ID: 1019645683

View in Genome Browser
Species Human (GRCh38)
Location 7:2127584-2127606
Sequence AACGACCTGGGGTCTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019645668_1019645683 28 Left 1019645668 7:2127533-2127555 CCAAGGTCCAGACGTCAGGAACC 0: 1
1: 0
2: 2
3: 6
4: 83
Right 1019645683 7:2127584-2127606 AACGACCTGGGGTCTAGGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 111
1019645674_1019645683 7 Left 1019645674 7:2127554-2127576 CCTGGTGTAGGTGGGCAATGAGG 0: 1
1: 0
2: 1
3: 22
4: 146
Right 1019645683 7:2127584-2127606 AACGACCTGGGGTCTAGGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 111
1019645670_1019645683 21 Left 1019645670 7:2127540-2127562 CCAGACGTCAGGAACCTGGTGTA 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1019645683 7:2127584-2127606 AACGACCTGGGGTCTAGGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019645683 Original CRISPR AACGACCTGGGGTCTAGGGT GGG Intronic
901463644 1:9406622-9406644 ATCGACCTGGGGTCTATGAATGG - Intergenic
902564564 1:17302789-17302811 AAGCACCTGGTGTCAAGGGTTGG + Intergenic
902877018 1:19346731-19346753 AACGACCAGGCTTCCAGGGTCGG + Intronic
903285376 1:22273599-22273621 AAGGAGCTGGGGTCTCAGGTGGG - Intergenic
904243102 1:29163848-29163870 ACCGACCTGGGTTCTAGTCTTGG + Intronic
904576716 1:31509594-31509616 AAGGACATGGGGTACAGGGTGGG - Intergenic
909226223 1:73026664-73026686 ATCACTCTGGGGTCTAGGGTAGG - Intergenic
913958841 1:143324063-143324085 CAGGAACTGGGGTCTGGGGTGGG + Intergenic
914053158 1:144149443-144149465 CAGGAACTGGGGTCTGGGGTGGG + Intergenic
914126039 1:144817098-144817120 CAGGAACTGGGGTCTGGGGTGGG - Intergenic
1063973717 10:11398746-11398768 AACGATATGGTGTCTGGGGTTGG - Intergenic
1071925963 10:90409246-90409268 AACAGCCTGGGGTCCAGAGTCGG + Intergenic
1073052960 10:100681131-100681153 AATGACCTGGGGCCTCGGGAAGG - Intergenic
1073137036 10:101225822-101225844 AATGCCCTTGGGTCTGGGGTGGG + Intergenic
1080858392 11:36131834-36131856 ACCCACCTGGGGCCTGGGGTGGG + Intronic
1081965887 11:47169392-47169414 AAAGAAAAGGGGTCTAGGGTTGG + Intronic
1084940322 11:72609018-72609040 AGAGACCTGGGGTCTAGGCCAGG - Intronic
1091365838 11:135019661-135019683 AAGGACCTGGGGTCAAGTGAAGG - Intergenic
1095099883 12:38169602-38169624 AACTACCTGGGCTCCAGAGTTGG + Intergenic
1097380917 12:58894939-58894961 ACAGACCTGGGGACTTGGGTTGG + Intronic
1106427938 13:29650933-29650955 AACAACCTGGGGTTTATGATTGG + Intergenic
1117455295 14:55890806-55890828 GTCGACCTGGAGTGTAGGGTGGG + Intergenic
1120186570 14:81399961-81399983 GAAGACCTGGGCTCAAGGGTTGG - Intronic
1120595199 14:86425668-86425690 AAAGACATGGGGTCTACTGTGGG + Intergenic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1122863888 14:104594896-104594918 AAGGCCCTGGGGTCTGGGGTGGG - Intronic
1122904605 14:104795902-104795924 GACGACCTGGGGCCTGGGCTGGG + Intergenic
1123442275 15:20301253-20301275 CAGGAACTGGGGTCTGGGGTGGG - Intergenic
1123538296 15:21261450-21261472 CAGGAACTGGGGTCTGGGGTGGG + Intergenic
1131028899 15:89169884-89169906 AAAAACTGGGGGTCTAGGGTAGG - Intronic
1133831130 16:9324696-9324718 TCTGACTTGGGGTCTAGGGTGGG - Intergenic
1136897638 16:34003858-34003880 CAGGAACTGGGGTCTGGGGTGGG + Intergenic
1139419718 16:66843022-66843044 AACGACCAGGGCTCGTGGGTGGG + Intronic
1140517808 16:75556852-75556874 AACGACCTGGGCTCCAGAGCCGG - Intergenic
1143726227 17:8848720-8848742 AACCAGCTGGGGTTTGGGGTGGG - Intronic
1152874996 17:82781394-82781416 AGCGACTTGGTTTCTAGGGTTGG + Intronic
1158875013 18:61725178-61725200 AAAGACATGGGGTCAAAGGTGGG - Intergenic
1160777351 19:862264-862286 AAGGACCTGTGGGTTAGGGTGGG + Intronic
1161155020 19:2728024-2728046 ACCCACCTGGGGTCTAGGCAAGG + Intronic
1163872392 19:19832797-19832819 AACAGCCTGGGCTCTAGAGTTGG + Intergenic
1163885104 19:19958497-19958519 AACAACCTGGGCTCCAGAGTCGG - Intergenic
1163889130 19:19995317-19995339 AACAACCTGGGCTCCAGAGTCGG + Intergenic
1163938420 19:20471533-20471555 AACAACCTGGGCTCCAGAGTCGG + Intergenic
1164137591 19:22428157-22428179 CAGGACCTGGGGTCTGGGGCCGG + Intronic
1165783360 19:38446583-38446605 GAGGGCCTGGGGTCTAGGGGTGG + Intronic
1202692554 1_KI270712v1_random:101866-101888 CAGGAACTGGGGTCTGGGGTGGG + Intergenic
927371172 2:22356915-22356937 AAGGCCTTGGGGTCTAAGGTGGG - Intergenic
930205892 2:48586495-48586517 AACTGCCTGGGGACTAGGGAGGG + Intronic
931835677 2:66096299-66096321 AAAGACCTGGTGTGTAGGCTTGG - Intergenic
932490330 2:72116048-72116070 AACGACCTGGGGGTCAGGGCTGG - Intergenic
933953849 2:87352105-87352127 CAGGAACTGGGGTCTGGGGTGGG - Intergenic
934238049 2:90248351-90248373 CAGGAACTGGGGTCTGGGGTGGG - Intergenic
934275150 2:91568385-91568407 CAGGAACTGGGGTCTGGGGTGGG + Intergenic
934697770 2:96412435-96412457 AACGAGGTGAGGTCGAGGGTGGG + Intergenic
935340388 2:102054454-102054476 AAAGACCTGGGTTCTAGGTTTGG - Intergenic
944305955 2:198180248-198180270 AACAACCTGAGGTCTTGGCTGGG - Intronic
946110137 2:217407843-217407865 AACCACATGGGGTGTAGGGGAGG - Intronic
947792801 2:232877419-232877441 AAGGCCCTGGGGACTGGGGTAGG - Intronic
948606920 2:239141640-239141662 AGAGAGCAGGGGTCTAGGGTGGG - Intronic
948931789 2:241136856-241136878 AAGGACCTTGGGTCCAGGGAGGG - Intronic
1169228035 20:3868226-3868248 ACCTAACTGGGGTTTAGGGTAGG - Exonic
1169388133 20:5168449-5168471 AAAGAAATGGGGTATAGGGTAGG + Intronic
1172045169 20:32074974-32074996 AACGACCTGGTTTCTTTGGTTGG + Intronic
1172503998 20:35447721-35447743 AAAGACCCAGGGTCTGGGGTGGG - Intronic
1180548927 22:16526815-16526837 CAGGAACTGGGGTCTGGGGTGGG - Intergenic
1182774026 22:32817868-32817890 GACGACCAGGGGACCAGGGTGGG - Intronic
1183279970 22:36926711-36926733 AGCCATCTGTGGTCTAGGGTGGG + Intronic
952882054 3:37991371-37991393 AAAGACCTGGGGAGGAGGGTGGG + Intronic
962969509 3:140385820-140385842 AGCAAGCTGGGGTCTAGGGCAGG + Intronic
968611210 4:1557982-1558004 AACGACCTGGAGCAAAGGGTCGG + Intergenic
976209373 4:82652006-82652028 AATCACCTGGGGTCTGGAGTGGG + Intronic
984257967 4:177409817-177409839 AGCGACCTGGGGAAGAGGGTGGG - Intergenic
997480889 5:134183810-134183832 GACTGCCTTGGGTCTAGGGTAGG + Intronic
998335709 5:141370548-141370570 AAGGACCTGGGGTTTGGCGTGGG + Exonic
998987987 5:147782967-147782989 AAAGACCTGGAGTTCAGGGTAGG - Intergenic
1002612133 5:180427382-180427404 AGCTATCTGGGGTCTAAGGTGGG - Intergenic
1015138055 6:129896554-129896576 AACTACTTGGGGTCTGAGGTGGG - Intergenic
1018801019 6:167222256-167222278 TACCACCAGGGGTCTGGGGTTGG + Intergenic
1018809115 6:167284915-167284937 TACCACCAGGGGTCTGGGGTTGG - Intronic
1019145228 6:169971640-169971662 AAGGAGCCGGGGTCTAGGGAGGG - Intergenic
1019645683 7:2127584-2127606 AACGACCTGGGGTCTAGGGTGGG + Intronic
1021923780 7:25514845-25514867 AACGAACTGGAGTATAGGATGGG - Intergenic
1025275983 7:57581337-57581359 CAGGACCTGGGGCCTGGGGTGGG - Intergenic
1029422114 7:100477253-100477275 TAAGACCTGGGTTCTAGGGCTGG - Intronic
1029818677 7:103123816-103123838 AACAGCCTGGGGTCCAGGTTGGG + Intronic
1034422703 7:150997782-150997804 ACCAACCTGGGGTCAAGGGAGGG - Intronic
1047679984 8:127244727-127244749 AACAACCTGGGCTCCAGAGTTGG - Intergenic
1053412930 9:37927441-37927463 AATGCCCTGGCGTCTCGGGTAGG - Intronic
1056572969 9:87832222-87832244 CAGGACCTTGGGTTTAGGGTTGG + Intergenic
1058145856 9:101410474-101410496 AAAGACCTGGAGTCTATGCTAGG + Exonic
1060153639 9:121304044-121304066 AATGACCAGGGTCCTAGGGTAGG + Intronic
1060757177 9:126222627-126222649 CCGGCCCTGGGGTCTAGGGTGGG - Intergenic
1062021059 9:134319624-134319646 AAGGCCCTGGAGTCTTGGGTAGG + Intronic
1185869497 X:3652082-3652104 AAGGACTTGGGGTAAAGGGTGGG + Intronic
1187799965 X:23050624-23050646 AACTTTCTGAGGTCTAGGGTGGG + Intergenic
1190172308 X:48121432-48121454 AAGGGCCTGGGGGCTGGGGTGGG + Intergenic
1190177950 X:48167081-48167103 AAGGGCCTGGGGGCTGGGGTGGG + Intergenic
1190183921 X:48218727-48218749 AAGGGCCTGGGGGCTGGGGTGGG + Intronic
1190189848 X:48268179-48268201 AAGGGCCTGGGGGCTGGGGTGGG + Intronic
1190193212 X:48294565-48294587 AAGGGCCTGGGGGCTGGGGTGGG - Intergenic
1190197073 X:48328868-48328890 AAGGGCCTGGGGGCTGGGGTGGG + Intergenic
1190204781 X:48394202-48394224 AAGGGCCTGGGGGCTGGGGTGGG + Intergenic
1190205755 X:48401201-48401223 AAGGGCCTGGGGGCTGGGGTGGG - Intergenic
1190210621 X:48443830-48443852 AAGGGCCTGGGGGCTGGGGTGGG + Intergenic
1190663807 X:52679247-52679269 AAGGGCCTGGGGGCTGGGGTGGG + Intronic
1190665950 X:52696013-52696035 AAAGGCCTGGGGGCTGGGGTGGG - Intronic
1190673468 X:52762397-52762419 AAAGGCCTGGGGGCTGGGGTGGG + Intronic
1190675616 X:52779175-52779197 AAGGGCCTGGGGGCTGGGGTGGG - Intronic
1190677013 X:52791168-52791190 AAAGGCCTGGGGGCTGGGGTGGG + Intergenic
1195667422 X:107443683-107443705 AGAGTCCTGGGCTCTAGGGTGGG + Intergenic
1199332505 X:146579288-146579310 AACAACCTGGGCTCCAGAGTCGG - Intergenic
1199527987 X:148813169-148813191 AATGACCTGCAGTCCAGGGTGGG + Intronic
1199870540 X:151894458-151894480 AAAGCACTGGGGTCTGGGGTCGG - Intergenic
1202583981 Y:26405894-26405916 CAGGAACTGGGGTCTGGGGTGGG + Intergenic