1139986918 16:70906314-70906336 GCCACTCCCCTCACTTGCAATGG + Intronic
1141338822 16:83183694-83183716 AGCACTCACCTGAGTAGCAATGG - Intronic
1144536743 17:16097367-16097389 GGCACCACCATGCCCAGCAAGGG + Intronic
1146251408 17:31347639-31347661 GTCACTCCCAAGAATAGTAAAGG - Intronic
1147415184 17:40283896-40283918 TGCACTTTCATCACTAGCAAAGG + Exonic
1156415206 18:36880266-36880288 GGAACTCCCTCCACTAGCAAAGG - Intronic
1163858096 19:19722041-19722063 GTCACTCTGATGACTAGCAGAGG - Intronic
927331157 2:21866007-21866029 GGCTCTCCCATGGCTAGGATTGG - Intergenic
929757273 2:44778279-44778301 GGCTCTCCCAGGAACAGCAAGGG + Intergenic
934849985 2:97692130-97692152 GGCATTCCCATTTCTAGCATAGG - Intergenic
937631989 2:124111980-124112002 GGTACTCCCATGGCTAGCTAGGG - Intronic
944146755 2:196514574-196514596 GGCACGCCCATGGCTACCCATGG + Intronic
1174620997 20:51874519-51874541 GGGGCTCACATGCCTAGCAAGGG + Intergenic
1176206655 20:63892358-63892380 GGAACTCCAAAGACTAGGAATGG - Intergenic
1176655071 21:9580326-9580348 AGCACTGCCATGCCCAGCAAAGG - Intergenic
1178830586 21:36053294-36053316 GGCAGTCCCATGGCTGGCAGAGG - Intronic
1179175689 21:39006328-39006350 GGCAACCCCATGACCACCAATGG + Intergenic
1179285330 21:39973082-39973104 TGCAATCCCATGTCTGGCAAAGG + Intergenic
1183303414 22:37069559-37069581 GGCACACCCATGTCTAGGGAGGG - Intronic
1183324950 22:37186190-37186212 GGCACTCTAAAGACTAGCAATGG - Intronic
1184194360 22:42916693-42916715 GGAACTCCCATGACTTCAAACGG + Intronic
1184227081 22:43135196-43135218 GGCACTACCAAGAATACCAAAGG + Intronic
954457574 3:50608200-50608222 GGCACTGCCTTGACTTGCACTGG - Intronic
955594682 3:60575832-60575854 GGGACACCAAAGACTAGCAACGG + Intronic
956688383 3:71853657-71853679 GGCAATCCCATGACTGGAATTGG + Intergenic
957992265 3:87641404-87641426 AGCCATCCCATGACTATCAAGGG - Intergenic
961433448 3:126899695-126899717 GGCACTCTCAAGACCAGGAAAGG - Intronic
963248517 3:143084230-143084252 GCCACTCCGATGGCTATCAAAGG - Intergenic
963829578 3:149992649-149992671 GGCTCTCCCATGGCTAGGATTGG - Intronic
965487236 3:169293055-169293077 GGTACCTCCATGACTAGCAAAGG + Intronic
965743580 3:171901949-171901971 GACACTCTCTTGACTAGGAAGGG + Intronic
966817046 3:183897831-183897853 GGAATTCCCATGACTAGAACTGG - Intergenic
968029266 3:195469087-195469109 GTCTCTACCATGACCAGCAAAGG - Intergenic
968617447 4:1584629-1584651 GCCACTCCCGTGGCTGGCAATGG + Intergenic
968671249 4:1852969-1852991 GGCTCTCCCAGGAGTGGCAAGGG - Intronic
969584414 4:8083813-8083835 GGCACTGCCATCAGCAGCAATGG + Intronic
973805304 4:54519960-54519982 GGAACTTCCATGACCAGCTAAGG - Intergenic
976318704 4:83686924-83686946 CGCACTCCCCTGAAAAGCAAGGG - Intergenic
980555460 4:134397610-134397632 AGCAATCCCATTACTGGCAAAGG - Intergenic
981885264 4:149666329-149666351 GGAACTCCCTTCCCTAGCAAAGG + Intergenic
991197115 5:63948126-63948148 GGTACTTTTATGACTAGCAAAGG - Intergenic
999804475 5:155069117-155069139 GGCTCTCCCAGGATGAGCAAGGG - Intergenic
1000295626 5:159911200-159911222 GGCAAGCCCATGGCCAGCAAGGG + Intergenic
1001453289 5:171842470-171842492 GGCACCCCCATGCCTAGCCCAGG - Intergenic
1001599506 5:172919829-172919851 GGCACTCCCCTGACCAGAGAAGG - Intronic
1002542228 5:179913843-179913865 GCCAGTCCCATGCCTTGCAAAGG + Intronic
1019645593 7:2127193-2127215 GGCACTCCCATGACTAGCAAAGG - Intronic
1022369369 7:29756547-29756569 GGCACTCTCATCAATACCAAAGG - Intergenic
1023618736 7:42048230-42048252 GTCAATCCCATGGCTAGTAAGGG - Intronic
1026403937 7:70044659-70044681 GGGTCTCCCATGGATAGCAAAGG - Intronic
1032902131 7:136321444-136321466 GGCTCTCCCATGACTAGTACTGG + Intergenic
1033201131 7:139371138-139371160 GACACTCCCATGTCTACAAATGG - Intronic
1039170472 8:34739296-34739318 GGAATTCCCTTGCCTAGCAAAGG - Intergenic
1039434205 8:37548436-37548458 GCCCCTCCTATGACTAGCACTGG + Intergenic
1041794248 8:61729456-61729478 TGCACTCCCATGACCACCATAGG + Intergenic
1043606478 8:82006797-82006819 GGCACTCCCATGAACAGCTGTGG + Intergenic
1051127418 9:13820471-13820493 GGCACACACATGACAAGAAAAGG - Intergenic
1052929950 9:34048396-34048418 GCCAGTCCCAAGACTAGCTACGG + Intronic
1056672363 9:88641404-88641426 GTCACTACCATCACCAGCAATGG - Intergenic
1061355252 9:130099823-130099845 GGCACTCTCATCTCTAGAAATGG - Intronic
1203632796 Un_KI270750v1:83779-83801 AGCACTGCCATGCCCAGCAAAGG - Intergenic
1186265016 X:7823293-7823315 GGCCCTCCCATGAGTAGGTAGGG + Intergenic
1191072085 X:56411263-56411285 GGAACTCCCTTCACTAGCCAAGG - Intergenic
1199607971 X:149591915-149591937 GGCACCGCCATGACAAGGAATGG + Intergenic
1199631149 X:149777441-149777463 GGCACCGCCATGACAAGGAATGG - Intergenic