ID: 1019652026

View in Genome Browser
Species Human (GRCh38)
Location 7:2165040-2165062
Sequence GTGGGCAATACAAATACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019652021_1019652026 5 Left 1019652021 7:2165012-2165034 CCTGAGCACAGATTCAACGAAAC 0: 1
1: 0
2: 1
3: 0
4: 89
Right 1019652026 7:2165040-2165062 GTGGGCAATACAAATACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019652026 Original CRISPR GTGGGCAATACAAATACGGC TGG Intronic
No off target data available for this crispr