ID: 1019649350

View in Genome Browser
Species Human (GRCh38)
Location 7:2148374-2148396
Sequence CTGTGGGGCTGGTGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 759
Summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 680}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019649350_1019649369 24 Left 1019649350 7:2148374-2148396 CCCACTGCCCACCAGCCCCACAG 0: 1
1: 0
2: 5
3: 73
4: 680
Right 1019649369 7:2148421-2148443 CTCATGGTAGCTCCACCTTCTGG 0: 1
1: 0
2: 0
3: 31
4: 255
1019649350_1019649361 -7 Left 1019649350 7:2148374-2148396 CCCACTGCCCACCAGCCCCACAG 0: 1
1: 0
2: 5
3: 73
4: 680
Right 1019649361 7:2148390-2148412 CCCACAGGTCCCACCGGATGGGG 0: 1
1: 0
2: 0
3: 12
4: 160
1019649350_1019649366 8 Left 1019649350 7:2148374-2148396 CCCACTGCCCACCAGCCCCACAG 0: 1
1: 0
2: 5
3: 73
4: 680
Right 1019649366 7:2148405-2148427 GGATGGGGTTCAGTCCCTCATGG 0: 1
1: 0
2: 2
3: 11
4: 124
1019649350_1019649357 -9 Left 1019649350 7:2148374-2148396 CCCACTGCCCACCAGCCCCACAG 0: 1
1: 0
2: 5
3: 73
4: 680
Right 1019649357 7:2148388-2148410 GCCCCACAGGTCCCACCGGATGG 0: 1
1: 0
2: 0
3: 8
4: 121
1019649350_1019649370 29 Left 1019649350 7:2148374-2148396 CCCACTGCCCACCAGCCCCACAG 0: 1
1: 0
2: 5
3: 73
4: 680
Right 1019649370 7:2148426-2148448 GGTAGCTCCACCTTCTGGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1019649350_1019649359 -8 Left 1019649350 7:2148374-2148396 CCCACTGCCCACCAGCCCCACAG 0: 1
1: 0
2: 5
3: 73
4: 680
Right 1019649359 7:2148389-2148411 CCCCACAGGTCCCACCGGATGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1019649350_1019649371 30 Left 1019649350 7:2148374-2148396 CCCACTGCCCACCAGCCCCACAG 0: 1
1: 0
2: 5
3: 73
4: 680
Right 1019649371 7:2148427-2148449 GTAGCTCCACCTTCTGGTCAGGG 0: 1
1: 0
2: 5
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019649350 Original CRISPR CTGTGGGGCTGGTGGGCAGT GGG (reversed) Intronic
900183776 1:1323928-1323950 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900183819 1:1324040-1324062 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183854 1:1324128-1324150 CTGAGGGGCTGGGGGGCTGGGGG + Intronic
900183857 1:1324136-1324158 CTGGGGGGCTGGGGGGCTGAGGG + Intronic
900183865 1:1324152-1324174 CTGAGGGGCTGGGGGGCTGAGGG + Intronic
900266941 1:1762154-1762176 TTGTGTGGCTGCTGGGCAGATGG - Intronic
900315481 1:2054023-2054045 CTGTGGGGCAGGTGGGCCCTGGG + Intronic
900318985 1:2073245-2073267 GTGTGGGGACGGTGGGCACTGGG - Intronic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900550619 1:3252609-3252631 GGGTGGGGCTGGTGGGCAGCAGG + Intronic
900596725 1:3483359-3483381 CTGTGTGGATGCAGGGCAGTGGG + Intergenic
900721542 1:4179138-4179160 CCGTCAGGCAGGTGGGCAGTTGG + Intergenic
900991563 1:6100528-6100550 GGGTGGGGCTGGGTGGCAGTGGG - Exonic
901062033 1:6475977-6475999 CTGCGGGGCTGGTGCGCGGCGGG + Exonic
901216574 1:7558572-7558594 CACTAGGGCTGATGGGCAGTGGG + Intronic
901773999 1:11546671-11546693 CAGAGGGGCTGGTGGGCCATGGG + Intergenic
901823880 1:11847968-11847990 CTGAGGGTCTGGGGGGCTGTTGG - Intronic
902242646 1:15099171-15099193 CTGGGAGGCTGATGGGCAGAGGG + Intronic
902360829 1:15941830-15941852 CTGTGGGGTGGGTGGGGAGCTGG - Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902768745 1:18633477-18633499 CTGCGAGGCTGGTAGGCAGATGG - Intronic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902817898 1:18926538-18926560 CTCTGAGGCTGGTGGCCAGGAGG + Intronic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903680503 1:25093277-25093299 CTCTGGGACTGGTGGGCTGGGGG - Intergenic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904503704 1:30933679-30933701 CTGTGCAGCTGGCGGGTAGTGGG - Intronic
904771535 1:32884065-32884087 CTGAGGGGCAGCTGGGCAGCGGG - Intergenic
904800868 1:33092287-33092309 CTGTGGGGAGGCTGGGCTGTGGG + Intronic
904842070 1:33379314-33379336 GTGGGGGGCAGGGGGGCAGTGGG - Intronic
905199043 1:36304122-36304144 CTGTGCGGCTGGTGGGGGGTGGG - Exonic
905245904 1:36613156-36613178 CTCTGGGGCCAGTGGGCAATGGG - Intergenic
906676761 1:47698788-47698810 CTGAGGGGATAGTTGGCAGTGGG - Intergenic
907135733 1:52138164-52138186 CTCTGAGGCTGGAGTGCAGTGGG + Intergenic
907311697 1:53542512-53542534 GTGTGGGGCGGGTGGGGAGATGG + Intronic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907697083 1:56742058-56742080 CAGTGGGGCTGGGGGGCGGATGG + Intronic
908398174 1:63745463-63745485 CTGTGGGGCTGGGTGAGAGTGGG - Intergenic
910118809 1:83761570-83761592 CTGAGGGGTGGGTGGGCAGGGGG - Intergenic
910739397 1:90498323-90498345 ATGTGGGCCTGGTGGTTAGTTGG + Intergenic
912382805 1:109256397-109256419 CTGGAGGGTAGGTGGGCAGTCGG + Intronic
913531715 1:119738372-119738394 GTGTGGGGCTGCTGGGCAGCAGG - Intronic
914221501 1:145686238-145686260 CAGTGGGGGTGGGGGGCACTGGG - Intronic
914474064 1:148009107-148009129 CAGTGGGGGTGGGGGGCACTGGG - Intergenic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
915088340 1:153404191-153404213 CTGTAGGGCTGCTGAGCAGGTGG - Intergenic
915420059 1:155773329-155773351 TTGGGGGGATGGTGGGCAGATGG - Intronic
915460238 1:156066119-156066141 CTGGGGGGCTGCTGGGTGGTGGG + Intronic
915701957 1:157804727-157804749 CTGTGTGGATGGTGGGTACTGGG - Intronic
916120721 1:161525774-161525796 CTATGGGGCTGCTGTGCAGGCGG + Exonic
916130488 1:161607407-161607429 CTATGGGGCTGCTGTGCAGGCGG + Intronic
916478716 1:165195474-165195496 CTGTGGGGCCTGTGGGTAATTGG - Intergenic
916599437 1:166277338-166277360 CTGTATGCCTGGGGGGCAGTTGG + Intergenic
917919529 1:179739445-179739467 CTGGGAGGCTTGTGGCCAGTGGG - Intergenic
919077409 1:192830384-192830406 CGCTGGGCCTGTTGGGCAGTGGG + Intergenic
919425623 1:197426710-197426732 CTGTGGTCCTGGTTGGGAGTAGG - Intronic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
919849905 1:201665596-201665618 CTCAGGAGGTGGTGGGCAGTGGG - Intronic
920030453 1:203034538-203034560 CTATGGGAGTGGGGGGCAGTGGG + Intronic
920116922 1:203628071-203628093 CTGTGGGGCTGGTGAGTGTTTGG + Intronic
920232627 1:204480679-204480701 CTGTGTGGGTGGTGGGCTGCCGG + Intronic
920242849 1:204566204-204566226 CTTGGTGGCTGGTGGGGAGTTGG - Intergenic
920432444 1:205927635-205927657 GTGTGGGGCTGGGGGGCACGGGG + Intronic
920446292 1:206021225-206021247 CTGTGGGGCTGGGTGGCATTAGG - Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
921070909 1:211656876-211656898 CTATGGGGCTGATGGGAGGTGGG - Intergenic
921589868 1:216990933-216990955 GGGTGGGGTTGGGGGGCAGTTGG - Intronic
922455902 1:225773369-225773391 CTGTGGACCTGGTAGGCAGTGGG + Intergenic
922598360 1:226831202-226831224 CTGTGGGGATAGTGGGCACATGG + Intergenic
922618300 1:226976228-226976250 CTGTGGGACTGCGGGGCTGTGGG + Intronic
922618339 1:226976380-226976402 CTGTGGGACTGCGGGGCTGTGGG + Intronic
922648867 1:227319017-227319039 CTGGGGGGCCGGTGGGGAGCAGG - Intergenic
923283343 1:232466126-232466148 CTGTGGGGCTGGTTATCACTGGG + Intronic
1063371713 10:5526595-5526617 GTGAGGGGTTGGGGGGCAGTTGG + Exonic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063487162 10:6430686-6430708 GAGTGGGGCTGGTGGGGAGTTGG + Intronic
1063892768 10:10647315-10647337 ATGTGGAGCGGGCGGGCAGTGGG - Intergenic
1065093453 10:22258667-22258689 CTGAGGGGCAGGTGGTCAGATGG - Intergenic
1065790378 10:29254821-29254843 CTCTGGGGCTGGTGGCCTTTTGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067183257 10:44006136-44006158 ATTTGGGGCTGATGGGCAGTGGG - Intergenic
1067290263 10:44934892-44934914 TTGGGGGGCTGGAGGGCACTGGG - Exonic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067433605 10:46262477-46262499 CTGAGGGCCTGGGGTGCAGTTGG - Intergenic
1067440079 10:46303828-46303850 CTGAGGGCCTGGGGTGCAGTTGG + Intronic
1067479974 10:46588278-46588300 CTGTGGGGAGGGTGGGCCATGGG - Intronic
1067513087 10:46911516-46911538 CTGGGGGCCAGGTGGGCAGGGGG + Intronic
1067614763 10:47753519-47753541 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1067649166 10:48140326-48140348 CTGGGGGCCAGGTGGGCAGGGGG - Intergenic
1068922439 10:62498809-62498831 GTGGGGGGGTGGAGGGCAGTGGG + Intronic
1069621659 10:69841060-69841082 AAGTGGGGCAGGGGGGCAGTGGG - Intronic
1069910358 10:71755143-71755165 CAAAGGGGCTGGTGGGCACTTGG + Intronic
1070140171 10:73732895-73732917 CTGGGGGCGTGGGGGGCAGTGGG - Intergenic
1070537980 10:77393612-77393634 GTGTGGTGCGGCTGGGCAGTTGG - Intronic
1070561992 10:77575172-77575194 CGGTGGGGCTGTTGGGGAGCTGG - Intronic
1070628708 10:78069201-78069223 CTGTGGAGCTGGTGTCCTGTGGG + Intergenic
1070645511 10:78199494-78199516 CAGAGGGGCTGGGGGGCAGAAGG + Intergenic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1071630169 10:87213482-87213504 CTGTGGGGAGGGTGGGCCATGGG + Intergenic
1072018889 10:91379388-91379410 GTGGGGGGTTGGGGGGCAGTGGG - Intergenic
1072174328 10:92901890-92901912 CTGGGGGGTTGGTGGGGGGTGGG + Intronic
1072486968 10:95864875-95864897 CTGTTGGGCTGGGGGGAGGTTGG + Intronic
1072625368 10:97107849-97107871 GAGTGTGGTTGGTGGGCAGTGGG - Intronic
1072692745 10:97582560-97582582 CTATGGCCCTTGTGGGCAGTGGG - Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1073470691 10:103720441-103720463 CAGTGGGGGAGGTGGGCAGCAGG - Intronic
1074301945 10:112240915-112240937 CTGTGGCGCTGGTGGGAGCTGGG - Intergenic
1074716358 10:116223162-116223184 CTGGGGGGCTAGTGGGTAGAGGG - Intronic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075657980 10:124174428-124174450 CTTTGGGGCTGGAGGGCACTGGG - Intergenic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076490154 10:130854890-130854912 CTTTGGGGGTTATGGGCAGTAGG + Intergenic
1076894448 10:133303119-133303141 CTGAGAGGCTGCTGGGCTGTTGG - Intronic
1076910417 10:133385342-133385364 CTGGGTTGCTGGTGGGCAGCCGG + Intronic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077162499 11:1120177-1120199 CTGTGGGGAGGGTTTGCAGTTGG - Intergenic
1077187933 11:1243765-1243787 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188360 11:1245436-1245458 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077188890 11:1247536-1247558 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077189315 11:1249207-1249229 ATGTGGGGCTGCTGGGCAGCAGG - Exonic
1077363136 11:2149696-2149718 ATGTGGAGGTGGTGGGGAGTGGG + Intronic
1077486607 11:2841622-2841644 CTGTGGGGCTGTTGGCCTGCAGG + Intronic
1077537190 11:3130026-3130048 GTGTAGGGCTGGTGGGGAGCAGG - Intronic
1077853194 11:6095794-6095816 CTGAGGGGCGAGTGGGAAGTGGG + Intergenic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1080453133 11:32395301-32395323 CTCTGGGCCTTGTGGGCACTAGG - Intronic
1080867756 11:36210572-36210594 CAGTGGGCCTCCTGGGCAGTGGG - Intronic
1081610049 11:44556522-44556544 CTCTTGGGCTGGAGCGCAGTGGG + Intergenic
1081750227 11:45505361-45505383 CTTTGGGGCTGAGGGGCACTGGG - Intergenic
1081756663 11:45549610-45549632 CTTTGGGGTGGTTGGGCAGTGGG - Intergenic
1082701263 11:56434018-56434040 TTGTGAGGGTGGTAGGCAGTAGG + Intergenic
1082807098 11:57458434-57458456 CTGAGGGGCGGGTGGGCGGCGGG - Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083803669 11:65060941-65060963 GTGTGGGGCAGGTGGAGAGTGGG - Intergenic
1083827764 11:65212796-65212818 GTGAGGGGCTGGAGGGCAGGAGG + Intergenic
1083885959 11:65573638-65573660 CTGAAGGGCTGGGGGGCAGGGGG + Exonic
1084004423 11:66315481-66315503 ATAGGGGGCTGGTGGGCAGGAGG + Exonic
1084014144 11:66368858-66368880 CTGTGGGGCTGTTGACCAGGAGG + Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084043705 11:66557110-66557132 CTGTGGGGGGAGTGGGCAGAAGG - Intronic
1084258193 11:67956571-67956593 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084457614 11:69277607-69277629 ATGCAGGGCAGGTGGGCAGTAGG + Intergenic
1084470539 11:69356722-69356744 CTGGGGTGCTCCTGGGCAGTGGG - Intronic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1085194683 11:74661952-74661974 CTGTGGTGGTGGTGGCCATTGGG - Intronic
1085309728 11:75509080-75509102 CTGGGTGGCTGGTGGGCATAGGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085386696 11:76161827-76161849 CTGTGGTGGGGGTGGGGAGTGGG - Intergenic
1085390016 11:76177530-76177552 CCGAGGGGCTGGGGGGCTGTGGG - Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1086399315 11:86447602-86447624 TTGGGAGGCTGGGGGGCAGTGGG + Intronic
1086411325 11:86547474-86547496 CTGTCGGGCGGGTGGGGGGTTGG + Intronic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1088685960 11:112284799-112284821 CTGTGAAGCTGGTGGGCATGAGG + Intergenic
1089046090 11:115503501-115503523 CTGTGGGGCGGGCGGGCTGCGGG + Intronic
1089120415 11:116130590-116130612 CTGTGGAGCTTGGGGGCTGTGGG - Intergenic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1089683971 11:120135121-120135143 ATGTGGTTCTGGTGGGCAGGAGG - Intronic
1089744239 11:120605885-120605907 CAATGAGGCTGGTGGGCAGCAGG + Intronic
1090007716 11:123017576-123017598 GCGCGGGGCTGGCGGGCAGTTGG + Intergenic
1090671003 11:128945307-128945329 CTCTGGGGCAGGTGGGCTGTGGG - Intergenic
1090708214 11:129359452-129359474 TTGGGGGGGTGGTGGGGAGTGGG - Intergenic
1091404524 12:200902-200924 CTGTGGGGGAGGTGGGGAGTGGG - Intronic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091722554 12:2823968-2823990 CTGTGGGTCTCCTGGGCACTCGG - Intronic
1091763757 12:3104925-3104947 GTGTGGGGGTGATGGGCAGGGGG + Intronic
1094436841 12:30430269-30430291 CAGTGTGGCTGGTGCCCAGTGGG - Intergenic
1094707576 12:32929252-32929274 ATTTGTGGCTGGTGGGCAGGGGG - Intergenic
1095133512 12:38571228-38571250 CTCTGCTGCTGCTGGGCAGTGGG - Intergenic
1095476182 12:42589510-42589532 CTGCGGGGCTGCTGGGCTGCGGG + Exonic
1095960081 12:47828893-47828915 GTGGGGGGGTGGTGGGTAGTGGG + Intronic
1096078785 12:48820281-48820303 CTGTGGGGCTGGATGGCCCTAGG + Intronic
1096840467 12:54376676-54376698 CTGTGGGGCTGGGCGGGATTAGG + Intronic
1096891131 12:54772674-54772696 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1096984759 12:55748973-55748995 CCGAGGGGCTGGTGAGCAGGGGG + Exonic
1097264188 12:57736452-57736474 CTGGGGAGGGGGTGGGCAGTGGG + Intronic
1098012674 12:66071353-66071375 GTGTGGGGGTGGTGGGCCGCAGG - Intergenic
1099176870 12:79432357-79432379 TTGTGGGGTTGGGGGGCAGGGGG - Intronic
1101781112 12:107837015-107837037 TTGTGGGGGTGGTGTTCAGTGGG - Intergenic
1101874421 12:108589290-108589312 CCCTGGGGCTGGGGGGCAGTGGG - Intergenic
1102101247 12:110280903-110280925 CTCTGGGGCCGGTGGGCGGATGG - Intronic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103455096 12:121059383-121059405 CTGTGGGACTGTGGGGCTGTGGG - Intergenic
1103506123 12:121443253-121443275 CTGTGGGGTGGGAGGTCAGTTGG - Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1104047354 12:125172785-125172807 CCCAGGGGCTGGTGGGCACTCGG + Intergenic
1104421223 12:128637224-128637246 CTGTGGGGATTGTAGGCTGTGGG - Intronic
1104430345 12:128711026-128711048 CTGCAGGGCTGGTGCTCAGTGGG - Intergenic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104781310 12:131422215-131422237 GTGTGCTGATGGTGGGCAGTAGG + Intergenic
1104928257 12:132324906-132324928 CTGTGGGGCTGGAGGGCTTGGGG - Intronic
1104928708 12:132327276-132327298 CAGTGGGGGCGGTGGGCGGTGGG + Intronic
1105253253 13:18720383-18720405 GTGTCGGGCTGGGGGACAGTCGG - Intergenic
1105258264 13:18759609-18759631 GTGAGAGGGTGGTGGGCAGTAGG - Intergenic
1105404856 13:20125135-20125157 CTGTGTGCCTGGTGAACAGTAGG - Intergenic
1105829971 13:24155519-24155541 AAGTGGGACTGATGGGCAGTGGG + Intronic
1107399331 13:40053721-40053743 CTGTGGTGATGGTAGTCAGTTGG - Intergenic
1108103684 13:46985528-46985550 CTGTGGGAAACGTGGGCAGTAGG + Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110271207 13:73592763-73592785 TTGTGGGGGAGGTGGGCAGGTGG + Intergenic
1110557555 13:76877617-76877639 CAATGGGGGTGGTGGGGAGTGGG - Intergenic
1112024207 13:95397555-95397577 GTGTGGGGGTGGTGGGCGATTGG + Intergenic
1113545152 13:111143013-111143035 GTGTGGAGCTGGGTGGCAGTAGG + Intronic
1113671566 13:112178974-112178996 CTGTGAGGCTGTGGGGCAGTGGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115694404 14:35881232-35881254 CTGTATGCCTGGGGGGCAGTTGG - Intronic
1116149982 14:41128702-41128724 CTGGGGGGCTGGAGGGCTGGGGG - Intergenic
1116861746 14:50001122-50001144 CTGCAGGGCTGGTGGGCTCTGGG - Intronic
1118764209 14:68899299-68899321 CTGTGGGTGTGGTGTGCTGTGGG - Intronic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119216973 14:72876543-72876565 CTGTTTGGCTGGTTGGGAGTAGG - Intronic
1119320854 14:73729549-73729571 CTGTGGGGCTGCTGGGGATTGGG - Intronic
1119532686 14:75374036-75374058 CTGTGGGGCTGAGGGGCTGTGGG + Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121530524 14:94649575-94649597 TATTGGGGCAGGTGGGCAGTAGG + Intergenic
1122151031 14:99726344-99726366 CTCTGGGGCTGCTGGGCTGTGGG + Intronic
1122564809 14:102645590-102645612 CTTTGGGGCTGGGTGGCAGGTGG - Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122635831 14:103129214-103129236 CTGCAGGGCTGGAGCGCAGTGGG + Intronic
1122872073 14:104643386-104643408 CTGGGGGGCGGGTGGGTAGCAGG - Intergenic
1122950845 14:105043679-105043701 CCGTGGGGCTGGGGGGCTGGGGG + Intergenic
1123707340 15:22959786-22959808 CTGAGAGGCTGGTGGGGAGGGGG - Intronic
1123787220 15:23686271-23686293 CTGCGAGGGTAGTGGGCAGTGGG + Exonic
1124940600 15:34213999-34214021 CTCAGGGGCTGTTGGGAAGTGGG + Intergenic
1125429868 15:39582907-39582929 CTCTGGGGCTGGGGTGCAGCAGG - Intronic
1127499287 15:59541704-59541726 CTGGGGTGCTGCTGGGCACTGGG - Intergenic
1127499445 15:59542934-59542956 CTGGGGTGCTGCTGGGCATTGGG + Intergenic
1128372032 15:67047448-67047470 CTCTGGGGCTGTTGAGGAGTAGG + Intergenic
1129296772 15:74604167-74604189 CTGTGGGGCTGGAGGTGTGTGGG + Intronic
1129465278 15:75721364-75721386 CTGTGGGGAAGGTGGTCTGTGGG + Intergenic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130540398 15:84817482-84817504 CTGGGGCGCGGGTGGGCGGTCGG + Exonic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1131158620 15:90090284-90090306 GTGTGTGCCTGGTGGACAGTGGG - Intronic
1131513682 15:93063830-93063852 CTGTGGAGGTGGGGGTCAGTTGG + Intronic
1132099926 15:99015651-99015673 CTCAGGGGCTGGTGGGCTTTGGG - Intergenic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1132541237 16:510861-510883 TTCTGGGGCTGGCGGGCTGTTGG - Intronic
1132574108 16:656880-656902 CCGTGGGGCTGGTGGCCAGCTGG - Intronic
1132743988 16:1429140-1429162 CTGTGGGGTCGCTGGGCTGTGGG + Intergenic
1133232176 16:4372002-4372024 CTGTGGGGCTGGGGGGCTGCGGG + Intronic
1133789713 16:9000098-9000120 CTGGGGGGGTGGTGGGGAGTTGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134353595 16:13460895-13460917 CTGAGCGGCTGGTTGGCAGAAGG - Intergenic
1134443054 16:14310797-14310819 CCAGGGGGCTGGTGGGCAGCTGG - Intergenic
1135159429 16:20080593-20080615 GTGTGGGGATGGAGGGCATTTGG - Intergenic
1136153337 16:28366201-28366223 CAGTGGGGGTGGTGGGCCCTGGG - Intergenic
1136209749 16:28749066-28749088 CAGTGGGGGTGGTGGGCCCTGGG + Intergenic
1136248452 16:28988667-28988689 CTAGAGGGCTGGAGGGCAGTGGG - Intronic
1136297508 16:29312095-29312117 CTGTGGGGCTGCAGGGCCTTGGG - Intergenic
1136715662 16:32279303-32279325 CTGTGGGGCGGGTGCGTCGTGGG + Intergenic
1136752247 16:32650464-32650486 CTGTGGGGCGGGTGCGTCGTGGG - Intergenic
1136822344 16:33329998-33330020 CTGTGGGGCGGGTGCGTCGTGGG + Intergenic
1136828907 16:33386537-33386559 CTGTGGGGCGGGTGCGTCGTGGG + Intergenic
1136833973 16:33485319-33485341 CTGTGGGGCGGGTGCGTCGTGGG + Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137539625 16:49353319-49353341 ATGTGGGGCTGCTGGGCAAATGG + Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1139546268 16:67651221-67651243 ATGTGGAGCTGCTGGGCTGTGGG + Exonic
1140210971 16:72969952-72969974 CTCTGGGCCTTCTGGGCAGTGGG - Intronic
1140892780 16:79299026-79299048 TTGTGGTGCTGATGGGCACTGGG + Intergenic
1141569051 16:84923123-84923145 CTCTGGGGCTGATGGACAGCTGG - Intergenic
1141611958 16:85186953-85186975 CTGAGGGGCTGGTGGGAAAGAGG - Intergenic
1141799302 16:86296217-86296239 AGGTGGGGCTGGTGTGCTGTTGG + Intergenic
1142186575 16:88697689-88697711 CTGTGTGGGTGATGGGCAGAGGG - Intronic
1203010943 16_KI270728v1_random:239201-239223 CTGTGGGGCGGGTGCGTCGTGGG - Intergenic
1203054392 16_KI270728v1_random:910448-910470 CTGTGGGGCGGGTGCGTCGTGGG - Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142589724 17:997411-997433 CTGAGGGCCTGGACGGCAGTGGG + Intronic
1142858955 17:2749545-2749567 CTGGGAGGCTGCGGGGCAGTCGG + Intergenic
1142880366 17:2878770-2878792 CCGTGGGGCTCCTGGGCAGCAGG - Intronic
1143773555 17:9183244-9183266 GTGTTGGGCTGGCGGGCAGCTGG - Intronic
1144620714 17:16816765-16816787 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145147293 17:20492995-20493017 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1145367723 17:22278610-22278632 GTGTGGGGCTGGTGTCCACTGGG + Intergenic
1146208959 17:30927017-30927039 CTATGGGCCTGGTGCGCAGGTGG + Intronic
1146677115 17:34781329-34781351 CTCTGTGGCTTGTGGGCTGTTGG - Intergenic
1147163303 17:38579970-38579992 CTTTGGGGCTGGTGGATTGTGGG - Intronic
1147421657 17:40324866-40324888 CTGTGGGGTTGGTGGGGAAGAGG + Intronic
1147572104 17:41577663-41577685 CTGTGTGGCTAAAGGGCAGTGGG + Intergenic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147677925 17:42220110-42220132 CTGTGAGGCAGGCGGGCAGGAGG - Intronic
1147688123 17:42299462-42299484 CTGTGAGGCAGGCGGGCAGGAGG + Intronic
1148051707 17:44772834-44772856 CTGGGGGGTGGGTGGGCACTTGG - Intronic
1148105069 17:45114626-45114648 CAGTGGAGCTGGAGGGCCGTGGG - Intronic
1148241821 17:46004202-46004224 CTGTGGGGCTGTGGGGCTGCAGG + Intronic
1148343507 17:46888234-46888256 GTGTGGGTCAGGTGGGGAGTTGG + Intergenic
1148506041 17:48127882-48127904 CTGTGGGGCTGGCCAGCTGTCGG - Intergenic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1148784862 17:50141021-50141043 TTGGAGGGCTGGTGGACAGTGGG + Intronic
1148913671 17:50956893-50956915 CTGAGGGGCTGGTAGGCTCTGGG + Intergenic
1149085157 17:52708039-52708061 GTGTGGGGTTGGTGGGGAGGTGG + Intergenic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1150007472 17:61478793-61478815 AAGTGGGGCTGTGGGGCAGTGGG - Intronic
1150141494 17:62733548-62733570 CTGGTGGGCTGGTGGGCTGGTGG - Intronic
1150626091 17:66842089-66842111 GTGAGGGCATGGTGGGCAGTGGG - Intronic
1151375546 17:73686367-73686389 CTGGGGGCCTGTGGGGCAGTGGG - Intergenic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1151475569 17:74342837-74342859 CTCTGGGGCTGGAGGGCCCTGGG - Intronic
1151504911 17:74521389-74521411 CCCTGGGGCTGGTGGACTGTGGG + Exonic
1151730773 17:75910015-75910037 CTGTGGCGATGGTGGGGTGTGGG - Intronic
1151813927 17:76461732-76461754 CTGGGGGGCTGGATGGCTGTTGG + Intronic
1151919888 17:77146189-77146211 CAGTGGGGGTGGTAGGCAGTGGG + Intronic
1151930289 17:77227874-77227896 CTCTGCGGCTGGTGGGGAGAAGG + Intergenic
1151979103 17:77498500-77498522 CTGTGGGGGTGGGGGGCGGGCGG - Intronic
1152240633 17:79159109-79159131 CTCTGTGGCAGGTGGGTAGTGGG + Intronic
1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG + Intergenic
1152626057 17:81388449-81388471 CTGGAGGGCAGGTGGGCGGTGGG + Intergenic
1152739099 17:82011301-82011323 GGGTGGGGCTGGGGGGCAGCGGG + Intronic
1152911883 17:83009935-83009957 CTGTGGGGGAGGGGGGCTGTGGG + Intronic
1153009568 18:525760-525782 TTGTGGGGTTTGTGGGAAGTAGG + Intergenic
1153508879 18:5831466-5831488 CTGTGGGGCTGCGGGGCCCTGGG - Intergenic
1153514649 18:5892122-5892144 CTGAGCAGCTAGTGGGCAGTTGG - Exonic
1153820339 18:8826284-8826306 CTGTGGGGCAGGTTGGGACTTGG + Intronic
1154408074 18:14114662-14114684 GTGGGGGGTTGGTGGGAAGTGGG + Intronic
1154425091 18:14265882-14265904 GTGAGAGGGTGGTGGGCAGTAGG + Intergenic
1155268113 18:24113449-24113471 CTGTGGGGATAATGGGCACTTGG + Intronic
1155326875 18:24673138-24673160 CTGTGGTGGGGGTTGGCAGTGGG - Intergenic
1156407485 18:36796770-36796792 CTCTGGAGCTGGTAGGGAGTTGG + Intronic
1156492886 18:37506713-37506735 CCGTTGGGCTGATGTGCAGTGGG - Intronic
1156707029 18:39895376-39895398 TTTTGGGGTGGGTGGGCAGTGGG + Intergenic
1157422903 18:47560898-47560920 CTGGGGGGCTGGCGGGCACTGGG - Intergenic
1157578440 18:48759186-48759208 CTGTGCCCCTGCTGGGCAGTGGG - Intronic
1160431591 18:78816790-78816812 CTGTCAGCCTGGTGGGCAGAAGG - Intergenic
1160702316 19:513621-513643 ATGCTGGGCTGGTGTGCAGTAGG - Intronic
1160702324 19:513685-513707 ATGCTGGGCTGGTGTGCAGTAGG - Intronic
1160702328 19:513717-513739 ATGCTGGGCTGGTGTGCAGTAGG - Intronic
1160702332 19:513749-513771 ATGCTGGGCTGGTGTGCAGTAGG - Intronic
1160702336 19:513781-513803 ATGTGGGGCTGGTGTGCAGTAGG - Intronic
1160702342 19:513814-513836 ATGTGGGGCCAGTGTGCAGTAGG - Intronic
1160702377 19:514052-514074 ATGTGGGGCCAGTGTGCAGTGGG - Intronic
1160702430 19:514411-514433 ATGTGGGGCTGGTGTGCAATAGG - Intronic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160744251 19:703456-703478 TTGTGGGGCTGCAGGGCACTGGG + Intergenic
1160836297 19:1126343-1126365 CGGTGGGGCTGGCGGGCATTGGG + Intronic
1160838123 19:1134009-1134031 CTGTGGGTCCTGTGGGCTGTGGG - Intronic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1162525993 19:11206882-11206904 CTGTCAGGCTGGAGTGCAGTGGG + Intronic
1162955063 19:14092844-14092866 CTGAGGGGCTGGGGGGCTGTGGG + Exonic
1163186360 19:15641864-15641886 CTGCGGGGCTCTTGGGCAGGGGG + Intronic
1163218356 19:15897139-15897161 CTGCGGGGCTCCTGGGCAGAGGG - Intronic
1163256430 19:16158705-16158727 TTGAGGGCCTGGTGTGCAGTAGG + Intergenic
1163677677 19:18663433-18663455 TTTTGGGGCTGGCTGGCAGTGGG + Intronic
1164051248 19:21586983-21587005 CGCAGTGGCTGGTGGGCAGTGGG + Intergenic
1164608687 19:29617862-29617884 CTGTGTGGCAGCTGGGCACTGGG - Intergenic
1164974743 19:32563960-32563982 CTGTGGAGCTGGCGGGTTGTCGG - Intergenic
1165018058 19:32898401-32898423 GTGGGGGGCTGGGGGGCAGGTGG + Intronic
1165149103 19:33750572-33750594 CTGAGCGGCTGGTGGACACTGGG - Intronic
1165149782 19:33753763-33753785 GTGTGGGGATGGTGGGTGGTTGG - Intronic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165286191 19:34844353-34844375 CAGTGGGGGTGCTGGGCAGGGGG + Intergenic
1165350216 19:35271167-35271189 CTGTGAGGGTGGTGGTCAGGGGG - Intronic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1165364998 19:35359892-35359914 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165366817 19:35372361-35372383 CTGTGGAACTGGTGGCCAGGTGG + Exonic
1165766741 19:38356383-38356405 CGGAGGGGCTGGTGGGCATAAGG + Intronic
1166002391 19:39885606-39885628 CCGTGGGGCTGATGAACAGTGGG + Intronic
1166005174 19:39901858-39901880 CCGTGGGGCTGATGAGCAGTGGG + Intronic
1166406380 19:42524851-42524873 CTCTGGGGCTGCTCGGCTGTGGG - Intronic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167101897 19:47408825-47408847 CTGGGTGGATGGTGGGCAGGTGG + Intronic
1167268384 19:48494336-48494358 ATGAGGGCCTGGTGGGCTGTGGG - Intronic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1168073382 19:53964834-53964856 CTGTGAGGCTGGGGTGCAGGAGG - Intronic
1168241573 19:55091620-55091642 CTGTGGGGGCTGTGGGCAGAGGG - Intronic
925115051 2:1371583-1371605 CTGTGGGGATTGTGGGCATCGGG - Intergenic
925167590 2:1727682-1727704 CAGGGGGTCTGGTGGGCAGGGGG - Intronic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
926151558 2:10428424-10428446 ATGTGGGGCTGGTGGGGACGGGG - Intergenic
926334142 2:11850471-11850493 CTCGGGGGCTGGTGCACAGTAGG + Intergenic
926683090 2:15678661-15678683 CTGGGGGGCTGGGGGGCTGGAGG + Intergenic
927193995 2:20535286-20535308 AGCTGGGGCCGGTGGGCAGTGGG + Intergenic
927484179 2:23477584-23477606 CTAGGGAGCTGGTGGGCTGTTGG + Intronic
927594556 2:24385291-24385313 CTGGAGGGTTGGTGGGCAGAGGG - Intergenic
927709060 2:25314020-25314042 CTGGGGGGCTGCTGGGCTTTGGG + Exonic
928209423 2:29312531-29312553 CTGTTGGGCTGTGGGGCAGGAGG + Intronic
928622809 2:33108221-33108243 CTGGGGGGCTGTGGGGCAGAGGG + Intronic
929060062 2:37914561-37914583 CTGTGGGGCTTGTGAAGAGTTGG - Intergenic
929217019 2:39425100-39425122 CTGGGGGGGTGGTGGGGAGTGGG - Intronic
929450093 2:42030994-42031016 CTCTGGGTCTGCTGGGCACTGGG - Intergenic
930284904 2:49415398-49415420 ATGTGTGGATGGTGGGCAATTGG - Intergenic
931225616 2:60327128-60327150 CTGTTAGGCTTGTGGGGAGTGGG - Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932784659 2:74589615-74589637 GTGTGGTGCTGGCAGGCAGTGGG + Intronic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933649521 2:84839137-84839159 CTTTGGAGCTGGTGAGTAGTGGG - Exonic
933999131 2:87692107-87692129 TTGTGGGGCAGGTAAGCAGTAGG - Intergenic
934033226 2:88066432-88066454 CGGCGGGGGTGGGGGGCAGTGGG - Intergenic
934492474 2:94771057-94771079 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
934730291 2:96652203-96652225 CTGAGGAGCTGGTGGGCTGGTGG + Intergenic
934778091 2:96951466-96951488 CTGTTGGGCTGGCGGGGAGCTGG + Exonic
934884713 2:98014459-98014481 CTGGTGGGCTGGTGGGTGGTGGG - Intergenic
934884748 2:98014565-98014587 CTGGTGGGCTGGTGGGCCGGTGG - Intergenic
934884798 2:98014718-98014740 CTGCTGGGCTGGTGGGCTGGTGG - Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935719582 2:105968140-105968162 CTGCCTGGCTGGTGGGCAGTCGG - Intergenic
936294713 2:111258784-111258806 TTGTGGGGCAGGTAAGCAGTAGG + Intergenic
936444652 2:112586137-112586159 CAGTGTGGGGGGTGGGCAGTGGG + Intronic
936755394 2:115703536-115703558 CTGTCGGGCAGGTTGGCAGTTGG + Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938103055 2:128511483-128511505 CTCTGGGGCCTGTGGGAAGTGGG + Intergenic
939548284 2:143581376-143581398 CTGTGGGGCTATGGGGCTGTGGG - Intronic
941318177 2:164020670-164020692 CTGGTGGGCTGGTGGGCTGGTGG + Intergenic
943365980 2:186967872-186967894 TTGTGTGGATGGTGGGCAGCAGG + Intergenic
944095384 2:195961392-195961414 GGGTGGGGCTGGTGGGTAGTGGG - Intronic
944614656 2:201448220-201448242 CTGTGGGGCTGGTACACAGTAGG + Intronic
945030609 2:205660063-205660085 CTGTGGGGCTGGGCAGCAGGTGG + Intergenic
946401783 2:219472173-219472195 CTGTGGGGCTGTTGGGCCCTTGG + Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948892769 2:240915374-240915396 CCCAGGGGCTGGTGGCCAGTTGG + Intergenic
949007553 2:241658305-241658327 TGGTGGGGCAGGGGGGCAGTGGG + Intronic
949040963 2:241849839-241849861 CTGTGGGGGCAGTGGGCAGGAGG - Intergenic
1169812297 20:9620468-9620490 GTCTGGGGCTGATGGGCAGTTGG + Intronic
1171175398 20:23048297-23048319 CTGTGCGGCTCGTGGGGAATGGG + Exonic
1171199801 20:23231849-23231871 CTCCGGGGCTGGTTGGGAGTTGG - Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171884085 20:30639245-30639267 GTGAGAGGGTGGTGGGCAGTAGG - Intergenic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1173126936 20:40345830-40345852 CTGTGGTGCTGGTGGCCATGAGG + Intergenic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1175281425 20:57806607-57806629 CGGTGGGGCTGGTGGGCTCAGGG - Intergenic
1176104463 20:63379400-63379422 CTGTGGAGCTGGTGGGAGCTGGG + Intergenic
1176139366 20:63538293-63538315 CTCAGGGGCTGGGGGGCAGGCGG - Intergenic
1176147776 20:63573084-63573106 CCGCGGGGCTGTTGGGCAGCAGG + Intronic
1176371844 21:6067068-6067090 GGGTGGAGCTGGTCGGCAGTGGG + Intergenic
1176924200 21:14727107-14727129 CTCTGGGGGTTGTGGGGAGTGGG - Intergenic
1178450689 21:32696720-32696742 CTGAGGGGCTGGCAGGGAGTTGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179607570 21:42527211-42527233 CTGTTGGGCTGGGGGGCTGTTGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179751675 21:43471471-43471493 GGGTGGAGCTGGTCGGCAGTGGG - Intergenic
1179902276 21:44400399-44400421 CTGTGGGGCTGCGGGGCTGCGGG + Intronic
1180959956 22:19758089-19758111 CTGGGGGGCTGGGCGCCAGTGGG - Intronic
1181009715 22:20033104-20033126 GTTGGGGGCCGGTGGGCAGTGGG + Intronic
1181022252 22:20109634-20109656 CTGTGGGGCTCAAGGGCAGCAGG + Intronic
1181672079 22:24430375-24430397 CACTGAGGCTGGTGGGCAGCAGG + Intronic
1182290794 22:29278041-29278063 CTGTATGCCTGGGGGGCAGTTGG - Exonic
1182552175 22:31106445-31106467 CTGTGGGGCTGGGCCGCAGGTGG - Intronic
1183142950 22:35961547-35961569 CTGTGAGGTTGGTGGGGAGTTGG - Intronic
1183320909 22:37164483-37164505 TGGTGGGGGTGGTGGGCAGGGGG + Intronic
1183416807 22:37687260-37687282 CTGTGGGGCGGGTGGGGGGGGGG - Intronic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1184132183 22:42523433-42523455 CTCCCGGGCTGGTGTGCAGTGGG + Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184595247 22:45509877-45509899 CTGTGGGGCAGGTGGGGTGGGGG + Intronic
1184648009 22:45906571-45906593 CTGATGGGCTGGTGGGCTGGTGG + Intergenic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
1184781716 22:46652928-46652950 ATGTGTCGCTGGTGGGCAGGAGG + Intronic
1185040899 22:48503882-48503904 CTGTGGTGCTGGTGTGTCGTGGG - Intronic
1185248978 22:49789687-49789709 CTGTGGAGAAGGTGGGCTGTAGG - Intronic
1185337856 22:50278744-50278766 ATATGGGAGTGGTGGGCAGTGGG - Intronic
949117046 3:339116-339138 CAGTGGTGCTGTTGGGTAGTTGG - Intronic
949281558 3:2352778-2352800 GTGCGGGACTGGTGGGCAGCAGG + Intronic
949797775 3:7869588-7869610 CCATGTGGCTGGTGTGCAGTGGG - Intergenic
949891747 3:8738360-8738382 TTGTAGGGCTGGTGGGCATCTGG - Intronic
950183704 3:10932426-10932448 GAGTGGGGCTGGTGCACAGTAGG - Intronic
950579304 3:13852238-13852260 CTCTGGGGCTTGTTGGCAGCTGG - Intronic
952341926 3:32454350-32454372 CTGTCAGGCTGGTGGGCACCAGG + Exonic
952764233 3:36941348-36941370 CTGTGAGCCTGGTGGGCTGGTGG - Intronic
952924979 3:38314058-38314080 CTGTGGGGTGGGTGGGCTATAGG - Intronic
952959616 3:38581114-38581136 CTCTGGGGGTGGCGGGGAGTAGG + Exonic
953849485 3:46455071-46455093 CCGTGGGGCTGGTGAGAAGTTGG + Intronic
954070817 3:48141645-48141667 CTGACCGGGTGGTGGGCAGTGGG + Intergenic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
955753296 3:62203817-62203839 CTGTGGCGGTGGGGGGCACTTGG - Exonic
956791121 3:72680841-72680863 CCGTGGGGCTGGCAGGAAGTGGG - Intergenic
957073142 3:75581087-75581109 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
958531038 3:95330370-95330392 CTGGGGGGCAAGTGGGAAGTGGG - Intergenic
960373878 3:116874640-116874662 ATGAGGGGCTGGAGGGCAGGAGG + Intronic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
961113460 3:124305680-124305702 CTGTGGAGCTGTGGGGGAGTGGG + Intronic
961260147 3:125595522-125595544 CTGTGGGGCTGTGGGGCTGTGGG - Intergenic
961260150 3:125595530-125595552 CTGTGGGGCTGTGGGGCTGTGGG - Intergenic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961616160 3:128182853-128182875 CTCTGTGGCTGGTGGGAAGCAGG - Intronic
961817110 3:129556779-129556801 CTGTGGGGGCCGTGGGGAGTTGG - Intronic
961823417 3:129586720-129586742 CTGTGGGGGTAGTGGGCATCAGG + Intronic
961867749 3:129966395-129966417 CTGTGGGGCTGGCGTGGAGCTGG - Intergenic
961873454 3:130003892-130003914 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
962079086 3:132117822-132117844 GGGAGGGGCTGGTGGACAGTGGG + Intronic
962398912 3:135040477-135040499 CCCTGGGGCTGGGGGGCATTTGG + Intronic
962844224 3:139260943-139260965 CTGTGGGGCTGTTTGGGAGTAGG + Intronic
964623990 3:158741369-158741391 CTGAGAGTCTGGTGGGCTGTGGG - Intronic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
966716918 3:183021970-183021992 TTGTGGGGAAGGTGGACAGTAGG - Intronic
968041881 3:195595847-195595869 CTGGGGGGGTGTTGGGGAGTGGG - Intergenic
968156876 3:196388297-196388319 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968579537 4:1383503-1383525 CTGTGGGGGTGTGGGGCGGTGGG + Intronic
968648002 4:1749451-1749473 GTGAGGGGCTGGTGGGGAGGGGG - Intergenic
968699023 4:2046099-2046121 CTGGAGTGCAGGTGGGCAGTGGG - Intergenic
968937855 4:3622548-3622570 ATGTGGGGCTGGGGGGCTGGTGG - Intergenic
969275003 4:6128908-6128930 GTGTGGGGGTTCTGGGCAGTGGG - Intronic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
969701241 4:8768915-8768937 CTGTGGTGCTGGTGGCCTGCAGG - Intergenic
970322996 4:14893964-14893986 ATGTGGGGCAGGTCGACAGTGGG + Intergenic
970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG + Intergenic
971363630 4:25958933-25958955 CTGAGGGGCTGATGGGGTGTAGG + Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972296623 4:37745479-37745501 CAGTGGGGCTGGTGGGCAACTGG - Intergenic
975142395 4:70931769-70931791 CTCTGAGGCTGGAGTGCAGTGGG + Intronic
975528693 4:75378338-75378360 CATTGGGACTGGTTGGCAGTGGG + Intergenic
975992159 4:80268251-80268273 CTGTGGGGCTTTTGCTCAGTAGG + Intronic
976389101 4:84491665-84491687 CCCTGGGGTTGGGGGGCAGTTGG - Intergenic
976408094 4:84682017-84682039 ATGTGGGGCTGGGGTGCAGCAGG + Intronic
976628083 4:87208094-87208116 CTCTGGGGCTGGTGGTCTGGTGG - Intronic
976869207 4:89770019-89770041 ACATGGGGCTGGTAGGCAGTGGG - Intronic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
980156760 4:129117384-129117406 CTATGGGGCTGGGGGACAGTGGG - Intergenic
981104448 4:140864622-140864644 CTGTGGGACTGGGGGACACTGGG + Exonic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981996203 4:150977778-150977800 CTGTGGTGGTGGTGGCTAGTGGG + Intronic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
983743445 4:171164830-171164852 TTGTGGGGGTGGTGGGCAAGCGG + Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
985495013 5:199469-199491 GTGTGGGGCTGATGGATAGTGGG - Exonic
985627400 5:996497-996519 CTGTGTGGCTGGTGGGCATGTGG + Intergenic
985640792 5:1062673-1062695 CTGGGGGGCTGGGGGGCTGGGGG + Intronic
985664961 5:1177263-1177285 GCTTGGCGCTGGTGGGCAGTGGG - Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986715394 5:10520097-10520119 CCATGGGGCTGCTGGGCAGGAGG - Intronic
989076789 5:37572340-37572362 CTGTGGGGCCCCTGGGAAGTTGG + Intronic
992014927 5:72565927-72565949 CTGTGGGGGTGATGGCGAGTAGG + Intergenic
992069468 5:73136034-73136056 CTGTGGGGGTGGTGGGCCTGAGG + Intergenic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995655206 5:114418568-114418590 AAGTGGGGCTGGCGGGGAGTTGG + Intronic
996357674 5:122614999-122615021 CTGTGGGGGTGGTGGGGGGTGGG - Intergenic
996798462 5:127376519-127376541 CAGGGGTGCTGGTGGGCAATGGG + Intronic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997579889 5:135010621-135010643 CTGAAGTGCTGATGGGCAGTGGG + Intronic
997777472 5:136624115-136624137 GTGTGGTGGTGGTGGGCAGTGGG - Intergenic
998163285 5:139825679-139825701 GTGTGGGGGTGGTGGTGAGTGGG + Intronic
998386517 5:141760225-141760247 CTGTGGGGCAGGGGGCCGGTGGG + Intergenic
998859451 5:146428391-146428413 CTGTGTGGATGATGGACAGTAGG + Intergenic
999590862 5:153143760-153143782 CTGTGGTGGTGGTGGCAAGTTGG - Intergenic
1000097408 5:157984091-157984113 TTGAGTGGCTGGTGGCCAGTTGG + Intergenic
1000325627 5:160169932-160169954 CTGTCTGTCTGGTGGGCACTGGG - Intergenic
1001440571 5:171739727-171739749 TTGTGGGGCTGGGGTGGAGTGGG - Intergenic
1001492511 5:172165494-172165516 CCCTGGGGCTGGGGAGCAGTGGG + Intronic
1001673122 5:173490927-173490949 CAGTGGAGCAGGTGGGGAGTGGG + Intergenic
1001797475 5:174514310-174514332 CGCTGGGGCTGGTGGTCAGGGGG - Intergenic
1002105718 5:176878684-176878706 TTTGGGGGCTGGTGGGGAGTTGG - Intronic
1002202275 5:177536584-177536606 CTGCCGGGGTGGTGGGCAGCAGG + Exonic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002450631 5:179316478-179316500 CTGTGGGGCTGGGGAGCCCTAGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002945791 6:1759885-1759907 GTGGGGGGCTGGGGCGCAGTAGG - Intronic
1003488213 6:6597639-6597661 CTGTGGGATTCGTGTGCAGTAGG + Intronic
1003504956 6:6733430-6733452 AGGTGGGACTGGTTGGCAGTGGG - Intergenic
1005135901 6:22569847-22569869 CTCTGAGGCTAATGGGCAGTCGG - Exonic
1005501026 6:26429384-26429406 CTGTGGTGCTTATGGGCAGAGGG - Intergenic
1005505606 6:26466687-26466709 CTGTGGTGCTTATGGGCAGAGGG - Intronic
1006378311 6:33683927-33683949 CTGTGGGGCTGTTTGGCGTTTGG + Intronic
1006430442 6:33992709-33992731 GTCTGGGGCTGATGGGCAGCTGG - Intergenic
1006474989 6:34247751-34247773 CTGTTGGCCTGGGGGGCATTGGG + Exonic
1006886726 6:37388225-37388247 CTGTGGGACTGATGTGCTGTGGG + Intronic
1007169060 6:39849770-39849792 GTGTGGTGTAGGTGGGCAGTGGG + Intronic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007416393 6:41693886-41693908 GTGTGCGTGTGGTGGGCAGTGGG - Intronic
1007577880 6:42937879-42937901 GTGAGGGGCTGGTGGGGATTGGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008267389 6:49445505-49445527 CTGTGGATAGGGTGGGCAGTGGG - Intronic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1010175621 6:73024869-73024891 CTGGTGGGAAGGTGGGCAGTGGG - Intronic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1012638788 6:101582224-101582246 CTGTTGGCCTGTTGGGGAGTAGG - Intronic
1013468504 6:110439104-110439126 GTTTGGGGCTGGTGGGAATTTGG - Intronic
1013633018 6:112003185-112003207 CTGTGGGGCAGGTGGTAAGCTGG + Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1014852802 6:126362087-126362109 GGGAGGGGCTGGTGGGCAGGAGG + Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015206877 6:130650334-130650356 ATCTGGGGCTAGGGGGCAGTGGG - Intergenic
1015505603 6:133983539-133983561 CTGAACGGCTGGTGGGGAGTGGG + Intronic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1016840449 6:148519713-148519735 CTGGGGGGCTGGCCGGAAGTTGG + Exonic
1017024816 6:150172460-150172482 CTGTGGTGCAGGTGGGGAGGCGG + Intronic
1017677547 6:156829330-156829352 CTGTGGGCCTGGAGGGCCATAGG - Exonic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018862249 6:167719647-167719669 CTGTTGGGGTGGTGGGCAAGAGG + Intergenic
1018880092 6:167869165-167869187 CTGATGGGGTGCTGGGCAGTGGG + Intronic
1018923898 6:168193762-168193784 ATATGGGCCTGGTGGGCAGGAGG + Intergenic
1019015612 6:168877743-168877765 CTGCGGGGGTCGTGGGCACTGGG + Intergenic
1019140114 6:169937644-169937666 ATGTGGGGCCGGCGGGCAGGTGG - Intergenic
1019173758 6:170149381-170149403 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019173847 6:170149846-170149868 CTGGAGGGGTGGTGGGCAGCTGG - Intergenic
1019191692 6:170254871-170254893 CTGTGGGCCTGGTGGGCACCAGG + Intergenic
1019314637 7:378914-378936 CTGCGGGGCTGTTGGGCGGGAGG - Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1020212070 7:6165069-6165091 CTCTGGGGCTGGTGGGAAAGGGG - Intronic
1020250732 7:6466355-6466377 CTGAGCTCCTGGTGGGCAGTGGG - Intronic
1020438321 7:8189697-8189719 CCGAGGGGCAGGTGGGCAGCTGG + Intronic
1020800203 7:12723689-12723711 CTGAGTGGCTGATGGGCAGAAGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022405872 7:30089341-30089363 CTGTGGGGGTGGTCTGGAGTGGG - Intronic
1022515871 7:30974690-30974712 CTGTGGGGCTGGGGGAAGGTGGG + Intronic
1022522882 7:31019341-31019363 CTGTGGCTGTGGTGGGCTGTGGG - Intergenic
1026447525 7:70498575-70498597 GTGGGGGGTTGGTGGGCAGAAGG + Intronic
1026853374 7:73738280-73738302 CTTTGGGGCTGGGCGGGAGTGGG - Intronic
1028057332 7:86262538-86262560 CTGGGGGCTAGGTGGGCAGTGGG - Intergenic
1028234792 7:88347604-88347626 CTGAGGGTCTGGTGGTAAGTTGG + Intergenic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029436856 7:100568494-100568516 GTGTGGGGCGGGGGGGCCGTGGG - Intergenic
1029491087 7:100870475-100870497 CTGTGGGGTGGGTGGGACGTGGG + Intronic
1029567331 7:101347778-101347800 CTGGAGGGCTGGGTGGCAGTGGG - Intergenic
1030167049 7:106565685-106565707 ATGTGGAGCTGGTGGCAAGTTGG - Intergenic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1033529181 7:142245773-142245795 CCCTGGGGCAGGTGGGCAGGAGG + Intergenic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034291234 7:149933254-149933276 CTATGGGGATGGTGGGGAGATGG - Intergenic
1034408498 7:150922767-150922789 TTGCGAGGCTGGTGGGAAGTTGG + Intergenic
1034536673 7:151729705-151729727 CTGCGGGGCTGGACGGCAGCAGG - Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034814864 7:154163677-154163699 CTATGGGGATGGTGGGGAGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035062645 7:156080313-156080335 TTGTGGGGCTGCTGGGAAGCTGG - Intergenic
1035906185 8:3512516-3512538 CTGGTGGGCTGGTGGGCTGGTGG + Intronic
1036242306 8:7091197-7091219 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036259543 8:7228959-7228981 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036307080 8:7610565-7610587 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036311587 8:7687529-7687551 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036357926 8:8058552-8058574 CTGTGGGGCTGGAGCGTGGTGGG - Intergenic
1036830433 8:12015933-12015955 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036891965 8:12602258-12602280 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1036893021 8:12608394-12608416 CTGTGGGGCTGGAGCGTGGTGGG + Intergenic
1037581732 8:20249529-20249551 CTGCAGGGCTGGTGAGCACTGGG + Exonic
1037656535 8:20888575-20888597 CTGTGGGGCGGTGGGGGAGTGGG + Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037960368 8:23093017-23093039 CTCTGGGGAAGGTGGACAGTGGG - Intronic
1037993681 8:23338358-23338380 CTGCTGGGCTGGTGGCCACTCGG - Intronic
1038131406 8:24735991-24736013 CAGTGGGGCAGGTGGGTAGAAGG + Intergenic
1038256751 8:25957478-25957500 CAGTGGGGATGGGAGGCAGTGGG - Intronic
1038955891 8:32468168-32468190 CTGTGGGGGTGATGGGGACTGGG + Intronic
1039448271 8:37649649-37649671 TGGTGGGGCTGGGAGGCAGTGGG - Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039961903 8:42254832-42254854 CTGTGGGGCGGCCGGGCAGAGGG - Intergenic
1041079461 8:54202592-54202614 CTGAGGGGCTGGGGAGGAGTAGG + Intergenic
1042179117 8:66067196-66067218 ATGTGGGGGTGGGGGGCGGTGGG - Intronic
1042200253 8:66274560-66274582 CTGTGAGGCAGGTGGGATGTGGG - Intergenic
1042485125 8:69339334-69339356 CTGAGGGGCTGCTGAGCAGGTGG - Intergenic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1043715791 8:83484547-83484569 CTTTGGGTCTGGTGGGGACTTGG + Intergenic
1044615014 8:94130960-94130982 CTGTGTGCCTGGTAGACAGTCGG + Exonic
1044892935 8:96856308-96856330 CTGTGGAGACAGTGGGCAGTGGG + Intronic
1046255653 8:111693874-111693896 CAGTGGGGCTGCTGTGCTGTAGG + Intergenic
1046454538 8:114440901-114440923 GGGAGGGGCTGGTGGGCAGAAGG - Intergenic
1047768842 8:128014031-128014053 CTGTTGTTCTGGTGAGCAGTGGG + Intergenic
1048031807 8:130640206-130640228 AGGTGGGGCTGGTGGGCAGGAGG + Intergenic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048898910 8:139019730-139019752 CTGTGACGGTGGTGGGCTGTGGG - Intergenic
1049252640 8:141597375-141597397 CTTTAGGGCCGGTGCGCAGTAGG + Intergenic
1049300425 8:141866753-141866775 CTGTGGGGCAGGTGAGCAGCAGG + Intergenic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049441365 8:142611271-142611293 CTGTGGGGCTGGCAGGGTGTGGG + Exonic
1049453662 8:142676147-142676169 CAGTGGGGTGGGTGGGCAGAAGG + Intronic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1049577037 8:143394250-143394272 CTGTGGGGCCAGGGGGCTGTGGG + Intergenic
1049598788 8:143497694-143497716 CTGTGGGGCTGCTGGCCGGCAGG - Intronic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049758901 8:144323012-144323034 CAGAGAGGCTGCTGGGCAGTTGG - Intronic
1049796543 8:144499736-144499758 CTGAGGGGCTGCTGAGCTGTGGG - Intronic
1049846159 8:144802809-144802831 CTGGGGGGCTGGAGGGCCTTAGG + Intronic
1050130366 9:2406348-2406370 CCGTGGAGCTGGTGGGAGGTGGG + Intergenic
1050437756 9:5628582-5628604 CTGTGGCTGTGGTGGGCGGTAGG - Intergenic
1051201641 9:14633355-14633377 CAGTGGGAATGTTGGGCAGTAGG - Intronic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1052331494 9:27274220-27274242 CAGTGGGGCTTGTTAGCAGTGGG + Intergenic
1052342917 9:27380766-27380788 ATGAGGGGGTGGTGGGCAGGTGG - Intronic
1052878451 9:33584889-33584911 GTGTGAGGGTGGTGGGTAGTAGG + Intergenic
1053497530 9:38559320-38559342 GTGTGAGGGTGGTGGGTAGTAGG - Intronic
1053582920 9:39425757-39425779 CACTGGGGCTTGTTGGCAGTGGG + Intergenic
1054104499 9:60984500-60984522 CACTGGGGCTTGTTGGCAGTGGG + Intergenic
1055338123 9:75253617-75253639 GTGGGGGGCTGGTGGGGAGGTGG - Intergenic
1056757388 9:89390362-89390384 CTGCGGGGCTGCGGGGCAGCTGG + Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1056964058 9:91151702-91151724 GTGTGCAGATGGTGGGCAGTGGG - Intergenic
1057129604 9:92644390-92644412 CTCTGTGGCTGCTGGGCAGCTGG - Intronic
1057141670 9:92730091-92730113 ATGTGGGGGTAGTGGGCAGTGGG - Intronic
1057161150 9:92889294-92889316 GTGGGAGGCTGGTGGGTAGTAGG - Intergenic
1057161974 9:92895333-92895355 ATGTGGGGCTGCCGGGCAGCTGG + Intergenic
1057676579 9:97140709-97140731 GTGAGAGGCTGGTGGGTAGTAGG - Intergenic
1057677005 9:97143802-97143824 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1059487724 9:114639678-114639700 CTTTTGTGCTGGTGGGCAGTAGG + Intronic
1060104347 9:120864101-120864123 CTGGGGTGCTGGTGAGCTGTGGG + Exonic
1060495369 9:124114665-124114687 CTGGGTGGGTGGGGGGCAGTTGG - Intergenic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1061223266 9:129264811-129264833 TGGTGGGGGTGGTGGGGAGTTGG + Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061371680 9:130201023-130201045 CTGTGGGCTTTGTGGGCTGTGGG + Intronic
1061541917 9:131282088-131282110 CTGTGGGGTGTGTGTGCAGTGGG + Intergenic
1061592229 9:131605064-131605086 CTCTGAGACTGGTGGGCAGGTGG + Intronic
1061636332 9:131911946-131911968 CTGTGGGGCAGCAGGGAAGTTGG - Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061876384 9:133546227-133546249 CTGCAGGGGTGGTGGGGAGTGGG + Intronic
1061990846 9:134157735-134157757 CTGTGTCGAAGGTGGGCAGTGGG + Intronic
1062050941 9:134446717-134446739 CTGGGGGGCTGGGGGGCTGCTGG + Intergenic
1062212714 9:135373233-135373255 GGGTGGGGCTGGCGGGCAATGGG + Intergenic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062532777 9:137009165-137009187 CTGTGGGGTTGGGGGGCTGTGGG - Intronic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187388769 X:18872254-18872276 CTGTAGCACTGGTAGGCAGTGGG - Intergenic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1188265290 X:28066010-28066032 CTGTGGGGCGTGTGGTCAGCAGG - Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189630629 X:42948857-42948879 CTGCGTGGATGGGGGGCAGTCGG + Intergenic
1189706089 X:43760336-43760358 CGGTGGGGCTGGTGGCCTTTGGG - Intergenic
1190056093 X:47181820-47181842 CAGTGGGGCTGGTAGCCGGTGGG - Exonic
1190139573 X:47830822-47830844 ATGGGGGGCTGGTGGGGAGGTGG + Intergenic
1190396861 X:49993851-49993873 CTGTGGGGCAGCTGGGAAGCAGG + Intronic
1190760065 X:53431559-53431581 CTGGGAGGCTGGTCAGCAGTGGG + Exonic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192428987 X:71100147-71100169 ACCTGGGGCTGGTGGGCACTGGG - Intronic
1193440836 X:81537799-81537821 CGGAGGGGCTGGTGAGCAATAGG + Intergenic
1195160115 X:102162586-102162608 ATGTGGGGCAGTTGGGCACTGGG + Intergenic
1195706739 X:107742918-107742940 CTGTGGGGCTGGCAGCCTGTGGG - Intronic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1198119628 X:133579297-133579319 CTTGGGGGGTGGTGGGCAATGGG - Intronic
1198684308 X:139211572-139211594 CTGTGGGGGTGGGGGGTAGCGGG - Intronic
1198841076 X:140858837-140858859 CTGTGGTGGTGGTGGCCATTGGG + Intergenic
1199179391 X:144835774-144835796 GTGGTGGGCTGGTGGGGAGTTGG + Intergenic
1199950716 X:152703740-152703762 ATTTGGGGCTGGTGTGCACTGGG + Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200149679 X:153944957-153944979 CTGTGGGGCAGGGGTGCAGCAGG + Intergenic
1201587347 Y:15575644-15575666 CTGTGTGGCAAGTGGGCAGCTGG - Intergenic