ID: 1019647712

View in Genome Browser
Species Human (GRCh38)
Location 7:2139941-2139963
Sequence AGGGAAACTGAGGCCTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1401
Summary {0: 1, 1: 1, 2: 38, 3: 214, 4: 1147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019647712_1019647720 -1 Left 1019647712 7:2139941-2139963 CCCCCACAGGCCTCAGTTTCCCT 0: 1
1: 1
2: 38
3: 214
4: 1147
Right 1019647720 7:2139963-2139985 TGTTTTTATGGTCTACTATCTGG 0: 1
1: 0
2: 0
3: 24
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019647712 Original CRISPR AGGGAAACTGAGGCCTGTGG GGG (reversed) Intronic
900242813 1:1624998-1625020 AGGGAAACCGGGCCGTGTGGTGG + Exonic
900251604 1:1673350-1673372 AGGGAAACTGAAGTTGGTGGTGG + Intronic
900261965 1:1735886-1735908 AGGGAAACTGAAGTTGGTGGTGG + Intronic
900393079 1:2442242-2442264 GGGGAAACTGAGGTCTGGAGGGG + Intronic
900396864 1:2456682-2456704 GGGGAAACTGAGGCCCAAGGAGG - Intronic
900457166 1:2782778-2782800 GAGGAAACTGAGGCCTGGGGAGG + Intronic
900479883 1:2892938-2892960 GGGGAAACTGAGGCACGGGGGGG + Intergenic
900503943 1:3019842-3019864 AGGTCACCTGAGGCCTGTGCTGG - Intergenic
900858702 1:5207633-5207655 AGGGGAACAGAAGCCTGTGCAGG + Intergenic
901124048 1:6916904-6916926 AGGGAGGCGGAGGCCTGTTGAGG + Intronic
901511095 1:9718415-9718437 GGGGAAACTGAGGCCTGGAGTGG + Intronic
901634891 1:10665941-10665963 AAGGAAACTGAGGCCCAGGGAGG + Intronic
901758417 1:11455385-11455407 GGGGAAACTGAGGCCCAGGGAGG + Intergenic
901778932 1:11579847-11579869 GGGGAAACTGAGGCTTGAAGAGG - Intergenic
901780855 1:11593627-11593649 GTGGAAACTGAGGCTTGTAGAGG - Intergenic
901866854 1:12112029-12112051 AGGTAAACTGAGGCCCGGGGAGG - Intronic
901873723 1:12153799-12153821 GGGGAAACTGAGGCCTGAGAAGG + Intergenic
901952694 1:12761259-12761281 GGGGAAACTGAGGCCCGGAGAGG + Exonic
902179871 1:14679727-14679749 AGGGAAACTGAGGCTTAGAGAGG + Intronic
902292623 1:15445323-15445345 AGGGAAACTGAGGCACGGAGAGG + Intronic
902399281 1:16149165-16149187 AAGGAAACTGAGGCCTGAGGCGG + Intronic
902466594 1:16622267-16622289 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
902508064 1:16950782-16950804 AGGGAAACTGAGGCCCAGAGAGG + Intronic
902631735 1:17708762-17708784 GGGGAAACTGAGGCCAGTAGAGG - Intergenic
902662151 1:17912603-17912625 GGGGAAACTGAGGCCAGAGAGGG + Intergenic
902753861 1:18536569-18536591 AGAGAAACTGAGGCCTGGAGAGG - Intergenic
902778704 1:18690872-18690894 GGGGAAAGTGAGGCCCGAGGAGG + Intronic
902806431 1:18863940-18863962 AGGGAAACTGAGGCCTGGAAAGG + Intronic
902839225 1:19064922-19064944 AGGGAAACTGAGGCCCAGGAGGG - Intergenic
902893536 1:19462516-19462538 GGGGAAACTGAGGCCCAAGGAGG + Intronic
902936237 1:19766849-19766871 GGGGAAACTGAGGCCTAGAGGGG - Intronic
902957656 1:19936811-19936833 GGGGAAACTGAGGCCTAGAGAGG + Intergenic
903016401 1:20364920-20364942 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
903022048 1:20401466-20401488 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
903140459 1:21335854-21335876 GGGGAAAGTGAGGACTATGGAGG + Intronic
903165994 1:21520824-21520846 TGGGAGACTGAGGCTTGGGGAGG + Intronic
903168582 1:21538261-21538283 CAGGAAACTGGGGCCTATGGAGG - Intronic
903173045 1:21565369-21565391 GGGGAAACTGAGGCATAGGGAGG - Intronic
903187304 1:21635839-21635861 AGAGAAACTGAGGCTTGGAGAGG - Intronic
903231420 1:21924587-21924609 AGGAAAACTGAGGCCCGGGGAGG + Intronic
903269292 1:22177703-22177725 GGGGAAACTGTGGCCTGGAGAGG + Intergenic
903287950 1:22288617-22288639 AAGGAAACTGAGGCCCATGATGG + Intergenic
903357784 1:22758679-22758701 AGGGAAACTGAGGCCTAGAAAGG - Intronic
903441875 1:23394342-23394364 AAGGAAACTCAGGCGTGTAGAGG - Intronic
903467011 1:23558824-23558846 AGGGAAACTGAGGCCAGAGAGGG - Intronic
903474175 1:23607961-23607983 AGGGAAACTGAGGCCTGAAGTGG - Intronic
903543340 1:24108782-24108804 AGGGAAACTGAGGTCTGAGAGGG + Intronic
903594944 1:24486845-24486867 AGGGCAACTGAGGCTGGAGGAGG + Intergenic
903639238 1:24847330-24847352 GAGGAAACTGAGGCATGTGGAGG + Intergenic
903705291 1:25281063-25281085 AGGGAAACTGAGGCCTAAAGAGG + Intronic
903721935 1:25412267-25412289 AGGGAAACTGAGGCCTAAAGAGG - Intronic
903931676 1:26865616-26865638 AGGGAAACTGAGGCCCAGGGAGG - Intergenic
904203662 1:28838431-28838453 GGGGAAACTGAGGCCTGGAAAGG - Intronic
904277685 1:29394931-29394953 AGCAGAGCTGAGGCCTGTGGTGG - Intergenic
904301248 1:29556244-29556266 GGGGAAACTGAGGCCCAGGGAGG - Intergenic
904404304 1:30275927-30275949 GGGGAAACTGAGGCCCAGGGAGG + Intergenic
904428363 1:30446226-30446248 GAGAAAACTGAGGCCAGTGGAGG - Intergenic
904430965 1:30463796-30463818 GGGGAAACTGAGGCCAGGGAAGG - Intergenic
904468702 1:30722967-30722989 GGGGAAACTGAGGTCAGTGAGGG - Intronic
904478058 1:30777254-30777276 GAGGAAACAGAGGCCTGGGGTGG - Intergenic
904610147 1:31721355-31721377 AGGGAAGCTGAGGCCTGGAGAGG + Intergenic
904611681 1:31729273-31729295 AGGGAAACTGAGACCCAGGGAGG + Intronic
904788321 1:32998958-32998980 CAGGAAACTGAGGCCAATGGAGG + Intergenic
904843280 1:33388268-33388290 GAGGAAACAAAGGCCTGTGGAGG - Intronic
904881175 1:33698339-33698361 AGGGAAACTGAGACCTAAAGTGG + Intronic
905026081 1:34850709-34850731 AGGGAAACCAAGGCCAGTAGAGG + Intronic
905274791 1:36810217-36810239 ATGGGAACTCAGGCCTGTGATGG - Intronic
905470060 1:38185113-38185135 GGGGAAACTGGGGCCTGATGAGG + Intergenic
905484826 1:38288136-38288158 TGGGAAACTGAGGCTTGGGGAGG + Intergenic
905627134 1:39496489-39496511 GAGGAAACTGAGGCTTGGGGAGG - Intronic
905669801 1:39784282-39784304 GAGGAAACTGAGGCTTGGGGAGG + Intronic
905674494 1:39816266-39816288 AAGGAAACTGAGGCCTAGGGAGG + Intergenic
905847189 1:41242441-41242463 GGGAAAACTGAGGCCTGAGAGGG + Intergenic
905919848 1:41712072-41712094 GGGGAAACTGAGGTCCGGGGAGG + Intronic
906679980 1:47719936-47719958 AGGGAAACAGAGGCCCAGGGAGG + Intergenic
906943716 1:50277745-50277767 AGGGCAACTAAGCCCTGTTGAGG - Intergenic
907094033 1:51758989-51759011 CGGGAAACTGAGGCCCATAGAGG + Intronic
907246128 1:53110216-53110238 GGGGAAACTGAGGCCTGGAGAGG + Intronic
907251150 1:53140764-53140786 AAGGAAACTGAGGCCCAGGGAGG + Intronic
907300438 1:53483450-53483472 GGGGAAACCAAGGCCTGGGGAGG + Intergenic
907341359 1:53738410-53738432 GGTGAAACTGAGGCCTGGAGCGG + Intergenic
907405455 1:54251109-54251131 GGGGAAACTGAGGCCTGCTGGGG + Intronic
907444384 1:54498672-54498694 GAGGAAACTGAGGCCTAGGGAGG + Intergenic
907621739 1:55988260-55988282 GGGGAAACTGAGGTCTGGAGAGG + Intergenic
907763647 1:57387161-57387183 AAGGAAACTGAGGCTTGGAGAGG - Intronic
907913053 1:58843656-58843678 AGGGAATCTGAGTCCTAGGGAGG + Intergenic
908218135 1:61976329-61976351 AATGAAGCTGAGGCCAGTGGAGG - Intronic
909381372 1:75002791-75002813 AGGGAAGCTTAGGCCTCTGTGGG - Intergenic
911226028 1:95306694-95306716 GAGGAAACTGAGGCCCATGGAGG - Intergenic
911741774 1:101394385-101394407 AGAGAGACTGAGGCATCTGGTGG - Intergenic
912775374 1:112503303-112503325 GGGGAAACTGAGGCCTGAAGTGG + Intronic
914250541 1:145918421-145918443 GGGGAAACTGAGGCATGAGTGGG - Intronic
914337636 1:146730180-146730202 AGGGACACTGAGGCTTGGAGAGG - Intergenic
914429961 1:147612199-147612221 AAGGAAACTGAGGCCTGGAATGG + Intronic
914982457 1:152426570-152426592 ATGGAAACTGAGGACTTTGCAGG + Intergenic
915275425 1:154784844-154784866 AGGGAAACTGAGGCTCGGAGAGG + Intronic
915626700 1:157118336-157118358 AGGGAAACTGAGGCACGGAGAGG + Intergenic
915899302 1:159834928-159834950 ATGGAAAGTTAGGACTGTGGTGG - Exonic
915980123 1:160415300-160415322 AGGGAAACCGAGGCATGAAGAGG - Intronic
916476244 1:165171877-165171899 GAGGAAACTGAAGCCTGGGGAGG - Intergenic
916839430 1:168584635-168584657 AGGGAAACTGAGGCATGTGTGGG + Intergenic
916972261 1:170035237-170035259 AAGGAAACTGAGGCATGAGTGGG + Intronic
917026447 1:170647989-170648011 AGGGAAACAGAGGGATATGGGGG + Intergenic
917195907 1:172465560-172465582 AGGGCAAGTGAGGCCTGAGGAGG - Intronic
917235431 1:172887008-172887030 AGGGAAACTGAGGCCTGAAAAGG - Intergenic
917487209 1:175466190-175466212 ATGGAAACTGAGGCTCATGGAGG + Intronic
917587596 1:176443616-176443638 AGTTAAACTGAGGCCTGAAGTGG + Intergenic
918043254 1:180925992-180926014 GGGGAAACTGAGGCCCAGGGAGG + Intronic
918134547 1:181659909-181659931 AGGGATACTGACACCTGAGGTGG + Intronic
918181021 1:182086164-182086186 CGTGACATTGAGGCCTGTGGGGG + Intergenic
918587641 1:186206150-186206172 AGAGAAACTGAGGAGGGTGGGGG + Intergenic
919805194 1:201377308-201377330 GAGAAAACTGAGGCCTGGGGAGG + Intronic
919855744 1:201704901-201704923 AGGGAAACTGAGGCCCAAAGAGG + Intronic
920006688 1:202838465-202838487 AGGGTAACTGAGGCATGGAGGGG + Intergenic
920184227 1:204150641-204150663 AGGGAAACTGAGGCAGGAGAGGG + Intronic
920201471 1:204262240-204262262 AGGGAAATTCAGGCTGGTGGTGG + Intronic
920259953 1:204682534-204682556 AAGGAAATTGAGGCCTGGAGAGG - Intronic
920270909 1:204763120-204763142 AGGGAAACTAAAGCCTGGAGAGG + Intergenic
920433930 1:205936227-205936249 AGGGAAACTGAGGTCTGGGAAGG - Intronic
920445331 1:206012141-206012163 AGGGACACAGCTGCCTGTGGTGG - Intronic
921566282 1:216724288-216724310 GGGGAGTCTGAGGGCTGTGGGGG + Intronic
922427710 1:225514825-225514847 AGGGCTACTGAAGCCTGTGCAGG + Exonic
922475775 1:225906126-225906148 AGAGAAACTGGGGCCTGCGGAGG + Intronic
922476580 1:225910935-225910957 AGGGAAACTGAGGCCTGGAGAGG - Intronic
922706358 1:227792811-227792833 GGGGAAATGGAGGCCTGTGGAGG - Intergenic
922800739 1:228363732-228363754 GGGGAAACTGAGGCCTGGGTTGG + Intronic
923324115 1:232865569-232865591 AAGGAAACTGAGGCTTGGAGAGG + Intergenic
923326121 1:232881718-232881740 AAGGAAACTGAGGCATGAGGAGG + Intergenic
923361607 1:233217499-233217521 AGGGAAACTGAGGCATGAAAAGG + Intronic
923803028 1:237229032-237229054 GTGGAAGCTGAGGCCTGTGGTGG + Intronic
924539828 1:244970555-244970577 AGGGAAAGGGCGGCCTGAGGAGG + Exonic
1062896754 10:1109118-1109140 AGAGAAACTGAGGCATGAGGAGG + Intronic
1062961612 10:1576884-1576906 AGGGGAACTGAGGCTTGGAGAGG - Intronic
1062968037 10:1625505-1625527 AGGGAAAAACAGGCCTCTGGAGG + Intronic
1064455487 10:15483938-15483960 AGGGAGACTGAGGAAGGTGGGGG - Intergenic
1064948409 10:20818340-20818362 TGGGAAACTGAGTCTTGGGGAGG - Intronic
1066198296 10:33123051-33123073 AGGGAAACTGAGACTTCTGGAGG + Intergenic
1067257761 10:44661089-44661111 GGGAAAACTGAGGCCTGGAGAGG - Intergenic
1067535166 10:47104202-47104224 GAGGAAACTGAGGCCTAGGGAGG - Intergenic
1067683852 10:48455941-48455963 CGGGAGACTGAGGCCTGGAGTGG - Intronic
1068753844 10:60627880-60627902 AAGGAAACTGAGCCCTGGAGAGG + Intronic
1069627059 10:69874842-69874864 AGGGAAACTGAGGCCCAGGCTGG + Intronic
1069684722 10:70310305-70310327 GGGGAAACTGAGGCTTGGAGAGG + Intronic
1069737903 10:70669675-70669697 AGGTAAACTGAGGTCTGGAGAGG - Intergenic
1069743148 10:70698465-70698487 AGGGAAACCAAGGTCTGAGGGGG + Intronic
1069748474 10:70730856-70730878 GGGGAAACTGAGCCATGGGGTGG + Intronic
1069788551 10:71005024-71005046 GGGGAAACTGAGGCCCCAGGAGG + Intergenic
1069800971 10:71081233-71081255 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1069886748 10:71628437-71628459 GGAGAAACTGAGGCCTGGAGAGG - Intronic
1070018130 10:72555768-72555790 TTTGAAACAGAGGCCTGTGGTGG - Intronic
1070567442 10:77614645-77614667 ATGGAAACTGAGGCATGAGGAGG + Intronic
1070751369 10:78965815-78965837 TGGGAAACTGAGGCCAGAGAGGG - Intergenic
1070779549 10:79129658-79129680 AGGGAGACTGAGGCCTGGTGAGG - Intronic
1070786680 10:79166144-79166166 AGGGACAGGGAGGCGTGTGGCGG - Intronic
1070914432 10:80144048-80144070 GGGGAAACTGAGGCAGGTAGGGG + Intronic
1071133021 10:82417645-82417667 GGGGAAACTGAGGCACGGGGCGG + Intronic
1071954466 10:90743083-90743105 TGGTAAGTTGAGGCCTGTGGAGG - Intronic
1072091073 10:92127741-92127763 AAGACAACTGAGGCCTCTGGGGG - Intronic
1072267664 10:93745922-93745944 ACGCACACTGGGGCCTGTGGAGG - Intergenic
1072449916 10:95531715-95531737 GGGGAAACTGAGACCTGGGAAGG - Intronic
1072543882 10:96419343-96419365 AAGGAAACCAAGGCCTGTGGAGG + Intronic
1072756698 10:98026214-98026236 AAGGAAACTGAGGCTTGCAGAGG + Intronic
1073582387 10:104680569-104680591 AAGGAAACTAAGGCATGGGGAGG - Intronic
1073606711 10:104902816-104902838 GGGGAAACTGAGGCCTGGAAAGG + Intronic
1073822119 10:107275627-107275649 AAGGAAACTGCAGCATGTGGAGG - Intergenic
1073990099 10:109252829-109252851 ATGGAAACTGGGAACTGTGGTGG + Intergenic
1074596936 10:114876434-114876456 AAGGAAACTGAGGCTCGGGGAGG - Intronic
1074703896 10:116114932-116114954 TGGGAAACTGAGGCCTCCAGTGG + Intronic
1074706133 10:116133531-116133553 AGGGAAACTGATGCCCATGGGGG - Intronic
1074779587 10:116791680-116791702 AGGGAAAATGGGGGCTGAGGAGG - Intergenic
1075077342 10:119360048-119360070 AGGGAGACTGAGGGAGGTGGAGG + Intronic
1075083204 10:119397444-119397466 AGGGAAACAGAGGCCCAGGGAGG - Intronic
1075199682 10:120392199-120392221 GGGCAAACTGAGGCCTGGGGAGG - Intergenic
1075544420 10:123343624-123343646 AAGGAAACTGAGGCTTGAAGGGG - Intergenic
1075658068 10:124174799-124174821 GGGGAAACTGAGGCTGGAGGAGG - Intergenic
1076122535 10:127947872-127947894 GGGGAAACTGAGGCCTGTTGTGG + Intronic
1076162450 10:128255903-128255925 AGGGAAAGTGGGGCCTGGGAGGG + Intergenic
1076351342 10:129816807-129816829 AGGCAAGCTGGGGCCTGTGCAGG - Intergenic
1076412778 10:130263869-130263891 TGGGAGACTGAGGCCCATGGTGG + Intergenic
1076727984 10:132422142-132422164 GGGGAGACGGAGGCCAGTGGGGG + Intergenic
1076916120 10:133423825-133423847 AGGCCCACTGAGGCCTGGGGGGG + Intronic
1076936224 10:133568611-133568633 AGGCCCACTGAGGCCTGGGGGGG + Intronic
1076991930 11:279978-280000 GAGGAAACTGAGGCCTGAGCAGG + Intronic
1077315753 11:1918703-1918725 AGGGAAACTGAGGCACCAGGTGG - Intergenic
1077367670 11:2167679-2167701 GGGGAAACTGAGGCCCAGGGGGG - Intronic
1077464335 11:2726464-2726486 GGGGAAACTGAGGCCCCAGGCGG + Intronic
1077466178 11:2734800-2734822 GGGGAAACTGAGGCTGGAGGAGG - Intronic
1077606915 11:3618484-3618506 AGAGAAGCTGAGGCCTGGGAAGG + Intergenic
1078604074 11:12759525-12759547 ATGGAAACTGAGGCACATGGGGG + Intronic
1078849864 11:15153809-15153831 GGGGAAACTGAGGCCCGGAGAGG + Intronic
1079088074 11:17461458-17461480 GGGGAAACTGAGGCTGGTGAGGG - Intronic
1079129190 11:17737681-17737703 AGAGACCCTAAGGCCTGTGGGGG + Intronic
1080253269 11:30259771-30259793 ATGGACACTGGGGCCTGTCGAGG + Intergenic
1080872926 11:36252571-36252593 GGGGAAACTGAGGCTTGAGGGGG - Intergenic
1080889377 11:36396235-36396257 TAGGAAACTGAGGCCTGAGCAGG - Intronic
1081285315 11:41261636-41261658 AGGAAAACTGGGGCTTGTAGGGG + Intronic
1081675096 11:44964001-44964023 GGGAAAACTGAGGCCTGGGAAGG + Intergenic
1081744392 11:45462818-45462840 GGGGAAACTGAGGCCTAGGGAGG + Intergenic
1081773099 11:45661789-45661811 AGGGAACCTGAGGGCCATGGAGG + Intronic
1081866519 11:46363381-46363403 AGGGAAACTGAGGCCCGTGAGGG + Intronic
1081874310 11:46398152-46398174 GGGGAAACTGAGGCCTAGGATGG + Intronic
1081994427 11:47354436-47354458 TGGGAAACTGAGGCTTGTAGAGG - Intergenic
1082001860 11:47397503-47397525 AAGGAAACTGAGGCTCGGGGAGG + Intergenic
1082350997 11:51506271-51506293 AGGGCCTTTGAGGCCTGTGGTGG + Intergenic
1082384831 11:51998625-51998647 AGGGCCTTTGAGGCCTGTGGTGG + Intergenic
1082446813 11:52895549-52895571 AGGGCCTTTGAGGCCTGTGGTGG + Intergenic
1082464633 11:53153975-53153997 AAGGGATTTGAGGCCTGTGGTGG + Intergenic
1082489154 11:53507844-53507866 AGGGCCTTTGAGGCCTGTGGTGG + Intergenic
1082530059 11:54098999-54099021 AGGGCCTTTGAGGCCTGTGGTGG + Intergenic
1082763514 11:57148614-57148636 AGGGAAAAGTGGGCCTGTGGAGG + Intergenic
1083100560 11:60301256-60301278 AGGGAATCTTACGCTTGTGGAGG + Intronic
1083266151 11:61547783-61547805 AGGGAAACTGAGGCCAGGAGAGG - Intronic
1083288494 11:61676438-61676460 AAGGAAACTGAGGCCAGAGTGGG + Intergenic
1083293589 11:61703316-61703338 AGGAAAACTGAGTCCTATGATGG + Intronic
1083618549 11:64037838-64037860 AGGGAAACTGAGGCACAGGGAGG - Intronic
1083642394 11:64152592-64152614 AGGGAAACTGAGGTCTGGGGAGG + Intronic
1083652169 11:64210083-64210105 AGGGAAACTGAGGCCCAGTGAGG + Intronic
1083660237 11:64248717-64248739 AGGGAGGCTGAGGCCGGAGGAGG - Intergenic
1083822347 11:65180656-65180678 AGGAAAACTGAGGCCTGAGAGGG - Exonic
1083897439 11:65627104-65627126 GGGGAAACTGAGGCCTAGAGAGG + Intronic
1083903831 11:65657283-65657305 AGGGTAACTGAGGACAGTGGTGG + Intronic
1084031083 11:66480808-66480830 AGGGAAACTGAGGCTTGGAAAGG - Intronic
1084118019 11:67053150-67053172 GGGGAAACTGAGGCCTGAGAAGG - Intergenic
1084182802 11:67455090-67455112 AGGGAAACTGAGGCTGGGAGGGG + Intronic
1084218328 11:67663538-67663560 AGGGAAACTGAGGCCTTGAGAGG + Intronic
1084273592 11:68041121-68041143 GTGGAAACTGAGGCCTGGGCAGG - Intronic
1084284457 11:68122061-68122083 AGGGAAACTGAGGCTGCGGGAGG - Intergenic
1084385821 11:68842023-68842045 AGGGAAACTGAGGCTCGAGCGGG + Intronic
1084432145 11:69116999-69117021 TGGTAAACTGAGGGCTGTGTTGG - Intergenic
1084483294 11:69434255-69434277 TGGGAGACTGAGGCCTGGGGAGG + Intergenic
1084530400 11:69724116-69724138 AGGGATACTGAGAGCGGTGGGGG - Intergenic
1084534748 11:69750148-69750170 AAGGAAACTGAGGCCCGGGGCGG + Intergenic
1084553343 11:69862173-69862195 AGGCAAACAGAGACCCGTGGAGG + Intergenic
1084673445 11:70621005-70621027 GGAGAAACTGAGGCCTGTTGTGG - Intronic
1084674862 11:70628419-70628441 AGGGAAACCGAGGCCTGGGTAGG - Intronic
1084684786 11:70687200-70687222 GGGGAAACTAAGGCCCGTGCAGG + Intronic
1084697730 11:70765769-70765791 GGGGAAACTGAAGCCTGAGCTGG - Intronic
1084935369 11:72584021-72584043 TGGGAAACTGAGCCCAGAGGTGG + Intronic
1085050514 11:73377699-73377721 GGGGAGACTGAGGCCTGCGCGGG - Intronic
1085201437 11:74704571-74704593 AGGGGCGCTGAGGCCAGTGGGGG + Exonic
1085301260 11:75460083-75460105 TGGGAAACTGAGGCCTGAAGAGG + Intronic
1085323843 11:75591805-75591827 GGGGAAACTGAGGTCTATGGTGG - Intronic
1085399443 11:76226955-76226977 AGAGAAACTGAGGCCCAGGGAGG + Intergenic
1085406508 11:76266261-76266283 AGGGAAACTGAGGCCTAGAAAGG - Intergenic
1085408167 11:76276364-76276386 TGGGAAACTGAGGCTTGATGAGG - Intergenic
1085411879 11:76296306-76296328 GGGGAAACTGAGGCCCAGGGAGG + Intergenic
1085475267 11:76784940-76784962 AGGGAAACTGAGGCCGGAGAGGG - Intronic
1085511697 11:77091464-77091486 AAGGAAACTGAGGCCCAGGGAGG - Intronic
1085823467 11:79817852-79817874 GGGGAAACTGAGGCCTCAGTTGG + Intergenic
1086425250 11:86676697-86676719 AGGGAGACTGAGGGCTGGAGAGG + Intergenic
1086585038 11:88441732-88441754 GGGAAAACTGGGGCCTGTCGGGG - Intergenic
1087194471 11:95291835-95291857 AAGGAAATTGAGGTCTGTGGAGG + Intergenic
1088183444 11:107137805-107137827 ATGGAAACAGAGGCCTGGGAAGG - Intergenic
1088440693 11:109867147-109867169 AGGGAGATGGAGGCCTTTGGAGG + Intergenic
1088538264 11:110885228-110885250 AGGAAGACTGATGGCTGTGGGGG + Intergenic
1088702004 11:112421811-112421833 AGGGAAACTGAGGCTGGCAGAGG + Intergenic
1089215083 11:116830244-116830266 AGGGAAACTGAGGCCTGGAGAGG + Intronic
1089603814 11:119630187-119630209 GGGGAAACTGAGGCCCTGGGAGG - Intronic
1089709562 11:120305371-120305393 AGGGAAACTGAGGACGTTGCTGG + Intronic
1089989115 11:122841914-122841936 AGGGAAGCTAAGGCCTGTTTTGG + Intronic
1090315851 11:125787849-125787871 GAGGAAACTGAGGCTTGTTGAGG - Intergenic
1090651169 11:128807489-128807511 AAAGAAACTGAGGCCCGGGGAGG + Intronic
1091704140 12:2682235-2682257 AGGGAAACTGAGGCATGAGGTGG + Intronic
1091713684 12:2760883-2760905 AGGGAAACTGAGGCATGTGTTGG + Intergenic
1092500896 12:9046012-9046034 ACAGACACTGGGGCCTGTGGGGG + Intergenic
1092547881 12:9467364-9467386 AGAGAAACTGAGGCATGGGGTGG + Intergenic
1092728528 12:11507573-11507595 AGGGAAACTGAGGAATGGGGTGG - Intergenic
1093374093 12:18402940-18402962 GAGGAAACTGAGGCCTATAGAGG + Intronic
1094062263 12:26326817-26326839 GAGGAAACTGAGGCATGGGGTGG - Intergenic
1094474549 12:30831369-30831391 AGGGAAACTGAGGCATAGGGTGG - Intergenic
1094505103 12:31054998-31055020 AGAGAAACTGAGGCATGGGGTGG - Intergenic
1095110620 12:38291237-38291259 ATGGAAACGAAGGCCTGGGGAGG + Intergenic
1095375379 12:41521623-41521645 GAGGAAACTGAAGCCTGTGAAGG + Intronic
1096119853 12:49081321-49081343 AGGGAAACTGAGGCCGGGCATGG - Intergenic
1096492578 12:52020839-52020861 AAGGAAGCTGAGGGCTCTGGAGG + Intergenic
1096646811 12:53043072-53043094 AGTGAAACTGATTCCTGTGGTGG - Intergenic
1096818543 12:54216753-54216775 AGGGAAACTGAGGCCATCTGTGG - Intergenic
1097823370 12:64149824-64149846 TGGGAAACTGAGGCATGGGTTGG + Exonic
1098042948 12:66370496-66370518 AGGGAAATTGAGGTCTTTAGAGG + Intronic
1098947925 12:76608906-76608928 GGGGAAGCTGAGGCCTGCGAAGG + Intergenic
1101440678 12:104702373-104702395 ATGGAAACTGAGGCATAGGGAGG + Intronic
1101752269 12:107591639-107591661 AGGGACACTGTTACCTGTGGGGG + Intronic
1101752272 12:107591658-107591680 GGGGAAACTGAGGCATGTCATGG + Intronic
1101848991 12:108387375-108387397 AAGGAAACTGAGGCTTGAAGAGG - Intergenic
1101870302 12:108560575-108560597 GAGGAAACTGAGGCTCGTGGAGG - Intronic
1101876287 12:108598568-108598590 TGGGAAACTGAGGTCTGGAGAGG - Intergenic
1101877200 12:108603646-108603668 GGGGAAACTGAGGCCCAAGGAGG - Intergenic
1101952201 12:109185859-109185881 GGGGAAACTGAGGCATGGGAAGG + Intronic
1101990404 12:109479442-109479464 AAGGAAACTGAGGCCTAGAGAGG + Intronic
1102000138 12:109552434-109552456 GAGGAAACTGAGGCCTGGAGAGG - Intergenic
1102036351 12:109772453-109772475 GGGGAAACTGAGGCCCAAGGAGG - Intergenic
1102042625 12:109810414-109810436 GGGGAAACTGAGGCCAGGGCAGG + Intronic
1102046969 12:109835506-109835528 TGGGAAACTGAGGCTTGGAGAGG + Intergenic
1102148438 12:110671880-110671902 GGGCAAACTGAGGCCTGGGGAGG + Intronic
1102157939 12:110745343-110745365 AGGCAAACTGAGGCCTAGAGAGG - Intergenic
1102348676 12:112176079-112176101 TGGGAAACTGCAGCCTGTTGAGG - Intronic
1102358317 12:112259890-112259912 AGAGAAACTGAGGCTTGTCTGGG + Intronic
1102422655 12:112816214-112816236 GGGGAAACTGAAGCCTGGAGGGG - Intronic
1102460089 12:113094751-113094773 GGGGAGACTGAGGACTGGGGAGG - Intronic
1102548786 12:113675632-113675654 GGGGAAAATGAGGCCCGAGGAGG - Intergenic
1102556529 12:113730452-113730474 GAGGAAACCGAGGCCTGTAGAGG + Intergenic
1102617770 12:114169528-114169550 GGGGAAACTGAGGCCTGTCTAGG - Intergenic
1102688093 12:114739826-114739848 GGGAAAACTGAGGCCTGGTGAGG + Intergenic
1102705503 12:114876853-114876875 GAGGAAACTGAGGCCTGGAGTGG - Intergenic
1102823218 12:115925628-115925650 AAGGAAACTGAGGCCTGGAGAGG - Intergenic
1102885423 12:116518155-116518177 AGGGAAACTGAGGCCTAGTTAGG - Intergenic
1103085959 12:118061659-118061681 AGGGAGACCGAGGGCTGTGGGGG + Intronic
1103561229 12:121794150-121794172 GGGGAAGCTGAGGCCAGAGGCGG - Exonic
1103573436 12:121859613-121859635 GGGGAAACTGAGGCCTGGAGAGG + Intronic
1103875013 12:124120213-124120235 AGGGAAACTGGGGGCTGTTTAGG + Intronic
1103938917 12:124491388-124491410 AGGGAAACTGAGGCACGGGACGG + Intronic
1103981020 12:124736950-124736972 GGGAAAACTGAGGCCTGGGGTGG - Intergenic
1104262118 12:127194023-127194045 ATGGACCCTGGGGCCTGTGGAGG - Intergenic
1104462236 12:128965230-128965252 AGAGAGACTGGGACCTGTGGAGG + Intronic
1104685592 12:130782291-130782313 AGGGAATGTGAGGTCAGTGGAGG - Intergenic
1104720619 12:131043293-131043315 GAGGAAACTGAGACTTGTGGAGG + Intronic
1104754048 12:131258028-131258050 GGGGAAACTGAGGCCTGGAAAGG - Intergenic
1106036602 13:26050458-26050480 GGAGAAACTGAGGCCCGTGAGGG + Intronic
1106056298 13:26240857-26240879 GGGGAAACTGAGGCTTATAGAGG - Intergenic
1106070071 13:26402193-26402215 CAGGAAACTGAGGCTTGTAGAGG + Intronic
1106134407 13:26963188-26963210 GGGGAAACTGAGGCCTAGGAAGG - Intergenic
1106488126 13:30190685-30190707 AGGGGAACTGAGGCCTAGTGAGG - Intergenic
1106638713 13:31559860-31559882 AGGGACACTGGGGCCTGTCAGGG - Intergenic
1110195233 13:72781525-72781547 AGGGAAACTGAGGCCCAGGGAGG - Intronic
1110701192 13:78551126-78551148 AGGGAAACTAAAGCCTGCAGAGG - Intergenic
1111550666 13:89806961-89806983 AGGGAGACTGGAGCCTGTCGGGG + Intergenic
1111970442 13:94908826-94908848 TGGGAGACTCAGGCTTGTGGAGG - Intergenic
1112000216 13:95203044-95203066 AAAGAAACTGAAGCCTGAGGAGG - Intronic
1112428044 13:99322850-99322872 AGGGAAAATGAGCCATCTGGAGG + Intronic
1113137803 13:107113319-107113341 ATGGCACCTGAGGCCTGGGGTGG + Intergenic
1113156029 13:107322986-107323008 AGAGAAAGTGAAGTCTGTGGTGG - Intronic
1113439505 13:110316711-110316733 GGGTAAACTGAGGCATGTGCAGG + Intronic
1113673630 13:112193671-112193693 ACGGAGCCTGAGGCCTGTGCGGG - Intergenic
1113911171 13:113841998-113842020 GAGGAAACTGAGGCATATGGAGG - Intronic
1113911179 13:113842036-113842058 AAGGAAATTGAGGCGTATGGAGG - Intronic
1113955040 13:114095755-114095777 GGGGAAACTGAGGCCTGGAGAGG - Intronic
1114530543 14:23392817-23392839 AAGGCAACTGTGGCCAGTGGAGG + Intronic
1115428603 14:33289941-33289963 GGGGAAACTGAAGCCTGAGATGG - Intronic
1116093670 14:40340175-40340197 GGGGAAACTGGGGCATGGGGTGG + Intergenic
1117000492 14:51366267-51366289 GGGGAACCTGAGGCAGGTGGTGG + Intergenic
1117804612 14:59478718-59478740 AGGAAAACTGAGGCATATGGAGG + Intronic
1118266281 14:64297512-64297534 AGGTAAGATGAGGGCTGTGGGGG - Intronic
1118386786 14:65262298-65262320 AAGAAAAGTGAGGCTTGTGGAGG - Intergenic
1118696437 14:68390730-68390752 GGGGAAACTGAGGCTTAAGGAGG + Intronic
1118889003 14:69891670-69891692 AGGCAAGCAGAGGCCTGGGGAGG - Intronic
1118909812 14:70051843-70051865 GGGGAAACTGAGACCTGGGGTGG + Intronic
1118975984 14:70677048-70677070 AAGGAAACTGAGGCCAGGGAGGG - Intergenic
1119176297 14:72569833-72569855 AAAGAAACTGAGGCCTATAGTGG + Intergenic
1119418811 14:74493904-74493926 TGGGAAACTAAGGCCTGTGGGGG + Intronic
1119443368 14:74644552-74644574 GGGGAAACTGAGGCATGAGGTGG - Intergenic
1119480208 14:74954136-74954158 AGGAAAACTGAGGCCAGAGAGGG - Intronic
1119559143 14:75576521-75576543 AAGGAAACTGAGGCCTGGAGAGG - Intergenic
1119644588 14:76339284-76339306 GGAGAAACTGAGGCATGGGGAGG - Intronic
1119701813 14:76761075-76761097 GGGGAAACTGAGGCCTACAGAGG + Intergenic
1119768321 14:77204827-77204849 AAGGAAACTGAGGCATAGGGAGG + Intronic
1119950991 14:78744829-78744851 AGGGCAACTGGGGCATGTAGGGG + Intronic
1120281370 14:82442898-82442920 AGGGAAACTCAGGACGGTGTTGG - Intergenic
1120410213 14:84144850-84144872 AGGGACACTGGGGCCTGTCAGGG - Intergenic
1120601617 14:86517328-86517350 AAGAAAACTGAGGCATGAGGTGG + Intergenic
1120827822 14:88971014-88971036 ATGGGAAGTGAGGCCTGTAGAGG + Intergenic
1120908344 14:89641038-89641060 AGGGAAACTGAGGCCTAGTCAGG + Intronic
1121263417 14:92583014-92583036 AAGGCAACTGAGGCCTGGAGAGG - Intronic
1121401890 14:93686947-93686969 GGAGAAACTGAGGCTTGGGGTGG + Intronic
1121422412 14:93824852-93824874 GGGGAAACTGAGGCGTGGAGAGG + Intergenic
1121456484 14:94041975-94041997 AGGGAGACAGTGGCTTGTGGAGG - Intronic
1121571743 14:94951524-94951546 GGGGAAACTGAGGCCTACAGAGG - Intergenic
1121701855 14:95960802-95960824 ATGGAAGCTGAGGCCTGGAGAGG + Intergenic
1121720958 14:96108389-96108411 GGGGAAACTGAGGGCTGGAGAGG - Intergenic
1122031418 14:98915314-98915336 GGGGAAACTGAGGCTTGAGAGGG - Intergenic
1122135207 14:99628799-99628821 AGGGAAACTGAGGCCCGAGAGGG - Intergenic
1122136436 14:99635503-99635525 AGGGAAACTGAGGCCCAGGGAGG - Intergenic
1122146418 14:99691564-99691586 GTGGAAACTGAGGCCTGCTGGGG + Intronic
1122235216 14:100327446-100327468 GGGGAAACTGAGGCTTGATGAGG + Intronic
1122272847 14:100576066-100576088 GGGGAAACTGAGGCATGATGAGG + Intronic
1122297169 14:100712162-100712184 GGGGAAACCGAGGCCTGGGCGGG + Intergenic
1122320964 14:100855533-100855555 AGGCAAGGTGAGGCCTGGGGAGG - Intergenic
1122374275 14:101248031-101248053 GGGGAAATTGAGGCCTGGAGAGG - Intergenic
1122517703 14:102320075-102320097 GGGGAAACTGAGGCCCGAAGGGG + Intronic
1122646127 14:103195416-103195438 CGGGAAACTGAGGCCACTGGCGG + Intergenic
1122744643 14:103890552-103890574 GAGGAAACTGAGGCTTGGGGTGG + Intergenic
1122806847 14:104264179-104264201 GGGGAAACTGAGGCCCAGGGTGG + Intergenic
1122861683 14:104585302-104585324 CGGGAAACTGAGGCCAGAGGGGG - Intronic
1122904625 14:104795970-104795992 GGGGAAACTGAGGCCAGAGAGGG - Intergenic
1122983607 14:105202371-105202393 AGGGTGGCTGAGCCCTGTGGGGG + Intergenic
1123059342 14:105587420-105587442 AGGGAAACTGAGGCAGGCTGAGG - Intergenic
1123083674 14:105707651-105707673 AGGGAAACTGAGGCAGGCTGAGG - Intergenic
1123467434 15:20527286-20527308 AGGGAAACTGAGGTCAGAGTGGG - Intergenic
1123650680 15:22473756-22473778 AGGGAAACTGAGGTCAGAGTGGG + Intergenic
1123741089 15:23282598-23282620 AGGGAAACTGAGGTCAGAGTGGG + Intergenic
1123745909 15:23319960-23319982 AGGGAAACTGAGGTCAGAGTGGG - Intergenic
1124125195 15:26932926-26932948 ACACACACTGAGGCCTGTGGTGG + Intronic
1124206727 15:27727128-27727150 TGGGAAAATGAGGCATGTGGTGG + Intergenic
1124278181 15:28343277-28343299 AGGGAAACTGAGGTCAGAGTGGG - Intergenic
1124304520 15:28568331-28568353 AGGGAAACTGAGGTCAGAGTGGG + Intergenic
1124533409 15:30524803-30524825 AGGGAAACTGAGGTCAGAGTGGG + Intergenic
1124602822 15:31149136-31149158 AAGGGAACTGAGGGCTGGGGAGG + Intronic
1124765248 15:32482842-32482864 AGGGAAACTGAGGTCAGAGTGGG - Intergenic
1125018523 15:34961770-34961792 AAGGAAACTGAGGCTTGGAGAGG - Intronic
1126110367 15:45171610-45171632 AAGGAAACTGAGGCCTAGAGAGG + Intronic
1126541739 15:49831654-49831676 AGGGAAAGTGAGGGCTGCTGTGG + Intergenic
1126716577 15:51524763-51524785 AGAGAACCTGAGCCTTGTGGTGG - Intronic
1127071784 15:55294295-55294317 AATGAAACTGAGGCCTGGCGCGG + Intronic
1127310456 15:57747471-57747493 AGGGGAAGTGGGGCCTGAGGAGG - Intronic
1127390295 15:58499817-58499839 AGGAAAACTGTGTCCTGGGGAGG + Intronic
1127549852 15:60026139-60026161 AGGGAAACTGAGGCACAGGGTGG + Intronic
1128087364 15:64895294-64895316 GGGGAAACTGAGGCCTAGTGAGG + Intronic
1128159724 15:65415627-65415649 GGGGAAACTGAGGCCTGGGGAGG + Intronic
1128334724 15:66778636-66778658 AGGGAAACTGAGGCTTAGGGAGG + Intronic
1128543410 15:68552083-68552105 AGGGAAACTGAGGACCAAGGAGG + Intergenic
1128645479 15:69375699-69375721 AAGGAAACTGAGGCCTGGAGAGG - Intronic
1128711176 15:69873070-69873092 GGGGACACAGAGGCCTGCGGAGG - Intergenic
1128756969 15:70189774-70189796 AAGGAAACTGAGGCTTAGGGGGG + Intergenic
1129015354 15:72462921-72462943 AGGGAAAATGTGGCCTGAGCTGG - Intergenic
1129324853 15:74794478-74794500 AGGGACACTGAGGCCCAAGGAGG - Intronic
1129329726 15:74820853-74820875 AGGGAAACTGAGGCCTGAGGAGG + Intronic
1129517016 15:76163089-76163111 TGTGAAACTGAGGCCTGGAGAGG + Intronic
1129645279 15:77424438-77424460 AGGAAAACTGAGGCTTAGGGAGG - Intronic
1129661095 15:77553602-77553624 AGGGCAACTGTGGGCTGTGAAGG - Intergenic
1129692870 15:77723735-77723757 GAAGAAACTGAGGCCTGGGGAGG - Intronic
1129741432 15:77991483-77991505 ACAGAAACTGAGGCCCCTGGGGG + Intronic
1129844231 15:78760924-78760946 ACAGAAACTGAGGCCCCTGGGGG - Intronic
1129872233 15:78947869-78947891 GAGGAAACTGAGGCTGGTGGGGG - Intronic
1129883402 15:79022023-79022045 AAGGAAACTGAAGCCTGATGAGG + Intronic
1130117773 15:81020409-81020431 AAGGAAACTGAGGCCTAGAGAGG - Intronic
1130255333 15:82323358-82323380 AGGGAAACTGAGGGATATTGGGG - Intergenic
1130306369 15:82714557-82714579 GGGGAAACTGAGGCTTGGAGAGG + Intergenic
1130335397 15:82953060-82953082 AAGGGAACCGAGGCCTGGGGAGG + Intronic
1130574749 15:85081941-85081963 AGGGGATGTGAGGGCTGTGGAGG - Intronic
1130599632 15:85266628-85266650 AGGGAAACTGAGGGATATTGGGG + Intergenic
1130886098 15:88093936-88093958 TGGGAAACTGAGGCTTGGGGAGG + Intronic
1131020076 15:89089989-89090011 GAGGAAACTGAGGCCTGGGGTGG + Intronic
1131147405 15:90023096-90023118 AGGGAAACTGAGGCTTATGAAGG + Intronic
1131238502 15:90717626-90717648 GGGGAAACAGAGGCCCGGGGCGG + Intronic
1131959574 15:97774221-97774243 ACACACACTGAGGCCTGTGGGGG + Intergenic
1132040820 15:98523436-98523458 GAGGAAACTGAGGCCTCTAGAGG + Intergenic
1132594175 16:740709-740731 AAGGAAACTGAGGCCAGGGAGGG - Intronic
1132661680 16:1064309-1064331 TGGGAAGCTGGGGGCTGTGGAGG + Intergenic
1132664142 16:1073982-1074004 AGGGAAACTGAGGCAGGTGTGGG - Intergenic
1132958981 16:2611873-2611895 AAAGAAACTGAGGCTTGGGGTGG + Intergenic
1132972040 16:2693848-2693870 AAAGAAACTGAGGCTTGGGGTGG + Intronic
1133026019 16:2989310-2989332 AGGGAAACTGAGACCTGGAAAGG + Intergenic
1133210748 16:4262171-4262193 GGGGAAACTGAGGCCGGGGCAGG + Intronic
1133222667 16:4325490-4325512 GGGGAAACTGAGGGCTGAAGGGG - Intronic
1133454877 16:5933344-5933366 AGGCAAACTGAGGGCAGTGGGGG + Intergenic
1133996336 16:10751407-10751429 AGGGCACCTGAGGCCAGTGCTGG + Intronic
1134009232 16:10838948-10838970 GGGAAAACTGAGGCCTGTGGGGG + Intergenic
1134068491 16:11245848-11245870 AGGGAAACTGAGGCCAGGAGAGG - Intergenic
1134130084 16:11643220-11643242 AGGGAAACAGAGGCCGGGTGTGG + Intergenic
1134322165 16:13174033-13174055 TGGGAAACTGAGGCCTAGAGAGG - Intronic
1134381962 16:13735896-13735918 AGTGAGACTGGGGCCTGTTGAGG - Intergenic
1134645133 16:15859051-15859073 AGGGAAATTGAGGCATGGAGAGG - Intergenic
1134664397 16:16008217-16008239 AGGGAAACTGAGGCTTGGGGAGG - Intronic
1135161172 16:20097733-20097755 AGGGTAAATCAGGACTGTGGTGG + Intergenic
1135589787 16:23696597-23696619 TGGGAAACCGAGGCCTCTAGGGG - Intronic
1136237029 16:28920852-28920874 AAAAAAACAGAGGCCTGTGGTGG - Intronic
1136275366 16:29176632-29176654 GAGGAAACTGAGGCTTGGGGAGG + Intergenic
1136464319 16:30431554-30431576 AAGGAAACTGAGGCCGGGCGCGG + Intergenic
1136500448 16:30667452-30667474 AGGGAACCTCAGGCCCGAGGGGG - Intronic
1136990937 16:35151084-35151106 AGGGAGGCTGAGACCTGGGGTGG - Intergenic
1137573154 16:49579630-49579652 GGGGAAACTGAGGCTTGCGTAGG + Intronic
1137599779 16:49748794-49748816 AGGGAAACTGAGGCCCCGAGGGG + Intronic
1137692750 16:50440951-50440973 AGGTAAAGTGAAGCCTCTGGAGG + Intergenic
1137709674 16:50557810-50557832 AGGGAAGCACAGGGCTGTGGAGG + Intronic
1137719544 16:50620019-50620041 GGGGAAACTGAGGCTTGGAGAGG - Intronic
1137729628 16:50680195-50680217 GAGGAAACTGAGGCCTGGAGAGG - Intronic
1137956402 16:52835206-52835228 AGGGATACTAAGGCCTGGAGAGG - Intergenic
1138045283 16:53716395-53716417 GGAGAAACTGTAGCCTGTGGTGG + Intronic
1138409846 16:56830341-56830363 AAGGAAACTGAGGCATGGAGGGG - Intronic
1138434234 16:56988433-56988455 AAGGAAGCTGAGGCCAGGGGAGG + Intergenic
1138436107 16:57000951-57000973 GGGGAAACTGAGGCCCTGGGAGG - Intronic
1138442686 16:57044578-57044600 GAGGAAACTGAGGCCTGGAGAGG - Intronic
1138501125 16:57445649-57445671 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1138519747 16:57564125-57564147 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1138545680 16:57718142-57718164 AGGGAAACTGAGGCCCCGAGGGG - Intronic
1138551134 16:57749120-57749142 AGGGGCACTGAGGCCTGGGGAGG + Intronic
1138589723 16:57993249-57993271 TGGGGAACTGAGGCCTGAGAGGG + Intergenic
1138600584 16:58051727-58051749 GGGGATACTGAGGCCTGGAGAGG + Intergenic
1139070797 16:63380024-63380046 GGGAAAACTGAGGCCTGGGGAGG - Intergenic
1139334246 16:66220002-66220024 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1139634348 16:68248872-68248894 ACGGAAACTGAGGCCTAGTGTGG + Intronic
1139685434 16:68599608-68599630 GGAGAAACTGAGTCCTGTGGGGG + Intergenic
1139996645 16:70987148-70987170 AGGGACACTGAGGCTTGGAGAGG + Intronic
1140252710 16:73308394-73308416 AGGGAGACTGAGGCAGGAGGCGG - Intergenic
1140818650 16:78643341-78643363 AATGAAACTGAGGCTTCTGGAGG + Intronic
1140835457 16:78789955-78789977 AGGGAAACTGAGGCTTGGAGAGG - Intronic
1140953877 16:79844843-79844865 ATGGAAACTGAGGCTTGAGGAGG + Intergenic
1141192741 16:81836223-81836245 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1141369478 16:83473845-83473867 AGGGAAGCTGAGGCCCAGGGAGG - Intronic
1141465078 16:84200222-84200244 GGGGAAGCTGAGGACTGGGGAGG - Intergenic
1141597703 16:85107439-85107461 GGGGAAACCGAGGCCCATGGAGG + Intronic
1141631618 16:85291142-85291164 GGGGAAACTGAGGCATGTAGTGG + Intergenic
1141747402 16:85934952-85934974 CGGGAAAACGAGGCCTGGGGTGG - Intergenic
1141862259 16:86725872-86725894 GAGGAAACTGAGGCATGGGGTGG + Intergenic
1141909104 16:87046452-87046474 GGGGAAACTGAGGCCTGGGGAGG - Intergenic
1141922149 16:87143498-87143520 GGGGAAACTGAGGCTTGGAGTGG - Intronic
1142008124 16:87700027-87700049 AGAGACCCTGAGGCCTGTGGTGG + Intronic
1142079726 16:88142697-88142719 GAGGAAACTGAGGCTTGGGGAGG + Intergenic
1142124297 16:88402539-88402561 AGGGAAACTGAGGCCCCTGCAGG - Intergenic
1142146223 16:88493990-88494012 GCGGAAACTGAGGCCTGGAGGGG - Intronic
1142147770 16:88499715-88499737 TGGGAAACTGAGGCCAGGAGAGG + Intronic
1142154235 16:88525983-88526005 GAGGAAACTGAGGCCTGGGAAGG - Intronic
1142243641 16:88958588-88958610 GGGGAGACTGAGGCCTGGGTGGG + Intronic
1142292622 16:89199942-89199964 GGGGAAACTGAGGCATGAGAGGG + Intronic
1142583461 17:955992-956014 AGGGAAACTGAGGCTCAGGGAGG - Intronic
1142696595 17:1637289-1637311 GCGGAAACTGAGGCCTAGGGAGG - Intronic
1142803637 17:2360366-2360388 AGGGAAATTGAGGTCTGTCAAGG - Intronic
1142982897 17:3681616-3681638 AGAGAAACCGAGGCCCGGGGAGG + Intronic
1142986244 17:3696816-3696838 TGGGGAACTGAGGCCAGGGGAGG + Intergenic
1143002837 17:3805841-3805863 AGGGAAGCTGAGGCCCAGGGAGG + Intergenic
1143020453 17:3914809-3914831 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1143230831 17:5353177-5353199 ATGGAAAAGCAGGCCTGTGGAGG - Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143726306 17:8849165-8849187 AGGTAAACTGAGGCTTGGAGAGG - Intronic
1143845952 17:9772732-9772754 AGGGAAGCTGGGGCCCCTGGGGG - Intronic
1144035039 17:11357244-11357266 AGGGATTCAGAGGCCTGTGGTGG + Intronic
1144182724 17:12767967-12767989 AAGGCAGCTGAGGGCTGTGGGGG - Exonic
1144539120 17:16121928-16121950 GAGGAAACTGAGGCCCATGGGGG - Intronic
1144833456 17:18144348-18144370 GGGGAAACTGAGGCTGGTGAGGG - Intronic
1144843780 17:18205227-18205249 GGGGAAACTGAGGCCCGAGGAGG + Intronic
1144958287 17:19030662-19030684 AAGGAAACTGAAGCCTGGAGAGG - Intronic
1144976871 17:19143862-19143884 AAGGAAACTGAAGCCTGGAGAGG + Intronic
1145010145 17:19363291-19363313 GGGGAAACTGAGGCCCGCAGCGG + Intronic
1145205238 17:20981302-20981324 AGGGAAACTGAGGCTGGAGAGGG + Intergenic
1145251255 17:21298119-21298141 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1145302049 17:21647811-21647833 AAGGAAACTGAGGCCTAGAGAGG - Intergenic
1145328395 17:21850595-21850617 AAGGAAACTGAGGCCTAGAGAGG - Intergenic
1145348261 17:22055505-22055527 AAGGAAACTGAGGCCTAGAGAGG + Intergenic
1145773531 17:27510323-27510345 AGGGAAACTGAGGCTCATTGAGG - Intronic
1146248275 17:31311053-31311075 AGGGAAGCTGAGGTGTGAGGAGG - Intronic
1146350158 17:32085758-32085780 AGGGAAACTGAGGCTCAGGGTGG - Intergenic
1146372581 17:32274717-32274739 AGGGAAAGTGAGGTTTGAGGGGG + Intronic
1146462092 17:33054363-33054385 GGGGAAACTGAGGCCCAGGGAGG - Intronic
1146554920 17:33815144-33815166 ATGGGAACTGAGGCCTGAGATGG - Intronic
1146642332 17:34550666-34550688 TTGGAAACTGAGGCCTAGGGAGG + Intergenic
1146923493 17:36729034-36729056 GGGGAAACTGAGGTCTGGAGAGG + Intergenic
1146925788 17:36743880-36743902 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1147164571 17:38586478-38586500 AGGGAAACTGAGGCTCAGGGAGG + Intronic
1147260867 17:39209316-39209338 GGGGAAACTGAGGCCTGGAGTGG - Intergenic
1147482822 17:40783115-40783137 GTGGAAACTGAGGCCCGAGGAGG - Intergenic
1147498234 17:40937739-40937761 AGGAAAGCTGAGGCCTATGGTGG + Intergenic
1147518815 17:41148693-41148715 AAGAAAACTGAGGCCTGAGGAGG + Intergenic
1147767587 17:42846948-42846970 AGGGAAACTAAGGAGGGTGGCGG + Intronic
1147793579 17:43027643-43027665 ATGGAAACTGGGGCCTGGAGAGG - Intronic
1148357619 17:46986250-46986272 AAGGAAACTTAGGCTTGGGGAGG - Intronic
1148654973 17:49276482-49276504 TGGGAGACTGAGGTCTGAGGTGG + Intergenic
1148686713 17:49505206-49505228 GGGGAAACTGAGGCCTGTAGGGG - Intronic
1148888444 17:50790301-50790323 TGGGAGAGTGAGGCCTGTGAAGG + Intergenic
1149383904 17:56123108-56123130 AGGGAAACTGAGGCATGGACAGG + Intronic
1150142873 17:62744731-62744753 AGGGAAACTGAGGCTTGGAGAGG - Intronic
1150645407 17:66974776-66974798 AGAGAGCCTGGGGCCTGTGGGGG - Intronic
1151221964 17:72619570-72619592 AGGGCAACTGAGGCCGGGTGTGG - Intergenic
1151367217 17:73625445-73625467 CAGGAAACTGAGGCCTGGAGAGG + Intronic
1151559654 17:74863437-74863459 AGGGAAACTGAGGTGTAAGGGGG - Intronic
1151834467 17:76573957-76573979 AAAGAATCGGAGGCCTGTGGGGG + Intronic
1151874282 17:76857636-76857658 AGGGAAACTGAGGCTCGGAGCGG - Intergenic
1151957049 17:77385675-77385697 AGGGGACCTGAGGCCTGGGCTGG + Intronic
1152012159 17:77725291-77725313 ACGGGAACTGAGGCCTGCTGAGG - Intergenic
1152310816 17:79548606-79548628 GGAGAAACTGAGGCCTGAGCTGG - Intergenic
1152437471 17:80285244-80285266 GGGGAAACTGAGGCCCACGGTGG + Intronic
1152570278 17:81118668-81118690 AAGGAAACTGAGGCCTGAACAGG + Intronic
1152733727 17:81986638-81986660 GAGGAAACTGAGGCCCGGGGAGG - Intronic
1152734870 17:81992374-81992396 AGGGAATCTGATCCCTCTGGAGG + Intronic
1153592605 18:6689461-6689483 ATGTAAACTGTGGCCTCTGGGGG + Intergenic
1153695934 18:7641880-7641902 GAGGAAACTGAGGCCTGGAGAGG + Intronic
1153959490 18:10128514-10128536 GAGAAAACTGAGGCCTGTAGAGG - Intergenic
1154341886 18:13510348-13510370 AGAGAAACTGAGGCCCCAGGAGG - Intronic
1154358591 18:13641578-13641600 AGGGAGGCCGGGGCCTGTGGCGG + Intronic
1155203665 18:23538606-23538628 AGGCAAACAGAGGCCTCAGGGGG - Exonic
1155296335 18:24387878-24387900 AGGGAAACTGCAGCTTCTGGTGG - Intronic
1155820708 18:30371588-30371610 AAGGAAGCAGAAGCCTGTGGAGG - Intergenic
1156502704 18:37569675-37569697 AGGGAAGCTGAGCCCAGTGAGGG - Intergenic
1156971168 18:43158299-43158321 AGGCAACTTGAAGCCTGTGGAGG - Intergenic
1157116242 18:44865002-44865024 GGGGAAATTGAGGCATGGGGAGG - Intronic
1157166673 18:45363846-45363868 AGGAGAAGTGAGGCCTGAGGAGG - Intronic
1157409311 18:47450456-47450478 GGGGAAACTGAGGCCTCAGAAGG - Intergenic
1157439306 18:47697773-47697795 AGGGAACGTGAGGGCTGAGGAGG - Intergenic
1157516978 18:48318094-48318116 GGGGAAACTGAGGGCTGAGGTGG + Intronic
1157621744 18:49020966-49020988 GGGGAAACTGAGGCCTCAGGAGG - Intergenic
1157712828 18:49861744-49861766 AAGGAGACTGAGGCCCGGGGGGG - Intronic
1158399971 18:57113289-57113311 GGGGAAACTGAGGCATGGAGAGG + Intergenic
1158806469 18:60979638-60979660 AGGGTATCTGAGGTGTGTGGAGG + Intergenic
1158845180 18:61434537-61434559 AGGGAAACTGAGGCCTCAAGAGG + Intronic
1158918230 18:62159009-62159031 TGGGAAGCTGAGGCAGGTGGAGG + Intronic
1159897248 18:74008894-74008916 AGAGAAACTGTGGCCTGTGGGGG - Intergenic
1160022065 18:75188828-75188850 GGGGAAACTGAGGCCCGAGGAGG - Intergenic
1160403679 18:78629652-78629674 AGGGAATCTGAGGGCTGGGTCGG + Intergenic
1160691232 19:461381-461403 GGGGAAACTGAGGCCCCGGGAGG + Intergenic
1160691266 19:461502-461524 GGGGAAACTGAGGCGCGGGGAGG + Intergenic
1160698182 19:494568-494590 AGGGAAACTGAGGCCCGGGGTGG - Intronic
1160699719 19:500056-500078 GGGGAGACTGAGGCCCGTGAGGG - Intronic
1160730282 19:638962-638984 GGGGAAACCGAGGCCTGAGAGGG - Intergenic
1160735804 19:661928-661950 GGGGAAACTGAGGCGCGTGGTGG - Intronic
1160738902 19:677034-677056 GGGGAAACTGAGGCCAGGAGTGG - Intronic
1160775873 19:855483-855505 GGGGAAACTGAGGCCCGGAGAGG + Intronic
1160793152 19:932325-932347 AGGGAAACTGAGGCTGGGCGGGG + Intronic
1160793755 19:934508-934530 GGGGAAACTGAGGCCAGTGCAGG + Intronic
1160814236 19:1027946-1027968 AGGGAGGCTGAGGCTTGGGGTGG + Intronic
1160829325 19:1095650-1095672 GGGGAAACTGAGGCCTGGATGGG + Intergenic
1160847928 19:1174468-1174490 GAGGAAACTGAGGCTTGAGGAGG - Intergenic
1160865401 19:1253865-1253887 GGGGAAACTGAGGCCAGAGGGGG - Intronic
1160875528 19:1294747-1294769 GGGGAAACTGAGGCCAGGGTGGG + Intronic
1160875950 19:1296190-1296212 GGGGAAACTGAGGCTTGGAGGGG + Intronic
1160879031 19:1311209-1311231 GGGGAAACTGAGGCCGGGGAAGG + Intergenic
1160892087 19:1384301-1384323 TGGGAAACTGAGGCCCATTGAGG + Intronic
1160896123 19:1402665-1402687 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1160904807 19:1447067-1447089 GGGGAAACTGAGGCCCATAGCGG + Intronic
1160918172 19:1507466-1507488 GGGGAGACTGAGGCCTGAGGAGG - Intronic
1160918589 19:1509381-1509403 GGGGAAACTGAGGCCCAGGGAGG - Intronic
1160919725 19:1513784-1513806 GGGGAAACTGAGGCCGGAGAGGG - Intergenic
1160937712 19:1605102-1605124 GGGGAAACTGAGGCTTGGAGCGG + Intronic
1160952576 19:1674693-1674715 AGGGAAACTGAGGCCCAGGGAGG - Intergenic
1160991615 19:1862625-1862647 AAGGAAACTGAGGCTGGGGGAGG + Intronic
1161028549 19:2047675-2047697 GGGGAAACTGAGGCCCAGGGAGG - Intronic
1161084063 19:2325902-2325924 GTGGAAGCTGAAGCCTGTGGAGG - Intronic
1161111806 19:2475044-2475066 GGGGAAACTGAGGCTTGGTGAGG - Intergenic
1161118496 19:2512519-2512541 AGGTAAACTGAGGCTCGGGGAGG - Exonic
1161201037 19:3014882-3014904 GGGTAAACTGAGGCCTGAGAGGG - Intronic
1161203736 19:3029435-3029457 GGGGAAACTGAGGCCGGGTGGGG + Intronic
1161217270 19:3100769-3100791 GGGGAAACTGAGGCCGGGAGAGG - Intronic
1161248772 19:3269592-3269614 GGGGAAACTGAGGCCCCTTGGGG - Intronic
1161255840 19:3309049-3309071 AGGGAAACTGAGGCATGGAGTGG + Intergenic
1161271639 19:3392849-3392871 GGGGAAACTGAGGCCCGGAGAGG + Intronic
1161272366 19:3397194-3397216 GGGGAAACTGAGGCCTAGAGAGG + Intronic
1161325640 19:3662473-3662495 AGGGAAACTGAGGCACATAGCGG - Intronic
1161339968 19:3736059-3736081 GGGGAAACTGAGGCCTGGAGGGG + Intronic
1161346864 19:3772449-3772471 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1161398283 19:4056268-4056290 AGGGAAACTGAGGCTGATGGGGG - Intronic
1161442907 19:4302530-4302552 GGGGAAACTGAGGCACGAGGTGG - Intergenic
1161450547 19:4343364-4343386 CGGGAAACTGAGGCGTGACGGGG - Intergenic
1161543960 19:4868563-4868585 AAGGAAACTGAGGCCTGGAGAGG + Intergenic
1161604703 19:5208177-5208199 GGGGAAACTGAGGCCTGGTGGGG - Intronic
1161620538 19:5294692-5294714 AGGGAAACTGAGGCATGGTAAGG - Intronic
1161627305 19:5334795-5334817 AGGGAAACTGAGGCACAGGGAGG - Intronic
1161662504 19:5555628-5555650 AGGGAAACTGAGGCCCAGCGAGG + Intergenic
1161665326 19:5572645-5572667 AGGGAAACTGAGGCCCGGAGAGG + Intergenic
1161681106 19:5680296-5680318 AGGGAAACTGAGGCTTCAGAGGG - Intronic
1161681356 19:5681250-5681272 GGGGAAACTGAGGCCTGAGCGGG + Exonic
1161702564 19:5803577-5803599 GGGGAAACTGAGGCACGGGGGGG + Intergenic
1161957180 19:7502739-7502761 GGGGAAACTGAGGCTTGGAGAGG - Intronic
1162016860 19:7850884-7850906 GGGGAAACTGAGGCCGGAGAAGG - Intronic
1162021614 19:7870704-7870726 AGGGCAGGTGGGGCCTGTGGAGG + Exonic
1162095162 19:8305931-8305953 AGGGAAACTGAGGCAGTGGGTGG + Intronic
1162297442 19:9823009-9823031 AGGGAAAATGAGGCCGGGTGTGG + Intronic
1162308303 19:9889136-9889158 GAGGAAACTGAGGCCTGGAGAGG + Intronic
1162424598 19:10586991-10587013 AGAGAAACTGAGGCCCTAGGAGG + Intronic
1162446791 19:10728300-10728322 AGAGAAACTGAGGCCAGAGAGGG + Intronic
1162522561 19:11190480-11190502 GGGGAAACTGAGGCTTAGGGAGG - Intronic
1162531526 19:11238810-11238832 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1162957688 19:14108249-14108271 AGGAAAACTGAGGCCTAGAGAGG - Intronic
1163057480 19:14731425-14731447 AAGGAGACTAAGGCCTGTGTGGG + Intronic
1163115025 19:15184147-15184169 ATGGAAACTGAGGCCCGAGGAGG - Intronic
1163425195 19:17236916-17236938 AGGGAAACTGAGGCATGAAGAGG + Intronic
1163429002 19:17255657-17255679 AGGGAAACTGAGGCCCCAAGAGG + Intronic
1163474305 19:17516052-17516074 GGGGAGACTGAGGCATGGGGAGG - Intronic
1163479246 19:17544925-17544947 AAGGAAACTGAGGCCAGGCGTGG + Intronic
1163500375 19:17672658-17672680 GGGGAAACTGAGGCCAGTGGGGG + Intronic
1163557320 19:18000127-18000149 GGGGAAACTAAGGCCTGAGAAGG + Intergenic
1163573614 19:18097927-18097949 AGGGAAACTGAGGCAGAGGGTGG + Intronic
1163596708 19:18224987-18225009 AGGGAAACTGAGGCCAGGAGCGG + Intronic
1163612694 19:18309425-18309447 GGGGAAACTGAGGCTTGGGGAGG + Intronic
1163664220 19:18595421-18595443 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1163752141 19:19084234-19084256 AGGGGAGGTGGGGCCTGTGGTGG - Intronic
1163821765 19:19500084-19500106 AGGGAGACTGAGCCCTGATGAGG - Intronic
1164051033 19:21586205-21586227 AGGGAAACTGAGGCCCAAAGAGG - Intergenic
1164675277 19:30096505-30096527 AGGGAAACTGAGGTCCAGGGAGG + Intergenic
1165091512 19:33390651-33390673 AGGGTAAGTGAGGCTTGGGGAGG - Intronic
1165154802 19:33780534-33780556 AGGCAAACTGTGGCCAGGGGTGG + Intergenic
1165247369 19:34505174-34505196 AGGGGCCCTGAGGCCTGAGGTGG + Exonic
1165317218 19:35063853-35063875 AGGGAAACTGAGGCACGGTGAGG - Intronic
1165324716 19:35107784-35107806 GGGGAAACTGAGGCCCGGGAAGG + Intergenic
1165396046 19:35563990-35564012 GGGGAAACTGAGGCATGGAGGGG + Intergenic
1165424279 19:35737341-35737363 TTGGAAACTGAGGCCTGGGGAGG + Intronic
1165454268 19:35901675-35901697 TGGGAGACTGAGGCAAGTGGAGG - Intronic
1165655421 19:37528371-37528393 CTGGAAACTGAGGTCAGTGGTGG - Intronic
1165716359 19:38048340-38048362 AGGCATACAGAGGCCTTTGGAGG - Intronic
1165724842 19:38105458-38105480 TGGGAAACTGAGGCATGGAGAGG - Intronic
1165750500 19:38256470-38256492 GGGGAAACTGAGGCCTGAGGCGG - Exonic
1165946473 19:39445813-39445835 GGGGAAACTGAGGCTCGGGGTGG + Exonic
1165949580 19:39466577-39466599 GGGGAATCTGTGGCCTGGGGGGG + Intronic
1166042325 19:40211538-40211560 ACGGACACTGGGGCCTGTTGGGG - Intronic
1166048094 19:40241650-40241672 AGGGAGGCTGGGGCCTGTTGGGG - Intronic
1166227885 19:41408309-41408331 GAGGAAACCGAGGCCTGGGGAGG - Intronic
1166354633 19:42219637-42219659 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1166371168 19:42302118-42302140 TGGGAAACTGAGGGCAGTTGAGG - Intronic
1166502089 19:43349212-43349234 AGGAAAACTGAGCCCTGGGAAGG - Intergenic
1166508023 19:43384240-43384262 AGGAAAACTGAGCCCTGGGAAGG + Intergenic
1166670083 19:44704348-44704370 GGGGAAACTGAGGCCAGGAGAGG + Intronic
1166676253 19:44742810-44742832 GGGGAAACTGAGGCATGGAGAGG - Intergenic
1166722322 19:45003661-45003683 AGGAAAACTGAGGCCTGAACTGG - Intronic
1166730347 19:45055848-45055870 AGAAAAACTGAGGCCTAGGGAGG + Intronic
1166786302 19:45369343-45369365 AGGGATACTGAGGTCTGGGGAGG - Intronic
1166795458 19:45423112-45423134 GGGGAAACTGGGACCTGGGGAGG + Intronic
1167040654 19:47020931-47020953 AGGGAAACTGAGATCCGTGCAGG - Intronic
1167113023 19:47472979-47473001 AGGGAAACCAAGGCATGAGGTGG + Intergenic
1167444496 19:49529284-49529306 CAGGAAACTGAGGCTTGGGGAGG - Intronic
1167467165 19:49656422-49656444 AGGTAAACTGAGTCCTGGGAAGG - Intronic
1167503588 19:49860364-49860386 AGGGACCCTGGGGCATGTGGGGG + Exonic
1167505890 19:49870920-49870942 AAGGACACTGAGGCTTGAGGGGG + Intronic
1167508601 19:49884011-49884033 GGGGAAACTGAGGCCCAGGGAGG - Intronic
1167585726 19:50374332-50374354 AAGGAAACTGAGGCACGGGGAGG + Intronic
1168327198 19:55544511-55544533 GGGGAAACTGAGGCCCGGAGAGG - Intronic
1168435778 19:56315663-56315685 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1168669578 19:58230406-58230428 GAGGAAACTGAGGCCTGGAGAGG + Intronic
925041703 2:736031-736053 AGGGGAAGTGAGGCCCCTGGAGG - Intergenic
925409570 2:3632134-3632156 AGGGAAACTGAGGCTTACAGAGG + Intronic
925755626 2:7128972-7128994 AAGGAAAATGAGGCCTGAGCTGG + Intergenic
925802736 2:7617591-7617613 GTGGCAACTGAGGCCTGAGGAGG - Intergenic
925872949 2:8286388-8286410 TGGGAAGGAGAGGCCTGTGGAGG - Intergenic
925893101 2:8451949-8451971 GGGGAAACTGAGGCCCGGAGAGG + Intergenic
926092167 2:10058171-10058193 AGGGAAACTGAGGCCCAGAGAGG + Exonic
926123975 2:10260156-10260178 CGGTAAACTGAGGCAGGTGGAGG - Intergenic
926416014 2:12650489-12650511 GGGGAAACTGAGGCTGGAGGAGG + Intergenic
926689772 2:15725273-15725295 GGGGACACTGAGGCCTGGAGAGG + Intronic
926859994 2:17299647-17299669 TGGGAAACTGAGGTCAGAGGAGG - Intergenic
927240467 2:20916079-20916101 AGGGGAAGTGAGGGCTGGGGAGG + Intergenic
927460857 2:23297001-23297023 AAGGAAGCTGAGGCCTGGGTAGG + Intergenic
927469459 2:23361955-23361977 GAGGAAACTGAGGCATGTGTAGG + Intergenic
927507190 2:23622230-23622252 AGGGAATGTGATGCCTTTGGGGG - Intronic
927855062 2:26522782-26522804 AGGGAAACTGAGGCCCAGAGAGG - Intronic
927872737 2:26633884-26633906 AGGGAAACTGAGGCCCGAGAGGG - Intronic
927887415 2:26727199-26727221 AAGGAAACTGAGGCATGGAGAGG + Intronic
927890212 2:26743429-26743451 AGGGAAACTGAGGCCTGATAAGG + Intergenic
928025056 2:27732757-27732779 TAGGAAACTGAGGCCTAGGGCGG + Intergenic
928263589 2:29789883-29789905 CAGGAAACTGAGGCCTGGAGGGG - Intronic
928350338 2:30547017-30547039 AGTGTTACTGAGTCCTGTGGGGG - Intronic
928544116 2:32313100-32313122 TGAGAAAAAGAGGCCTGTGGTGG + Exonic
929089201 2:38197979-38198001 AGGAAAACTGAGGCCTAGAGAGG + Intergenic
932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG + Intronic
932397382 2:71457311-71457333 AAGGAAACTGAGGCATGAAGAGG + Intronic
932734227 2:74243134-74243156 AGGGACACTGAGGCCAGGGTAGG - Intronic
932760307 2:74435278-74435300 GGGGAAACTGAGGCTTAGGGAGG - Intronic
933053782 2:77634954-77634976 TGGGAAGCTGAGGCAGGTGGAGG - Intergenic
933700522 2:85252202-85252224 AGGGAAACTGAGGCTATGGGTGG + Intronic
933777465 2:85779645-85779667 GAGGAAACTGAGGTCTGTAGGGG + Intronic
934768109 2:96891929-96891951 GGGGAAACTGAGGCCAGAGTAGG - Intronic
935155360 2:100479585-100479607 GAGGAAACTGAGGCCCGGGGAGG - Intronic
935351867 2:102157980-102158002 TGGGAAACTGAGGCCTAGTGAGG + Intronic
935666845 2:105519580-105519602 AGGGAACCTGCGGTCTGTGAAGG - Intergenic
935921077 2:108015888-108015910 TGGGAAACTGAGGCCTACAGAGG - Intergenic
936029629 2:109060726-109060748 TGGGAAACTGAGGCCCAGGGTGG - Intergenic
936385520 2:112025132-112025154 AGGGCAGCTGAGGCCTGGAGAGG - Intronic
936510039 2:113137855-113137877 ATGAAAACTGAGGCCTAGGGAGG - Intergenic
937080733 2:119137809-119137831 AGGAAGACTGAGGCCTGCGTGGG - Intergenic
937102287 2:119281024-119281046 GGGGAAACTGAGGCAAGAGGAGG - Intergenic
937316603 2:120935624-120935646 GGGGAAACCGAGGCATGGGGAGG + Intronic
937478037 2:122232340-122232362 GAGGAAACTGAGGCTTGGGGAGG + Intergenic
938118815 2:128619873-128619895 GGGGGAACTGAGGCCTGGGGCGG + Intergenic
938172110 2:129088473-129088495 AGGGAAAGTGGGGCCTGTGGAGG - Intergenic
938242419 2:129753588-129753610 AAGGAAACTGAGGCATGGGGAGG - Intergenic
938577486 2:132618587-132618609 AGGGAAACCGAGGCCACTGCTGG + Intronic
938594649 2:132775721-132775743 ATGGAAACTGAGGTGTTTGGGGG - Intronic
940760376 2:157732396-157732418 AGAGAAGCTGAGGTTTGTGGAGG - Intergenic
940909335 2:159196402-159196424 AGGGAACCTGAGGCCTGGAATGG + Intronic
941591840 2:167429729-167429751 AGGGAAACTGAGGCCCTTGGGGG - Intergenic
942321226 2:174737733-174737755 AGAGAAACTTAGACCTGTGAAGG + Intergenic
943931032 2:193853704-193853726 TGGGAATCTGAGGCCTGTGGTGG + Intergenic
944078720 2:195760339-195760361 AGGGAAACTGACTGCTGTGAAGG + Intronic
944299485 2:198106840-198106862 GAGGAAATTGAGGCTTGTGGGGG + Intronic
944539975 2:200745570-200745592 AGGGAAACCAAGGCCTGGGGAGG - Intergenic
946002410 2:216493516-216493538 AGGGTGCATGAGGCCTGTGGTGG + Intergenic
946025956 2:216671834-216671856 AAGGAAATGGAGGCCTGAGGAGG + Intergenic
946042123 2:216791630-216791652 AGGGAAACTGAGGCCTAGAAAGG + Intergenic
946190689 2:218006288-218006310 AAGGAAACTGAGGCCCAGGGAGG - Intergenic
946206753 2:218114664-218114686 AGAGAAACTGGGGCCTTTAGAGG + Intergenic
946660260 2:221992064-221992086 AGGGCAGCTCAGGGCTGTGGTGG + Intergenic
946867089 2:224051523-224051545 AAGGAAACTAAGGCCTGGGGAGG - Intergenic
947980378 2:234403632-234403654 AGGGAAACTGAGGCATGGAAGGG - Intergenic
948348155 2:237316641-237316663 CGGGAACCTGAGGGCTGTGGTGG - Intergenic
948859580 2:240746343-240746365 GGGAAAACTGAGACCTGGGGAGG - Intronic
949039728 2:241842658-241842680 GGGGAAACTGAGGCCCAGGGAGG - Intergenic
1168831720 20:848661-848683 GGGTAAACTGAGGTCTGTGGGGG - Intronic
1168837095 20:884702-884724 AGGAAAACTGAGGCCCAGGGAGG + Intronic
1168877243 20:1180292-1180314 AGGGCAACTGAGGCCTGGTGAGG + Intronic
1168959229 20:1857401-1857423 GGGGAAACTGAGGCCTAGAGAGG + Intergenic
1168960348 20:1864789-1864811 GAGGAAACTGAGGCCAGGGGAGG - Intergenic
1168970195 20:1925676-1925698 GGGGAAACTGAGGCTTGTAGAGG - Intronic
1169120853 20:3094840-3094862 AGGGACACTCAGACATGTGGAGG - Intergenic
1169400881 20:5279248-5279270 AGGGAAAGTGTGGCTAGTGGGGG - Intergenic
1169802416 20:9523718-9523740 AGGGATCCTAAGTCCTGTGGAGG + Intronic
1170136374 20:13078761-13078783 AGGGCAAGTGAGACTTGTGGAGG + Intronic
1170757671 20:19218894-19218916 GGGGAAACTGAGGTATGGGGTGG + Intronic
1171125910 20:22601859-22601881 GAGGAAACTGAGGCCTAGGGAGG - Intergenic
1171311094 20:24145115-24145137 GGGTAAACTGAGGCCTGGGTTGG + Intergenic
1171390221 20:24796575-24796597 AGGGAAGCTGAGGGCAGTGGGGG + Intergenic
1171520810 20:25772857-25772879 ATGGACACCCAGGCCTGTGGTGG - Intronic
1171556112 20:26083634-26083656 ATGGACACCCAGGCCTGTGGTGG + Intergenic
1172053019 20:32133731-32133753 GGGGAAACCGAGGCCTGGGAAGG + Intronic
1172057596 20:32165186-32165208 GGGGAAACTGAGGCCTGGCCAGG - Intronic
1172094049 20:32452128-32452150 AGGGAAGCAGAGGCCAGTGATGG - Intronic
1172110622 20:32542701-32542723 GGGGAAACTGAGGCATGGAGAGG - Intronic
1172121760 20:32602914-32602936 AAGGAAACTGAGGCTCATGGAGG + Intronic
1172200823 20:33124911-33124933 AGGGAAACTAAGGCTTGGAGAGG + Intergenic
1172248912 20:33465279-33465301 GGGGAAACTGAGGCCTAGAGTGG - Intergenic
1172468482 20:35174472-35174494 GAGGAAACTGAGGCCTGCAGTGG - Intronic
1172497426 20:35398031-35398053 AAGGAAACTGAGGCATGGAGAGG + Intronic
1172589818 20:36109735-36109757 GAGGAAGCTGAGGCCTGTGAAGG + Intronic
1172624852 20:36341068-36341090 AGGGAAACTGAGGCCAGAGAGGG + Intronic
1172625192 20:36342716-36342738 GGGGAAACTGAGGCCCATGGAGG + Intronic
1172634433 20:36400650-36400672 GGGGAAACTGAGGCTGGGGGTGG + Intronic
1172657479 20:36545995-36546017 GGGGAAACTGAGGCCTAGAGGGG + Intronic
1172735457 20:37123786-37123808 AGGGCATCTGTTGCCTGTGGTGG + Exonic
1172773182 20:37393206-37393228 GGGGAAACTGAGGCCAGAGGGGG - Intronic
1172801874 20:37581563-37581585 GGGGAAACTGAGGCCTACAGAGG - Intergenic
1172859259 20:38034252-38034274 AAGGAAACTGAGGCCCGGGAAGG + Intronic
1173162436 20:40662811-40662833 AGAGATACCGAGGCCTCTGGAGG - Intergenic
1173826753 20:46052732-46052754 GGGGAAACTGAGGCCTAGAGAGG + Intronic
1173874893 20:46364222-46364244 GGCGAAACTGAGGCCCGGGGAGG + Intronic
1173885866 20:46458200-46458222 TGGGAACCTGAGAACTGTGGAGG + Intergenic
1173903129 20:46605602-46605624 GGGGAAACTGAGGCCTAGAGAGG + Intronic
1173952796 20:47006467-47006489 GAGGAAACTGAGGCCTGGAGAGG - Intronic
1174076416 20:47940639-47940661 AGGAAAACTGAGGCCTGGAATGG + Intergenic
1174221361 20:48958284-48958306 AAGGAAACTGAGGCTTGGGGAGG + Intronic
1174328850 20:49801754-49801776 AGGGAAACTGAGGCACAAGGGGG + Intergenic
1174365407 20:50053475-50053497 AGGGAAACTGAGGCCCGGAAGGG + Intergenic
1174385534 20:50186697-50186719 GGGGAAACTGAGGCCCGAAGAGG - Intergenic
1174715853 20:52758067-52758089 GGGGAAACTGAGGCTTGTTGAGG - Intergenic
1174772135 20:53310280-53310302 AGGGAAACTGAGGCCCACAGAGG - Intronic
1174799108 20:53548159-53548181 TAGGAAACTGAGGCCTGAGGGGG - Intergenic
1175095676 20:56539691-56539713 AGAGAAATTGAGGCCTGGCGTGG + Intergenic
1175240500 20:57544588-57544610 AAGGAAACTGAGGCCCTAGGAGG - Intergenic
1175430866 20:58902126-58902148 AGGGAAACTGAGGCCAAGAGGGG - Intronic
1175685639 20:61026208-61026230 ATGCACACTGAGGCCTGTTGTGG - Intergenic
1175813211 20:61869934-61869956 AGGTTATCTGAGTCCTGTGGAGG + Intronic
1175930435 20:62491390-62491412 GGGGAAACTGAGTCCTGAGGTGG + Intergenic
1175934021 20:62506853-62506875 GGGGAAACTGAGGCCTGGGGAGG - Intergenic
1175935985 20:62514243-62514265 GGGGAAGCTGAGGCCAGGGGAGG + Intergenic
1175989248 20:62779312-62779334 AGGGAAGGTGGGGGCTGTGGGGG - Intergenic
1175993030 20:62798860-62798882 ACGGAAGCTGAGGCCTGTGTGGG + Intronic
1176092030 20:63322395-63322417 GGGGAATCTGAGGCTTGGGGAGG + Intronic
1176195380 20:63834489-63834511 AGGGACCCTGAGGCCTATGAGGG + Intergenic
1176652779 21:9565644-9565666 AAGGAAACTGAGGCCTAGAGAGG - Intergenic
1176654672 21:9577962-9577984 ATGGACACCCAGGCCTGTGGTGG - Intergenic
1178582528 21:33848566-33848588 AGGGAAACTGAGGCACAGGGCGG - Intronic
1178665267 21:34541062-34541084 ACAGAAACTGAGGCTTTTGGAGG - Intronic
1179257431 21:39728902-39728924 AGGGAAACTGAGTCTGATGGAGG + Intergenic
1179510627 21:41870913-41870935 AAGGAAACTGAGGCCCTTGGAGG - Intronic
1180012620 21:45060928-45060950 AGTGAAACTGAGGATGGTGGAGG - Intergenic
1180244510 21:46538027-46538049 AGGGAAACTGAAGCTTGGGTAGG + Intronic
1180842393 22:18965410-18965432 GGGGAAACTGAGCCCCGGGGAGG - Intergenic
1180876913 22:19178855-19178877 CGGGAAACTGAGGCCTGGGCGGG + Intergenic
1181000016 22:19983636-19983658 GGGGAAACTGAGGCCTGGCAGGG + Intronic
1181493080 22:23272956-23272978 AGGGGAGATGGGGCCTGTGGAGG + Intronic
1181763802 22:25076919-25076941 AGGGAAACTGAGGCCTTGAAAGG + Intronic
1181770137 22:25119228-25119250 GGGTAAACTGAGGCCTGGAGAGG + Intronic
1181782736 22:25204916-25204938 AGAGAAACTGAGGCCAGGAGAGG - Intronic
1181789336 22:25251704-25251726 AATGAAACTGAGGCCTGGTGCGG - Intergenic
1181790935 22:25265813-25265835 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1181811451 22:25405689-25405711 GGGGAAACTGAGGCACGGGGCGG + Intergenic
1181826742 22:25522852-25522874 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1181910868 22:26237131-26237153 AGGGAAACTGAGGCTCAGGGAGG - Intronic
1181988945 22:26822024-26822046 AGGAACACTGAGGCTTGGGGAGG + Intergenic
1182066527 22:27435254-27435276 AGGGAGACTGAGGCCGGGGTAGG + Intergenic
1182280182 22:29213959-29213981 GGGGAAACTGAGGCTTGGGGAGG - Intronic
1182285742 22:29245806-29245828 AGGGAAACTGAGGCCCGACTCGG + Intronic
1182310098 22:29398240-29398262 TGGGAAACTGAGGCCTGAACTGG - Intronic
1182352971 22:29709225-29709247 GGGGAAACTGAGGCTTGGAGAGG + Intergenic
1182418615 22:30237676-30237698 AAGGAAACTGAGGCCCAGGGAGG - Intergenic
1182428669 22:30288019-30288041 AGGGAAACTAAGGCCTGCAGTGG + Intronic
1182429378 22:30291021-30291043 GGGGATACTGAGGCCTAGGGAGG - Intronic
1182534811 22:30992969-30992991 AAGGAAACTGAGGCCAGAGAGGG + Intergenic
1182902028 22:33906475-33906497 AAGGAAACTGAGGCTTGGAGAGG - Intronic
1183098191 22:35567136-35567158 GGGGAAACTGAGGCTTCAGGAGG - Intergenic
1183173328 22:36204071-36204093 GGGGAAACTGAGGCCCTGGGAGG - Intronic
1183178069 22:36238881-36238903 GGGGAAACTGAGGCCCTGGGAGG - Intronic
1183290796 22:37000571-37000593 AGGGAAACTGAGGCCTAGAGTGG - Intronic
1183307257 22:37089360-37089382 GGGGAAACTGAGGCTCGCGGAGG + Intronic
1183314990 22:37132126-37132148 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1183327092 22:37200130-37200152 GGAGAAACTGAGGCCTACGGTGG - Intergenic
1183333915 22:37235996-37236018 GAGGAAACTGAGGCCTGAAGAGG + Intronic
1183349231 22:37325341-37325363 GGGGAAACTGAGGCCTAGAGAGG + Intergenic
1183377642 22:37474355-37474377 GGGGAAACTGAGGCCTAGGGTGG - Intronic
1183386367 22:37517845-37517867 AGGGAAACTGAGGCATGGAGAGG - Intronic
1183427467 22:37747185-37747207 AGATAAACTGAGGCTTGGGGAGG + Intronic
1183483354 22:38076625-38076647 AGGGAAATTGAGGCCCAGGGAGG - Intergenic
1183545199 22:38451734-38451756 GTGGAAACTGAGGCCTGAGGGGG - Intronic
1183545219 22:38451830-38451852 GTGGAAACTGAGGCCTGAGGGGG - Intronic
1183552488 22:38498782-38498804 TGGGAGGCTGAGGCCAGTGGAGG + Intronic
1183598012 22:38823720-38823742 AAGGAAACTGAGGCCCAGGGAGG - Intronic
1183650749 22:39152216-39152238 AGGGAAACTGAGGCACGGGCTGG + Intronic
1183706504 22:39477921-39477943 GGGGAAACTGAGGCACGGGGAGG + Intronic
1183745251 22:39688135-39688157 CGGGAAACTGAGCCCTGGAGAGG + Exonic
1183933210 22:41247899-41247921 GGGCAGACTGAGGCCTGTGCTGG + Intronic
1184058854 22:42069971-42069993 AAGGAAACTGAGGCCCGAGGGGG - Intronic
1184059615 22:42074133-42074155 CGGGAAACTGAGGCCCGAGAGGG - Intergenic
1184066709 22:42125604-42125626 AGGGAAACAGAAGCCCGGGGTGG + Intergenic
1184069177 22:42137756-42137778 AGGGAAACAGAAGCCCGGGGTGG + Intergenic
1184090572 22:42290977-42290999 AAGGAAACTGAGGCATGGAGAGG + Intronic
1184139935 22:42572723-42572745 AAGGAAACAGAGACCTTTGGTGG + Intronic
1184171332 22:42761498-42761520 AGGGAAGCTGAGGAGTGGGGAGG + Intergenic
1184224454 22:43121231-43121253 GGGGAAACTGAGGCTGGTGCAGG + Intronic
1184241905 22:43215537-43215559 AGTGAAAGTGAAGCCAGTGGCGG + Intronic
1184259739 22:43307826-43307848 AGGGAAACTGAGGCATAAAGAGG + Intronic
1184279718 22:43430051-43430073 GGGGAAACTGAGGCCTGGGGAGG - Intronic
1184284915 22:43465102-43465124 GGGGAAACTGAGGCACGAGGAGG + Intronic
1184392626 22:44213248-44213270 AAGGAAACTGAGGCTTAGGGAGG - Intronic
1184493527 22:44824203-44824225 TGGGAAACTGAGGCTTGTCAAGG - Intronic
1184494477 22:44829900-44829922 TGGAAACCTGAGGCCTGTGTGGG + Intronic
1184512146 22:44940059-44940081 GGGGAAACTGAGGCCCAGGGTGG - Intronic
1184521708 22:44998473-44998495 AGGGAAACTGAGGCCCCGGTCGG - Intronic
1184580283 22:45412713-45412735 GGGGAAACTGAGGTCTGGAGAGG - Intronic
1184654181 22:45932876-45932898 TGGGCAACTGAGGGCTGTGCAGG - Intronic
1184692197 22:46122509-46122531 GGGGAAACTGAGGCCAGGGAGGG - Intergenic
1184715432 22:46279276-46279298 GTGGAAACTGAGGCCCATGGAGG + Intronic
1185025252 22:48405202-48405224 AGGGAAGTTGAGGCCTGAGAGGG - Intergenic
1185054876 22:48574458-48574480 GGGGAAACTGAGGCTTATAGAGG - Intronic
1185105481 22:48867187-48867209 GGGGAAACTGAGGCCTGCAACGG + Intergenic
1185165846 22:49261708-49261730 GGGGAAGCTGAAGCCCGTGGGGG - Intergenic
949805762 3:7953717-7953739 AGAGAAACTGAGGCCTAAGATGG - Intergenic
949871072 3:8589643-8589665 AGGGAAACTGAGGCTGGGGAAGG - Intergenic
950017124 3:9762108-9762130 GAGGAAACTGATGCCTTTGGAGG + Intronic
950077765 3:10199378-10199400 GAGGAAACTGAGGCCTGAGCAGG - Intronic
950101464 3:10359421-10359443 GGGGAAACTGAGGCCAGAGAGGG + Intronic
950120392 3:10478594-10478616 AGAGAAGATGAGGCCTTTGGTGG - Intronic
950131116 3:10547287-10547309 AGGGAAACTGAGACCTAAAGAGG - Intronic
950181130 3:10914206-10914228 AGGGAAAGTGAAGCTGGTGGAGG + Intronic
950184906 3:10939001-10939023 GGGGAAACTGAGGCCCAGGGAGG - Exonic
950272035 3:11624577-11624599 GGGGAAACTGAGGCATGGGAGGG - Intronic
950348661 3:12324536-12324558 GGGAAAACTGAGGCCTGAAGAGG - Intronic
950404811 3:12797601-12797623 GGGGAAACTGAGGCCCAGGGAGG + Intronic
950438536 3:12994301-12994323 GGGGAAACTGAGGCCAGGCGCGG - Intronic
950500421 3:13360115-13360137 AGGCAAACTGAGGCGTGGTGAGG - Intronic
950550925 3:13665521-13665543 AGGGAAACTGAGGCTCAAGGAGG + Intergenic
950568477 3:13785873-13785895 AGGGAAGCTGAGGCCCAGGGAGG + Intergenic
950716477 3:14851057-14851079 GGGGAAACTAAGGCCCTTGGAGG + Intronic
950809052 3:15633675-15633697 ATGGAAACTGAGGCCAGGAGAGG - Intronic
950816952 3:15714771-15714793 AGTTTAACTGAGGCCTATGGAGG + Intronic
951531194 3:23699644-23699666 GAGGAAACTGAGGCATGTGGAGG - Intergenic
952152821 3:30610852-30610874 TGGGAAAATGTGGGCTGTGGTGG - Intronic
952347169 3:32498866-32498888 AGTGAAACTGAGGCCGGGTGCGG - Intronic
952872806 3:37916878-37916900 AGAGAAACTGAGGCCTAGAGAGG + Intronic
952887398 3:38020070-38020092 GGGGAAACTGAGGCCTGGCCTGG - Intronic
953387036 3:42512606-42512628 AGAGAAACTGAGGCCCAGGGAGG + Intronic
954012331 3:47652593-47652615 AAGGAAACTGAGGCATGGAGAGG - Intronic
954035100 3:47847098-47847120 AAGGAAACCGAGGACTGGGGAGG - Intronic
954326792 3:49868431-49868453 GGGGAAACTGAGGCATGGGGAGG - Intronic
954386930 3:50249051-50249073 AGGGAAACTGATGCCTCAAGTGG + Intronic
954433476 3:50483702-50483724 AGGGAAACTGAGACCCGCAGAGG - Intronic
954435250 3:50492509-50492531 GGGGAAACCGAGGCCTGGAGAGG - Intronic
954452022 3:50576871-50576893 GGGGAAGCTGAGGCCTGGAGGGG + Intronic
954745484 3:52785312-52785334 GGGGAAAGAGAGGCCTCTGGGGG - Intronic
955410074 3:58649826-58649848 AAGGAAACTGAGGCCCAGGGAGG - Intronic
955436551 3:58906054-58906076 AGGAAAACTGAGGCATGGAGAGG - Intronic
955438458 3:58930245-58930267 AGGGTTAGTGAGGACTGTGGGGG - Intronic
955604356 3:60684539-60684561 AGGGAATCTGAGGTGTGAGGAGG - Intronic
955795959 3:62637207-62637229 AGGGAAACTGAGGCTTAATGGGG + Intronic
955968557 3:64413737-64413759 AGTGACACTGAGGCCTGGAGAGG + Intronic
956027598 3:65000177-65000199 AAGGAAACTGAGGCCTTTAGAGG + Intergenic
956162233 3:66367380-66367402 GAGGAAACTGAGGCTTATGGAGG - Intronic
957720027 3:83982991-83983013 AGGGAAACTGAAGCCTTTCTAGG + Intergenic
958157011 3:89768283-89768305 ACACACACTGAGGCCTGTGGTGG - Intergenic
958824972 3:99019185-99019207 AGTGAAACTGAGGCCTAAAGAGG - Intergenic
959114578 3:102161663-102161685 AAGGACATTGAGGCCTGGGGAGG - Intronic
959156174 3:102668515-102668537 AGGGAGACTGAGGCATGGGGAGG - Intergenic
960160224 3:114342562-114342584 AAGGAAACTGAGGCTTATAGAGG - Intronic
960743267 3:120857921-120857943 AAGAAAACTGAGGCTTGGGGAGG - Intergenic
960829813 3:121834788-121834810 GTGGAAACTGAGGCCTGGGGAGG - Intronic
961014287 3:123455504-123455526 AGGGTAACTGAGGCACGAGGGGG - Intergenic
961133675 3:124491254-124491276 GGGGAAACTTAGGGCTGGGGTGG - Intronic
961364183 3:126389139-126389161 AGGGACACTGGGGCCTGTGGAGG + Intergenic
961514520 3:127424420-127424442 AGGGAATCAGTGGCCGGTGGGGG - Intergenic
961581070 3:127882733-127882755 GAGGAAACAGAGGCCTGTGGTGG - Intergenic
961604342 3:128082679-128082701 AGAGAAACTGAGACCTGGGTTGG + Intronic
961654715 3:128434990-128435012 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
961771024 3:129249978-129250000 GGGTAAATTGAGGCCTGGGGGGG - Intronic
961830299 3:129619778-129619800 GGGGAAATTGAGGCCTGGCGGGG - Intergenic
962101580 3:132348394-132348416 GGGGAAACTGAGGCTTGGAGAGG - Intronic
962441482 3:135422427-135422449 AGGCACACTGAGGCCTGTTATGG - Intergenic
962658147 3:137570584-137570606 AGTCAAACTGAGGCCTGAGGTGG - Intergenic
962706190 3:138046986-138047008 GAGGAAACTGAGGCTTGGGGAGG + Intergenic
963270954 3:143285418-143285440 CTGGAAACTGAGGCATGGGGAGG + Intronic
963302692 3:143616692-143616714 AGGGAAAGTGAGGTCTGTGCTGG - Intronic
963839278 3:150088694-150088716 AGGGAAAATGAGGGATGTGTGGG - Intergenic
964663930 3:159151569-159151591 AAGGAAACTGAGACCAGTGCAGG - Intronic
964668500 3:159199950-159199972 AGGAAAACTGAGGCATGGGGAGG - Intronic
964722628 3:159782285-159782307 AGGGAAACTGAAGCTTATGGTGG + Intronic
965395963 3:168160725-168160747 AGAGACACTGAGACATGTGGAGG - Intergenic
965661732 3:171049333-171049355 GAGGAAACTCAGGCCTGTGATGG + Intergenic
966736232 3:183189329-183189351 AGGGGCACACAGGCCTGTGGGGG - Intronic
966913512 3:184572295-184572317 GGGGAAACTGAGGCACATGGCGG + Intronic
967370994 3:188745879-188745901 GAGGGAACTGAGGCCCGTGGTGG + Intronic
967877436 3:194276834-194276856 TGGGAAACTGAGGCCTGGCAAGG - Intergenic
967931865 3:194695752-194695774 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
968026129 3:195443542-195443564 AGAGAAACTGAGGCCAGAAGAGG + Intergenic
968609596 4:1551032-1551054 AGGGAAACTGAGGCTGGGGTAGG + Intergenic
968815111 4:2818067-2818089 GGGGAAACTGAGGCCCGCAGGGG + Intronic
968819139 4:2836831-2836853 AGGGAAACTGAGGCTTTGGGAGG + Exonic
968975049 4:3817681-3817703 AGGGAAACTGAGGCCTAGAGAGG + Intergenic
969059399 4:4423177-4423199 TGGGAAACTGTAGCTTGTGGGGG + Intronic
969096689 4:4737961-4737983 GGGGAGACTGAGGCCTGGAGAGG - Intergenic
969184491 4:5465308-5465330 ATGGAAACTGAGGCCCATAGAGG + Intronic
969227740 4:5810161-5810183 GAGGAAACTGAGGCCTGGGAAGG - Intronic
969281930 4:6176623-6176645 GGGGAAACTGAGGCTTGCAGTGG + Intronic
969295783 4:6270095-6270117 GGGGAAACTGAGGCCCGAAGAGG - Intronic
969481937 4:7451364-7451386 TGGGAAACTGAGGCCAAGGGAGG - Intronic
969533343 4:7741287-7741309 GGGGAAACTGAGGCCCAGGGAGG + Exonic
969626768 4:8309560-8309582 ACAGAAACTGAGGCCTGGAGAGG + Intergenic
969662985 4:8541133-8541155 AGGGAAGCTGAGGCACGGGGTGG + Intergenic
969671460 4:8592551-8592573 GGGGAAACTGAGGCCCAAGGAGG + Intronic
969709940 4:8836985-8837007 AGGGAAACAGAGGCTTGGGGAGG - Intergenic
969717256 4:8873705-8873727 AAGGAAACTGAGGCCAGAGAGGG + Intergenic
969817432 4:9696921-9696943 AGGGAAACTGAGGCCAAAGAAGG - Intergenic
970075901 4:12219777-12219799 GAGGAAACTGAGGCCTATAGAGG - Intergenic
970435630 4:16032031-16032053 AAGGAAATTGAGGGTTGTGGAGG - Intronic
970582986 4:17490373-17490395 GGGGAAACTGAGGCCTCAGCAGG + Intronic
971176079 4:24283955-24283977 GGGGAAACTGAGGATTGGGGAGG + Intergenic
971777908 4:30992061-30992083 AAGGAAACTGAGGCCTCAGAAGG - Intronic
973642590 4:52917971-52917993 AGGGAAGGTGGGGCCAGTGGGGG + Intronic
973978441 4:56285829-56285851 AAGGAAACTGAGGCACCTGGAGG + Intronic
975525351 4:75342890-75342912 AGGGAATTTTAGGCCTGTGGGGG - Intergenic
975957055 4:79853685-79853707 AGGAAAACTGAGACCTATAGAGG - Intergenic
976132331 4:81897786-81897808 AAGGAAACTGAGGCTTGGAGGGG + Intronic
976529029 4:86129189-86129211 AAGGAAACTGAGTCCCATGGTGG + Intronic
977759197 4:100710921-100710943 AAAGAAACTGAGGACTATGGTGG - Intronic
978685253 4:111434708-111434730 AGGGAAAATGAAGCAGGTGGGGG + Intergenic
979779431 4:124632125-124632147 AGGGAAACTGAGGGCAGAGGAGG - Intergenic
979908568 4:126330961-126330983 AGGTAAACTGAGGACTGGAGAGG + Intergenic
980014047 4:127628613-127628635 AAGGAAAGTGAAGCTTGTGGAGG + Intronic
981418530 4:144521545-144521567 AGGGGAAGTGAGGACAGTGGAGG - Intergenic
982025918 4:151254070-151254092 GAGGAAACTGAGGCCCTTGGAGG - Intronic
982138333 4:152294105-152294127 AGGGACACTGAGCCTTGGGGAGG + Intergenic
982292391 4:153792263-153792285 TGGGAAACTGAGGCATGGAGAGG + Intergenic
983542654 4:168929715-168929737 AAGGAAACTGAGGCTTGGGGAGG - Intronic
983867180 4:172781767-172781789 AGGGAAACTGAGGCATTAGGAGG + Intronic
984081605 4:175254615-175254637 AGCGAGACTGAGGCTTGTTGAGG - Intergenic
984316501 4:178137923-178137945 AGGGAAGCAGAGGGCTGTTGGGG + Intergenic
985272180 4:188204350-188204372 ACACACACTGAGGCCTGTGGGGG + Intergenic
985575140 5:670387-670409 TGGGAAGCTGGGGGCTGTGGAGG + Intronic
986314552 5:6577804-6577826 TGGGAAACGGAGGCCTGAGCGGG + Intergenic
988997867 5:36731519-36731541 GAGGAAACTGAGGCTTGGGGGGG + Intergenic
990258660 5:53998092-53998114 AAGGAAACTGAGGCATGAGGAGG - Intronic
990478654 5:56186137-56186159 AAGGAAACTAAGGCCTGGAGAGG - Intronic
990523507 5:56602820-56602842 AGAGAAACTGAGGCATGGAGAGG - Intronic
990875431 5:60479024-60479046 AAGGAAACTGAGGCTGGCGGTGG + Intronic
992127066 5:73653080-73653102 AAGGAAACTGAGGCTTAAGGAGG + Intronic
992508028 5:77407055-77407077 GGGGAAAGTGAGCCGTGTGGGGG + Intronic
992643470 5:78790316-78790338 ACTGAAACTGAGGCCTAGGGAGG - Intronic
993100248 5:83529657-83529679 ATAACAACTGAGGCCTGTGGAGG - Intronic
993501008 5:88666938-88666960 AGGAAGACAGAGGCCTGTGTGGG - Intergenic
993719230 5:91305627-91305649 GAGAAAACTGAGGCATGTGGTGG - Intergenic
994743996 5:103656207-103656229 AAGGAAACTGAGGTATGGGGAGG + Intergenic
994820829 5:104648867-104648889 AGTGAAAATGAGGCCTGGCGCGG - Intergenic
995134318 5:108664155-108664177 GGGGAAACTGAGGCCTAGAGTGG + Intergenic
995258215 5:110072188-110072210 AAGGCAACTGAGGTCTGGGGTGG - Intergenic
995844826 5:116482153-116482175 GGGAAAACTGAGGCCTGGAGAGG - Intronic
996927261 5:128842346-128842368 GAGGAAACTGAGGCCTTTTGGGG - Intronic
998045272 5:138981971-138981993 GGAGAAACTGAGGCTTGGGGAGG - Intronic
998078581 5:139256210-139256232 AGGGGAATTGAGGCCAGGGGTGG - Intronic
998416902 5:141952693-141952715 GAGGAAACTGAGGTCTGAGGAGG - Intronic
998459169 5:142296670-142296692 GGGGAAACTGAGACGTGGGGAGG + Intergenic
998952538 5:147406463-147406485 AAGGAAACTGAGGCTTTGGGAGG - Intronic
999093591 5:148958586-148958608 AGGGAGACAGAGGCATGGGGTGG + Intronic
999150319 5:149422317-149422339 GGAGAAACTGAGGCCTGGAGAGG + Intergenic
999169584 5:149581844-149581866 TGGGAAACTGAGGCCCAGGGAGG + Intronic
999195900 5:149781423-149781445 GAGGAAACTGAGGCATGGGGAGG - Intronic
999238160 5:150112449-150112471 GGGGAAACTGAGGCCTGATGTGG + Intronic
999239365 5:150118615-150118637 AGGGAAACTGAGGCCCAGAGAGG + Intronic
999249069 5:150171102-150171124 GGGGAAACTGAGGCCCATGAAGG + Intronic
999260079 5:150232878-150232900 AGGGAAACTGAGGCCCAGTGAGG + Intronic
999303886 5:150507701-150507723 GGGGAAACTGAGGTCTGGAGGGG + Intronic
999308391 5:150535542-150535564 TGGGAAGCTGAGGCCTGGGAGGG - Intronic
999443004 5:151616976-151616998 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
999586745 5:153097727-153097749 AGAGAAACTGAGGCCTATGGTGG + Intergenic
999640531 5:153668098-153668120 AGGGAAACTGAGGCCCAAAGAGG - Intronic
999671878 5:153965478-153965500 AAGCAAACTGAGGCCTGGGGAGG - Intergenic
999740489 5:154546285-154546307 TGGGAAACTGAGGCTTGGAGAGG - Intergenic
999790765 5:154937854-154937876 AGGGAAACTGAGGCCCAGGCTGG - Intronic
999853933 5:155572831-155572853 AGGGAAACTGAGCCTTTTCGTGG - Intergenic
1000070597 5:157737198-157737220 AGGAAAACTGGGGCCTGGTGTGG + Intronic
1000215214 5:159148895-159148917 AGGGTAAATAAGGCCTGGGGGGG + Intergenic
1000673012 5:164085951-164085973 GGGGAAACTGAGGCCTAGGGAGG + Intergenic
1001228496 5:169965784-169965806 GAGGAAACTGAGGCCTATAGAGG + Intronic
1001268748 5:170295033-170295055 AGGAAGACTGAGGCCTCTAGAGG + Intronic
1001321901 5:170689447-170689469 AAGGAAACTGAGGCTTAGGGAGG + Intronic
1001334059 5:170783349-170783371 TGGGAAGCTGAGGCCTAAGGAGG + Intronic
1001403824 5:171462016-171462038 GGGAAAACTGAGGCCTGTAGAGG + Intergenic
1001415401 5:171541896-171541918 GAGGAAACTGAGGCTTATGGAGG + Intergenic
1001428626 5:171642220-171642242 AGGGGTACTGAGGCCTGAGCAGG + Intergenic
1001431597 5:171666876-171666898 GGGGTAACTGAGGTCTGAGGGGG + Intergenic
1001529397 5:172451807-172451829 ATGGAAACAGATCCCTGTGGTGG - Intronic
1001569555 5:172721212-172721234 GGGGAAACCGAGGCCTGGAGAGG - Intergenic
1001583880 5:172819726-172819748 GTGGAAACTGAGGCCAGTGTGGG + Intergenic
1001587553 5:172843832-172843854 AGGAAAACTGAGGCTTGCAGAGG - Intronic
1001793634 5:174483267-174483289 AAGGAAACTGAAGCCTGGGGAGG + Intergenic
1001926312 5:175639727-175639749 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1001932869 5:175685651-175685673 GAGGAAACTGAGGCCTGAGATGG - Exonic
1001966298 5:175912079-175912101 ATGGAAAATGAGGCTTGGGGAGG - Intergenic
1002047519 5:176550229-176550251 GGGGAAACTGAGGCCTGGAGAGG + Intronic
1002054495 5:176590843-176590865 AAGGAAACTGAGGCCCGTGGAGG - Intronic
1002101586 5:176860606-176860628 GGGGAACCTGAGGCCCGAGGGGG - Intronic
1002250649 5:177927124-177927146 ATGGAAAATGAGGCTTGGGGAGG + Intergenic
1002277906 5:178115065-178115087 CGGGAAACTGAGGCCTCGGAAGG - Intronic
1002330021 5:178434741-178434763 GAGGAAACTGAGGCCTGGGATGG + Intronic
1002425473 5:179172188-179172210 AGGGCAGCTCATGCCTGTGGTGG - Intronic
1002494606 5:179603291-179603313 AGGGAATCTGATGTCTCTGGTGG + Intronic
1003038154 6:2662687-2662709 AGTGATCCTGTGGCCTGTGGTGG + Intergenic
1003095544 6:3140280-3140302 AGGGAAACTGAGGGCCAAGGAGG + Intronic
1003152234 6:3562761-3562783 AGGGAATCTGAGGCCTGGGAAGG + Intergenic
1003168313 6:3700496-3700518 AAGGAAACTGAGGCCAGGAGAGG + Intergenic
1003454646 6:6270593-6270615 TGGGAAACTGAGGCTTGGTGAGG + Intronic
1003620293 6:7693506-7693528 GGGGAAACTGAGGCCTGGAGAGG + Intergenic
1004690091 6:17986711-17986733 AGGAAAACTGAGGCCCGAGGCGG - Intronic
1005098372 6:22143214-22143236 AGAGCATCTGAGGCGTGTGGTGG + Intergenic
1005712980 6:28520433-28520455 AGGTAAATTCAGGCCTGTAGAGG + Intronic
1005949976 6:30624734-30624756 GGGGAAACTGAGGTCCATGGAGG + Intronic
1006020871 6:31116852-31116874 AGGGGGTCAGAGGCCTGTGGTGG - Exonic
1006083911 6:31582673-31582695 AGAGAAACTGAGGCCCAGGGAGG + Intergenic
1006376237 6:33673159-33673181 GGGGAAACTGAGGCCTGTGAGGG - Intronic
1006419530 6:33924596-33924618 AGGGACACAGAGGCCACTGGAGG + Intergenic
1006425930 6:33962993-33963015 AGGAGAAATGAGGCCTGAGGAGG - Intergenic
1006438921 6:34041268-34041290 AGGGAAACTGAGGCCCAGAGAGG + Intronic
1006439963 6:34047767-34047789 AAGGAAACTGAGGCCTGAGGAGG + Intronic
1006625810 6:35397040-35397062 AGGGCAGCTGAGTCCTGAGGAGG - Intronic
1006642158 6:35495090-35495112 AGGGAAACTGAGGCCCAAAGGGG + Intronic
1006840965 6:37027677-37027699 AGGGAAACTGAGGCCCAATGAGG + Intronic
1006881356 6:37342729-37342751 GGGGAAACTGAGGCTTGGAGTGG + Intergenic
1006905754 6:37532316-37532338 GTGGAAACTGAGGCCAATGGAGG - Intergenic
1006927765 6:37667362-37667384 AGGGAAACTGAGGCCCAAGGTGG - Intronic
1006933371 6:37700624-37700646 GGGGAAACTGAGGCCTAGAGAGG - Intergenic
1006951126 6:37821498-37821520 GGGGAAACTGAGGCTTTGGGTGG + Intronic
1007228758 6:40333483-40333505 GAGGAAACTGAGGCATGGGGGGG - Intergenic
1007413416 6:41678234-41678256 AGGGAAACTGAGGCACAGGGAGG + Intergenic
1007476952 6:42125309-42125331 AGGGAAACTGAGGCACAGGGTGG - Intronic
1007701074 6:43766999-43767021 AGGGAAACTCTCGCCTGTGTGGG - Intergenic
1007714660 6:43848725-43848747 GAGGAAACTGAGGCCTTGGGAGG + Intergenic
1007746043 6:44043555-44043577 AGGGAAACTGAGGCCCAAGGAGG + Intergenic
1007747396 6:44051473-44051495 GGGGACACTGGGGCCTGGGGTGG + Intergenic
1007756330 6:44102037-44102059 AGATGAAGTGAGGCCTGTGGAGG - Intergenic
1007769291 6:44180274-44180296 AGGGAAACTGAGGCATGAGAAGG + Intronic
1007812041 6:44493276-44493298 AGTGCAACGGAGGCCTCTGGAGG - Intergenic
1009573344 6:65418687-65418709 ATGGAAACAGAGACCTGTTGGGG + Intronic
1009585433 6:65595514-65595536 AAGGAAAGTGAAGCTTGTGGAGG - Intronic
1010755778 6:79664621-79664643 TGGGACACTGAGGTCTGTGTGGG - Intronic
1013021361 6:106223515-106223537 AGGTAAATTGAGTCCTGTAGGGG - Intronic
1013317841 6:108958860-108958882 AAGGAAACTGAGGCCCAAGGAGG + Intronic
1014283170 6:119464655-119464677 GAGGAAAATGAGGCCTGAGGAGG - Intergenic
1015033188 6:128621481-128621503 ACACACACTGAGGCCTGTGGGGG - Intergenic
1015840432 6:137471187-137471209 AGGGAAACTGAGGCATTGAGGGG + Intergenic
1015842555 6:137489859-137489881 AGGGAAAATGAGGCCGGCGTCGG - Intergenic
1015898229 6:138037502-138037524 AAGGAAACTGAGGCTTGGGCAGG + Intergenic
1016024430 6:139271811-139271833 ACAGAAACTGAGGCCAGTGGAGG - Intronic
1016826913 6:148396813-148396835 TGGGAAACTGAGGCCAGGAGAGG - Intronic
1017524913 6:155234121-155234143 ATGAAAGCTGAGGCCTGTGATGG + Intronic
1017901602 6:158722714-158722736 AGGGGAACTGAGGACAGAGGTGG + Intronic
1018010657 6:159666996-159667018 AGGGAAACCTAAGCCTTTGGTGG + Intergenic
1018133140 6:160751341-160751363 AAGGAAACTGAGGCGTAAGGAGG - Intronic
1018443712 6:163835821-163835843 GGGGAAACTGAGGCCTAGGAAGG - Intergenic
1018631281 6:165825287-165825309 GAGGAAGCCGAGGCCTGTGGTGG + Intronic
1018720482 6:166568115-166568137 AAGAAAGCTGAGGCCTGTGGTGG - Intronic
1018932480 6:168250377-168250399 AGTGAAGCTGAGACCTGGGGTGG - Intergenic
1018970772 6:168527300-168527322 GGGGAAACTGAGGCCCGGGAAGG - Intronic
1019265526 7:115370-115392 GGGGAAGCTGTGGCCAGTGGAGG - Intergenic
1019300458 7:300533-300555 GGGGAAACTGAGGCTTGAGAGGG + Intergenic
1019359342 7:596678-596700 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1019411156 7:907349-907371 GTGGAAACTGAGGCCAGAGGGGG + Intronic
1019462324 7:1167092-1167114 GGGGAAACTGAGGCGTGGAGGGG + Intergenic
1019494518 7:1331559-1331581 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1019511918 7:1421949-1421971 AGGGAGACTGAGGCTTGAAGAGG + Intergenic
1019514178 7:1432559-1432581 AGGGAAACTGAGGCTGGGAGAGG - Intronic
1019558689 7:1645269-1645291 AGGGAAACTGAGGCCGGGTGAGG - Intergenic
1019571300 7:1713720-1713742 AGGGAAACCGAGACCTACGGAGG - Intronic
1019613363 7:1947955-1947977 AGAGAAACTGAGGCCCAAGGAGG + Intronic
1019647712 7:2139941-2139963 AGGGAAACTGAGGCCTGTGGGGG - Intronic
1019700235 7:2471336-2471358 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1019737427 7:2657628-2657650 AGGGAAATTGAGGCCCAGGGTGG - Intronic
1020138503 7:5599425-5599447 AGGGAGACTAAGGCCGGTGGTGG - Intronic
1020140604 7:5609544-5609566 AGGGACCCTGAGTCCTGCGGGGG + Intergenic
1020259592 7:6523444-6523466 GGGGAAACTGAGGCCTGGAGAGG - Intronic
1020262979 7:6541205-6541227 AAGGAAACTGAGGCTGGTAGAGG + Intronic
1020289599 7:6712542-6712564 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1021104680 7:16623580-16623602 CAGAAAACTGAGGCCTATGGAGG + Intronic
1021153388 7:17179450-17179472 AGGGAAACTGAGGCCTGGAATGG + Intergenic
1021607339 7:22421427-22421449 GAGGAAACTGAGGCGTGGGGAGG + Intronic
1021914388 7:25416895-25416917 AGAGAAACTGAGGCCCAGGGAGG - Intergenic
1022507032 7:30913845-30913867 CTGGCAACTGAGGCCTGGGGGGG - Intronic
1022529599 7:31058569-31058591 AGGGAAACTGAGGCCAGAGAAGG - Intronic
1022873104 7:34500119-34500141 AGGGAAACCAAGGCATGAGGAGG + Intergenic
1023168991 7:37372352-37372374 GGGGAAACTGAGGCCTGTCAAGG - Intronic
1023187048 7:37542933-37542955 AAGGAAACTGGGGCCCATGGAGG + Intergenic
1023336996 7:39180776-39180798 AGGGAAACTGAAGCCAGTAATGG - Intronic
1023654431 7:42405666-42405688 AGGGAACCCCAGGCCAGTGGTGG - Intergenic
1023826344 7:44012504-44012526 AAGGAAGCAGAGGCATGTGGAGG - Intergenic
1023850299 7:44146334-44146356 TGGGAAACTAGGGCCTGGGGCGG - Intronic
1024055050 7:45654856-45654878 AGGGAAACTGAGTCCTAGGTAGG + Intronic
1024248595 7:47489382-47489404 GGGGAAACTGAGGCCCCTAGAGG - Intronic
1025150180 7:56541333-56541355 AGGGAGGCTGAGACCTGGGGTGG - Intergenic
1025174161 7:56788713-56788735 AAGGAAACTGAGGCTTGGAGAGG - Intergenic
1025281293 7:57627820-57627842 ATGGACACGCAGGCCTGTGGTGG - Intergenic
1025303436 7:57837687-57837709 ATGGACACGCAGGCCTGTGGTGG + Intergenic
1025697636 7:63787712-63787734 AAGGAAACTGAGGCTTGGAGAGG + Intergenic
1026016477 7:66675161-66675183 AGGGAAATTGAGGCATGGAGAGG + Intronic
1026089925 7:67291369-67291391 AAGGAAGCAGAGGCTTGTGGAGG - Intergenic
1026746532 7:73017492-73017514 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1026750184 7:73045635-73045657 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1026753831 7:73073745-73073767 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1026757482 7:73101781-73101803 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1026836245 7:73641342-73641364 AGGGCAACTGAGGCCCAGGGAGG - Intergenic
1026877569 7:73888222-73888244 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1026988764 7:74571189-74571211 AGGGAAACTGAGGCCCAGGTAGG - Intronic
1027032635 7:74902050-74902072 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1027089922 7:75291705-75291727 AAGGAAGCAGAGGCATGTGGAGG - Intergenic
1027093567 7:75319633-75319655 AAGGAAGCAGAGGCATGTGGAGG - Intergenic
1027097210 7:75347600-75347622 AAGGAAGCAGAGGCATGTGGAGG - Intergenic
1027119515 7:75506688-75506710 AAGGAAGCAGAGGCATGTGGAGG - Intergenic
1027272310 7:76528923-76528945 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1027322137 7:77020070-77020092 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1027325770 7:77047989-77048011 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1027578489 7:79961592-79961614 TGGGAGGCTGAGGCCGGTGGTGG - Intergenic
1028201829 7:87971426-87971448 AGGGACACTGAGGCCAGTGTGGG - Intronic
1028872017 7:95780566-95780588 AGGGAAAGTGAGGCCGGGCGTGG - Intronic
1029272500 7:99385489-99385511 AGGGAAACTGAGGCCCCAGGAGG + Intronic
1029398320 7:100324601-100324623 AAGGAAGCAGAGGCATGTGGAGG - Intergenic
1029619835 7:101683333-101683355 AGGGAAACTGAGGCATGGGGAGG - Intergenic
1029623908 7:101707711-101707733 AGTAAAACCCAGGCCTGTGGTGG - Intergenic
1029656856 7:101931508-101931530 AGGGAAACTGAGGCCCAGAGAGG + Intronic
1029717982 7:102343344-102343366 AAGGAAGCAGAGGCATGTGGAGG + Intergenic
1029754632 7:102565901-102565923 AAGGAAGCAGAGGCATGTGGAGG - Intronic
1029772583 7:102664985-102665007 AAGGAAGCAGAGGCATGTGGAGG - Intronic
1032431421 7:131864990-131865012 AGGGAAACTGAGGCATGGGGAGG + Intergenic
1033038241 7:137894939-137894961 GGAGAAACTGAGGCCTGGTGGGG - Intronic
1033726499 7:144124054-144124076 TGGGAAACTGAGGCATGAAGAGG + Intergenic
1034060360 7:148081761-148081783 CAGGAAACTGAGGCCTGAGGGGG + Intronic
1034105482 7:148486314-148486336 GGGGAAACTGAGTCCTGAAGAGG + Intergenic
1034139270 7:148801381-148801403 GGGGAAACTGAGGCCAGATGAGG + Intergenic
1034369913 7:150585859-150585881 AGGGATACTGAGGGCAGTGACGG + Intergenic
1034554163 7:151839405-151839427 GGGGAAACTGAGGCCTAAAGAGG - Intronic
1035168878 7:157006974-157006996 AGGAGAACTGAGGCCAGTCGGGG + Intronic
1035589563 8:802350-802372 AGGGAAGCTGTGGCCTGAGGTGG - Intergenic
1035905009 8:3499983-3500005 AGGGCCTATGAGGCCTGTGGGGG + Intronic
1036561229 8:9901999-9902021 GGGGAAACTGAGGCCGGGGAGGG + Intergenic
1036693253 8:10958076-10958098 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1036766185 8:11550535-11550557 AGGAACACCGAGGCCAGTGGGGG + Intronic
1037261596 8:17015366-17015388 AGGGAAACTGATGAGGGTGGAGG + Intergenic
1037484425 8:19334050-19334072 AGGGAAACTGAGGCAGGTGATGG + Intronic
1037671803 8:21021638-21021660 AAGGAAACTGGGGACTGAGGTGG + Intergenic
1037914869 8:22766932-22766954 GAGGAAACTGAGGCATGGGGAGG - Intronic
1038450361 8:27635324-27635346 AGGGAAACTGAGGCCCAAGCAGG + Intronic
1039489443 8:37936486-37936508 GAGGAAACAGAGGCCTGAGGGGG + Intronic
1040380365 8:46865873-46865895 AGGGAATCCTGGGCCTGTGGTGG + Intergenic
1040550866 8:48436465-48436487 GAGGAAACTGAAGCCTGAGGAGG - Intergenic
1040807712 8:51411841-51411863 AGGGAGAGTGAGGCCTGAGGAGG - Intronic
1041694327 8:60719806-60719828 AAGGAAACTGAGGCCTTGTGAGG + Intronic
1041886112 8:62809772-62809794 GAGGAAACTGAAGCCCGTGGTGG + Intronic
1042224259 8:66503265-66503287 AGGGAAACTGAGGCCAAGAGAGG - Intronic
1042347645 8:67744428-67744450 AGAGGAAATGAGGCCAGTGGTGG - Intronic
1043271869 8:78343892-78343914 AAGGAATTTGAAGCCTGTGGTGG + Intergenic
1043516968 8:81003636-81003658 GGGGAAACTGAGGCATGGGGCGG - Intronic
1044781909 8:95752214-95752236 AGGCGAACTCAGGCCTGTGCTGG - Intergenic
1044969657 8:97606593-97606615 AAGGAAACTGAGGCTTGGAGAGG + Intergenic
1045034965 8:98169809-98169831 AGGGAGACTGAGGCCCGGCGAGG + Intergenic
1046036068 8:108843156-108843178 AGGGGAACTGAGGCCTAGAGAGG + Intergenic
1046855821 8:119030595-119030617 ATGAAAACTGAGGCATGTGGAGG - Intronic
1047205741 8:122802007-122802029 GGGGAAACTGAGGCCAGAGAGGG - Intronic
1047211841 8:122847053-122847075 AGAGAAACTGAGGCATGATGAGG + Intronic
1047308978 8:123676471-123676493 AAAGAAACTGGAGCCTGTGGTGG - Intergenic
1047554614 8:125915598-125915620 AAGGAAACTGAGGCATGCAGAGG + Intergenic
1047743764 8:127828270-127828292 AGGGAAACTGAGGCCCAGAGTGG + Intergenic
1047981382 8:130186729-130186751 AGGGAAACTGAAACCTGGAGAGG - Intronic
1048016253 8:130500178-130500200 GAGGAAACTGAGGCCTTGGGAGG - Intergenic
1048209159 8:132440576-132440598 TGGGAAACTGAGGCTTGGAGGGG + Intronic
1048238030 8:132711653-132711675 AGGGACACTCAGGCCAGTGGTGG + Intronic
1048358255 8:133671773-133671795 AGGGAGACGGAGTCCAGTGGTGG + Intergenic
1048468014 8:134683656-134683678 AGGCACACTGAGAGCTGTGGCGG + Intronic
1048531292 8:135252819-135252841 ACGGAATCTGAGGCTTGGGGAGG - Intergenic
1048866452 8:138765127-138765149 GAGGAAACTGAGGCCGGAGGAGG + Intronic
1049201074 8:141340942-141340964 AAGGAAACTGAGGCTTGGGGAGG - Intergenic
1049211547 8:141388909-141388931 GGGGAAACTGAGGCCAGGAGAGG + Intergenic
1049241172 8:141538035-141538057 GGGGAAACTGAGGCCAGGCGGGG + Intergenic
1049266780 8:141671805-141671827 GGGTAAACTGAGGCTTATGGGGG + Intergenic
1049287748 8:141785703-141785725 GAGGAAACGGAGGCCTGAGGAGG - Intergenic
1049354756 8:142182222-142182244 GGGGAGACTGAGGCCAGGGGAGG - Intergenic
1049462489 8:142736553-142736575 GGGGAAACTGAGGCCTGGAATGG + Exonic
1049541853 8:143212256-143212278 GGGGAAACTGAGGCCTCAGTAGG + Intergenic
1049590952 8:143462236-143462258 AAGGAGACTGAGGCCAGAGGAGG + Intronic
1049741616 8:144243658-144243680 TGGGAGACTGAGGCCAGAGGTGG + Intronic
1050014182 9:1216326-1216348 AGGGAAACCAAGGCATGTGATGG - Intergenic
1051187004 9:14470851-14470873 GAGGAAACTGAGGCCTATGAGGG - Intergenic
1051414902 9:16829054-16829076 AGGGGACCTGGGGCCTGGGGCGG + Intronic
1052778852 9:32760075-32760097 GAGGAAACTGAGGCCTGGAGAGG - Intergenic
1052964589 9:34329927-34329949 AGTGAAACTGAGGCCCAGGGAGG - Intronic
1053179989 9:35960644-35960666 GGGGAAACTGAGGCCTAGGGGGG - Intergenic
1055028892 9:71752087-71752109 AGAGAAACTGAGGCCCAGGGAGG + Intronic
1055256194 9:74374070-74374092 AAGTAAACTGGGGCCTGAGGAGG - Intergenic
1055353783 9:75416875-75416897 TGAGAAACTGAGGCCTGGAGAGG + Intergenic
1055603890 9:77948427-77948449 AGGGAGACTGAGGCCTGACACGG + Intronic
1056000112 9:82206403-82206425 AGGAAAACTGAGGCATGGAGAGG + Intergenic
1056676658 9:88682055-88682077 GGGGAAACTGAGGCCAGGGCTGG + Intergenic
1057280581 9:93708457-93708479 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1057298665 9:93863878-93863900 AGGGAAGCTGAGGCGCATGGAGG + Intergenic
1057757474 9:97849421-97849443 AGAGAAACTGAGGCCTAAGAAGG + Intergenic
1057801181 9:98192367-98192389 GGGGAAACTGAGGCCTGGAGAGG + Intronic
1057840389 9:98481379-98481401 AGGAAAACTGAGGCCAGATGAGG + Intronic
1058177751 9:101757198-101757220 GAGGAAACTGAGGCTTGTAGAGG + Intergenic
1058479322 9:105374970-105374992 AGGGAAACTGAGGCATGGAAAGG + Intronic
1058747797 9:108008676-108008698 AGAGAAACTGAGGCCCTGGGAGG + Intergenic
1058834933 9:108852575-108852597 AGGGAAGCTGAGGCTTATAGAGG - Intergenic
1059348713 9:113649548-113649570 GGGGAAACTGAGGCCTAGTGAGG + Intergenic
1059356023 9:113700083-113700105 AGGGAGACTGAGGCCTGGCAGGG - Intergenic
1059366060 9:113787323-113787345 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1059412338 9:114140276-114140298 AGGGAAACTGAGGCCCAAAGAGG + Intergenic
1059422443 9:114200692-114200714 GGGGAAACTGAGGCCCGGAGAGG + Intronic
1059649079 9:116297942-116297964 GGGGAAACTGAGGCATAGGGAGG + Intronic
1059657452 9:116369387-116369409 AGGGAAACTGAGGCCTATAGAGG + Intronic
1059761266 9:117339964-117339986 ATGGGAACTGAGGCCTGTTGAGG + Intronic
1060182940 9:121546298-121546320 AAGGGAACTGAGGCCTGCGGAGG - Intergenic
1060205850 9:121682437-121682459 ATGGAAACTGAGGCCTGGGAAGG + Intronic
1060206329 9:121684796-121684818 GGGGAAACTGAGGCCTGGAGAGG + Intronic
1060398150 9:123330758-123330780 AGGGAAACTGAGGCATAAGGAGG + Intergenic
1060406890 9:123377233-123377255 AGGGAAACAGAGGCCTAGAGAGG + Exonic
1060525911 9:124321307-124321329 AGGGAAAGAAAGGCCTGTGCTGG - Intronic
1060724809 9:125999684-125999706 GCAGAAACTGAGGCCTGTGGGGG + Intergenic
1060886993 9:127161380-127161402 AAGGAAACTGAGGCCCTGGGAGG + Intronic
1060917302 9:127398705-127398727 AAGGAAACTGAGGCCCAGGGAGG - Intronic
1060995763 9:127874253-127874275 AGGGAAACTGAGTCCCGGAGAGG + Intronic
1060996287 9:127876373-127876395 GAGGAAACTGAGGCATGGGGAGG + Intronic
1061039029 9:128128915-128128937 AGGGAAACTGAGGCAGCTGCTGG + Intergenic
1061045362 9:128162123-128162145 AGGGAAACCGAGGCCTCAGAAGG - Intronic
1061087656 9:128408774-128408796 AGGGAAACTGAGGCCCACAGTGG + Intergenic
1061178385 9:129010519-129010541 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1061211381 9:129195404-129195426 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1061215442 9:129219070-129219092 AGAGAAACTGAGGCTCGTGGTGG + Intergenic
1061248105 9:129411814-129411836 GGGCAAACTGAGGCCTGGAGAGG - Intergenic
1061253667 9:129441038-129441060 AGAGAAACTGAGGCCCAGGGAGG - Intergenic
1061272872 9:129553525-129553547 AGGGAAACTGAGGCCCAGGGAGG - Intergenic
1061286660 9:129627140-129627162 ATGTAAACTGAGGACTGTGCGGG + Intronic
1061300937 9:129704657-129704679 AGGAAAACTGAGGCCTGGAGGGG - Intronic
1061397900 9:130353393-130353415 AAGGAAACTGAGGCCAGGAGTGG + Intronic
1061416781 9:130451391-130451413 AGAGAAACTGAGGCCCAGGGAGG - Intronic
1061419068 9:130463530-130463552 AGGGAAACTGAGGCCCAGGAAGG - Intronic
1061422799 9:130481186-130481208 GGGGAAACTGAGTCCTGGAGAGG - Intronic
1061423859 9:130487042-130487064 TGAGAACCTGAGGCCTGGGGAGG - Intronic
1061493022 9:130956758-130956780 CGGGAAACTGAGGCCCCCGGGGG + Intergenic
1061634896 9:131901393-131901415 AAGTAAACTGAGGCCTAGGGAGG + Intronic
1061659421 9:132118846-132118868 GAGGAAACTGAGGTCTCTGGAGG - Intergenic
1061676375 9:132218289-132218311 GGGGAAACTGAGACTTGGGGTGG - Intronic
1061719160 9:132541114-132541136 GAGGACACTGAGGTCTGTGGTGG - Intronic
1061720013 9:132545790-132545812 ATGGAAACTGAGGCTTGGAGAGG + Intronic
1061727318 9:132588983-132589005 AGGAAAACTGAGGTCTGGGCCGG - Intronic
1061808353 9:133148791-133148813 AGGGAAACTGAGGACAGGAGAGG - Intronic
1061894278 9:133639018-133639040 AGGTAAACTGAGGCCCAGGGAGG - Intronic
1061904970 9:133692087-133692109 AGGGAAACTGAGGCTCAGGGAGG + Intronic
1061905003 9:133692203-133692225 GGGGAAACTGAGGCTCGGGGGGG + Intronic
1061948147 9:133920289-133920311 GGGGACACTGAGGCCTGGTGAGG - Intronic
1062019985 9:134314754-134314776 AAGTTAACTGAGGCCGGTGGGGG + Intergenic
1062028229 9:134350345-134350367 AAGGAAACTGAGGCTTGGAGGGG - Intronic
1062033176 9:134371270-134371292 AAGGACACAGAGGCCTGGGGGGG - Intronic
1062046721 9:134427767-134427789 GGGGAAACTGAGGCATGAGGGGG - Intronic
1062068207 9:134540205-134540227 AGGGAAACTGAGGACTGGGTGGG + Intergenic
1062083713 9:134637811-134637833 AGGTAAACTAGGGCCAGTGGGGG + Intergenic
1062218207 9:135400366-135400388 AGGGAAACTGAGGCAGGCTGGGG - Intergenic
1062352926 9:136148001-136148023 GAGGAAACTGAGGCCTGAGGAGG + Intergenic
1062406663 9:136399981-136400003 GGGGAAACTGAGGCCCGGCGTGG - Intergenic
1062434012 9:136538414-136538436 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1062439417 9:136563077-136563099 TGGGAAACTGAGGCCTGAGAGGG + Intergenic
1062447864 9:136603242-136603264 GAGGAAACTGAGGCCTGGCGAGG + Intergenic
1062460190 9:136659726-136659748 GGGGAAACTGAGGCCTGTGTGGG + Intronic
1062468423 9:136691682-136691704 AGGGAAACTGAGGCCTAGAGAGG - Intergenic
1203630510 Un_KI270750v1:69185-69207 AAGGAAACTGAGGCCTAGAGAGG - Intergenic
1203632392 Un_KI270750v1:81420-81442 ATGGACACCCAGGCCTGTGGTGG - Intergenic
1185466554 X:358439-358461 AGGCACAGTGGGGCCTGTGGAGG + Intronic
1185763540 X:2706620-2706642 AGGGACACCCAGGCCAGTGGCGG + Intronic
1185892727 X:3835362-3835384 GGGGAAACTGAGGCCCGGAGGGG - Intronic
1185897835 X:3873782-3873804 GGGGAAACTGAGGCCCGGAGGGG - Intergenic
1185902954 X:3912213-3912235 GGGGAAACTGAGGCCCGGAGGGG - Intergenic
1186177663 X:6942377-6942399 TAGGAAACTAGGGCCTGTGGTGG - Intergenic
1186969268 X:14822471-14822493 ACAGAAACTGAGGCCAATGGAGG + Intergenic
1187240186 X:17505869-17505891 TGGGGAACTGGGGCCTGAGGAGG + Intronic
1187682081 X:21777901-21777923 TGGGCAACTGAGTCCTGCGGGGG + Intergenic
1188041352 X:25372862-25372884 GGGGAAACTGAGGCCTACTGTGG + Intergenic
1188104338 X:26131345-26131367 ATGGAAACTGAGGCCTAGGCAGG + Intergenic
1189004033 X:36976978-36977000 AGGGAAACTGAGGCACGGAGAGG - Intergenic
1189279589 X:39811829-39811851 GGGGAAACTGAGGTCTGGAGGGG - Intergenic
1189350534 X:40272430-40272452 TGGGAAACTCAGCCCTGTGTGGG - Intergenic
1189779667 X:44502056-44502078 AGGGAAGAGGAGGCCTGAGGAGG - Intergenic
1190058894 X:47198388-47198410 GAGAAAACTGAGGCCTGTGGCGG + Intronic
1190244463 X:48682020-48682042 GGGGAAACTGAGGCCTGGGGAGG + Intronic
1190292524 X:49002038-49002060 AGGGAAACTGAGGCTCGGAGTGG - Intronic
1190309510 X:49106810-49106832 GGGGAAACTGAGGCCTGGGGAGG + Intergenic
1190328822 X:49223315-49223337 GGGGAAGCTGGGCCCTGTGGTGG + Intronic
1190625749 X:52336928-52336950 ATGGGAAATGAGGCCTGTGTTGG + Intergenic
1190935568 X:54996347-54996369 AGGGAAACTGAGGTCTGGGGAGG + Intronic
1191700175 X:64033618-64033640 AGGGAGCCTGAGGTCTCTGGTGG - Intergenic
1192012824 X:67293567-67293589 AGGCAAACTGAGGCCCTAGGAGG - Intergenic
1192201361 X:69068655-69068677 AGGCAAAGTGAGGCCTGAGGAGG - Intergenic
1192212138 X:69134400-69134422 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1192284600 X:69721502-69721524 AGGGAAGCTCAGGCCTGGTGGGG + Intronic
1192410664 X:70930047-70930069 AGGGATAATGAGCCCTGTCGAGG - Intronic
1192807809 X:74525331-74525353 AGGAAACATGAAGCCTGTGGAGG - Intronic
1192848057 X:74925742-74925764 AGGGAAAGGGAGAGCTGTGGTGG - Intergenic
1193076389 X:77360253-77360275 TGGGAAACTGAGTCCAGTGGGGG - Intergenic
1193195064 X:78621774-78621796 AGGTAAACTGAGGCCCAAGGAGG - Intergenic
1194250000 X:91562861-91562883 AGAGACTGTGAGGCCTGTGGGGG + Intergenic
1195675345 X:107503398-107503420 GGGGAAACTGAGGCCTAGGAAGG + Intergenic
1196031724 X:111099795-111099817 AAGGAAACTGAGGCCTAGAGAGG - Intronic
1196078256 X:111601471-111601493 AAGGAAGCGGGGGCCTGTGGGGG + Intergenic
1196649686 X:118156206-118156228 GAGGAAACTGAGGCCTAGGGAGG - Intergenic
1197705493 X:129631714-129631736 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1197823141 X:130561763-130561785 AAGCAAGCTGAGGCCTGTGGAGG + Intergenic
1198028931 X:132736187-132736209 AGGGAAACTGAGGCCCTATGTGG - Intronic
1198214184 X:134542235-134542257 AAGAAAACTGGGGCCTCTGGAGG - Intergenic
1200568961 Y:4804110-4804132 AGAGACTGTGAGGCCTGTGGGGG + Intergenic
1202130092 Y:21601545-21601567 AGGAAAACCTAGGCCAGTGGGGG + Intergenic