ID: 1019655516

View in Genome Browser
Species Human (GRCh38)
Location 7:2192611-2192633
Sequence CTGTGGAGAATCAGTTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 157}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019655516_1019655524 20 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655524 7:2192654-2192676 TCTAAGGAAGGGCGGGGAGAAGG No data
1019655516_1019655520 9 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655520 7:2192643-2192665 TTTTAAAAAATTCTAAGGAAGGG 0: 1
1: 10
2: 9
3: 135
4: 1313
1019655516_1019655526 24 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655526 7:2192658-2192680 AGGAAGGGCGGGGAGAAGGGTGG 0: 1
1: 0
2: 50
3: 870
4: 7645
1019655516_1019655522 13 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655522 7:2192647-2192669 AAAAAATTCTAAGGAAGGGCGGG 0: 1
1: 0
2: 2
3: 54
4: 574
1019655516_1019655525 21 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655525 7:2192655-2192677 CTAAGGAAGGGCGGGGAGAAGGG No data
1019655516_1019655521 12 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655521 7:2192646-2192668 TAAAAAATTCTAAGGAAGGGCGG No data
1019655516_1019655523 14 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655523 7:2192648-2192670 AAAAATTCTAAGGAAGGGCGGGG No data
1019655516_1019655518 4 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655518 7:2192638-2192660 AAGTTTTTTAAAAAATTCTAAGG No data
1019655516_1019655519 8 Left 1019655516 7:2192611-2192633 CCTAGGGAACTGATTCTCCACAG 0: 1
1: 0
2: 1
3: 28
4: 157
Right 1019655519 7:2192642-2192664 TTTTTAAAAAATTCTAAGGAAGG 0: 1
1: 1
2: 20
3: 163
4: 1485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019655516 Original CRISPR CTGTGGAGAATCAGTTCCCT AGG (reversed) Intronic
901088846 1:6628375-6628397 CTGTGGACATTCAGTCCTCTCGG - Intronic
901374272 1:8826334-8826356 CTTTGGGGAAGCAGCTCCCTGGG - Intergenic
901860236 1:12069753-12069775 CTGTGGAATGTCAGTTCCGTGGG - Intronic
902220075 1:14959027-14959049 CTGTGGATAAACAGATCCATAGG + Intronic
903520417 1:23943297-23943319 ATGTGCAGAAGCATTTCCCTGGG - Intergenic
905227551 1:36489081-36489103 CTCTGGAGCACCAGTCCCCTGGG - Intergenic
907256355 1:53181975-53181997 CTGTGGAAAATCAGTTAGGTTGG - Intergenic
907901048 1:58741712-58741734 CTGTGGAGACTCTGTGCCTTTGG + Intergenic
908175848 1:61554354-61554376 CCTTGGAGGATCAGTTTCCTAGG + Intergenic
908479496 1:64523786-64523808 CTGTGGAGAATCTGCTCACTTGG + Intronic
909600589 1:77457277-77457299 ATGTGGAGACGCAGGTCCCTCGG + Intronic
910921472 1:92352373-92352395 CTCTGGAGAGTCACTTCCCTAGG + Intronic
911912137 1:103650417-103650439 CTGGGGAGAATCAGCTGCCTGGG + Intergenic
911916317 1:103701531-103701553 CTGGGGAGAATCAGCTGCCTGGG - Intronic
911919552 1:103744555-103744577 CTGGGGAGAATCAGCTGCCTGGG + Intronic
915774217 1:158465214-158465236 CTTTGGAGAGTGAGTTGCCTTGG + Intergenic
915843177 1:159233414-159233436 ATGTGGAGAAGCATTTCTCTGGG - Intergenic
917808181 1:178632986-178633008 CTTTGGAGAAACAGTTCTCCTGG + Intergenic
923105182 1:230848942-230848964 CTGGGTAGAATGAGGTCCCTGGG - Intronic
923558334 1:235019561-235019583 GTGTGGTGAATCAGTTTCCTTGG + Intergenic
1063588580 10:7374876-7374898 CTTTGGAGAATCAGCTCCTTGGG - Intronic
1063791296 10:9451204-9451226 ATGTGGAGAAGCATTTCCCTGGG + Intergenic
1066490659 10:35890912-35890934 TTGTGGAGAATGAGGTCTCTGGG + Intergenic
1073010521 10:100355754-100355776 ATGTAGGGAATCAGTGCCCTTGG + Intronic
1074686183 10:115964378-115964400 CCCTGGAGAGGCAGTTCCCTGGG - Intergenic
1076381716 10:130028253-130028275 CTGTGTAGAATCAGTAGCCCTGG + Intergenic
1079684379 11:23339037-23339059 CTAGGTAGAATCAGTTACCTGGG - Intergenic
1081215597 11:40393163-40393185 CTGTGCATAATCAGTTCAATAGG + Intronic
1083069641 11:59963969-59963991 CTGTGGAGGCCCACTTCCCTAGG + Intergenic
1084227884 11:67728748-67728770 GTGTAGGGAATCGGTTCCCTTGG + Intergenic
1084277916 11:68065024-68065046 GTGTGGAGAATCAGTTCTCATGG - Intronic
1084686786 11:70700786-70700808 CTGTGGAGGCTCAGTACCCTGGG - Intronic
1085463746 11:76710492-76710514 CTGTGGAGGGCCAGGTCCCTGGG + Intergenic
1085917849 11:80912341-80912363 ATGTGGAGAGACAGTTACCTGGG + Intergenic
1086838332 11:91653579-91653601 CTGTGGAGAATCTGTGTGCTTGG - Intergenic
1090250617 11:125248378-125248400 CTGTAGAGTATCAGTGTCCTGGG - Intronic
1090627248 11:128617960-128617982 CTGTGGAGGATCAGTCACGTTGG - Intergenic
1093756700 12:22860851-22860873 CTGTGGAAAATCAGGACTCTAGG - Intergenic
1097789015 12:63794298-63794320 CTGTGGAGAAACCATTTCCTTGG - Intronic
1098474855 12:70888777-70888799 CTGTGGAGAAGCAGATGTCTAGG - Intronic
1104047698 12:125174634-125174656 CTTTGGAGAATCACCTCCCTCGG - Intergenic
1104728098 12:131089869-131089891 CTCTGGAGCATCAGCTGCCTGGG + Intronic
1107949117 13:45446062-45446084 CTGTTAAGATTCGGTTCCCTGGG - Intergenic
1116336644 14:43665764-43665786 CAGTGCAGACTCAGTTCCCTGGG + Intergenic
1117541093 14:56747261-56747283 CTGTGGAGACGCAGTGCCTTTGG - Intergenic
1119099946 14:71870626-71870648 CTTTGGAAAATCATTTCCCCAGG - Intergenic
1121123152 14:91389004-91389026 CTGAGCAGAATCAGGACCCTCGG - Intronic
1121649815 14:95549680-95549702 CAGGGGAGAATCCGTTTCCTTGG - Intergenic
1121774909 14:96584223-96584245 CTGAGGAGACTGAGTTCTCTGGG - Intergenic
1121845583 14:97169499-97169521 CTGGGGAGGGTCAGTACCCTGGG - Intergenic
1121868814 14:97388416-97388438 CTGTGCAGAAGCAGTTCTATTGG - Intergenic
1125600761 15:40914796-40914818 CTGGGAAGAATCAGTTCCCAAGG + Intergenic
1126694503 15:51314533-51314555 CCCTGGAGAATCAGTTCTTTGGG + Intronic
1127346801 15:58109202-58109224 CTGTGCAGAACAAGTTCCCATGG + Intronic
1128301412 15:66568318-66568340 CTCTGGGGACTCTGTTCCCTGGG + Intergenic
1129693205 15:77725229-77725251 CTGTGGAGAATAAGTACCGATGG - Intronic
1132011960 15:98283982-98284004 CAGTAGAGAATCAGTGGCCTAGG + Intergenic
1133050077 16:3112615-3112637 CTGTGGAGACTCCCTTCCCGGGG + Exonic
1137683970 16:50373167-50373189 CTGTGGGGAATCAGTGGCCTGGG + Intergenic
1137814229 16:51383149-51383171 AGGTGGAGAAGCATTTCCCTGGG - Intergenic
1140181961 16:72729144-72729166 CTGTGGAGAATGACATCCATGGG + Intergenic
1143712575 17:8744629-8744651 CTGTGAAGAGTCAGCTGCCTGGG - Exonic
1144956698 17:19022214-19022236 CTGTGGCAAATCACTTCTCTTGG - Intronic
1147858443 17:43501187-43501209 CTGTGGTGGGTCACTTCCCTGGG + Intronic
1149521851 17:57323626-57323648 CCGTGGAGGAGCAGTTGCCTAGG + Intronic
1150294872 17:64002248-64002270 CTGAGCAGAGTCAGTTCGCTGGG + Exonic
1151316148 17:73323939-73323961 CTGTGCAGAATAAGATCCCTGGG + Intergenic
1152042908 17:77916418-77916440 CTGTGGAGATTGATTTCTCTTGG - Intergenic
1152765578 17:82136128-82136150 CTGTGAACATTCAGTTCTCTTGG - Intronic
1159046821 18:63376574-63376596 CTAGGGAGAATTAGTTTCCTTGG - Intergenic
1161348002 19:3777600-3777622 CTGTGGGGACACCGTTCCCTGGG - Intergenic
1164610882 19:29630907-29630929 ATGTGGCCAATCAGTGCCCTGGG - Intergenic
1165720845 19:38078764-38078786 CTGAGCAAAATCAGTTCCGTTGG + Intronic
1167954872 19:53056735-53056757 CTGTGGAAAGCCAGTTCTCTGGG + Intergenic
1168626761 19:57924695-57924717 CTGAGGGAAATCTGTTCCCTAGG - Intronic
924974635 2:161434-161456 CTGTGGGGAAACAGTTGCATCGG + Intergenic
925990522 2:9250802-9250824 CTGTGCTGAATCACATCCCTAGG - Intronic
927244760 2:20948725-20948747 CTGCGGAGAATCTGTGCTCTTGG + Intergenic
928839027 2:35583344-35583366 ATTTGGAGAACCAGTGCCCTCGG - Intergenic
929050135 2:37829460-37829482 CTGTGCAGATTCATTTCCCTTGG + Intergenic
933976609 2:87517133-87517155 CTAAGGAGAATCACTTCCTTGGG + Intergenic
935840914 2:107109392-107109414 CTGTGATGAATCCCTTCCCTTGG - Intergenic
936317210 2:111433671-111433693 CTAAGGAGAATCACTTCCTTGGG - Intergenic
936502310 2:113075711-113075733 TAGAGGAGAATCCGTTCCCTTGG - Exonic
937895013 2:126971756-126971778 CTGTGGAGGACCAGCCCCCTGGG + Intergenic
939964987 2:148601478-148601500 CTGATTAGAATCAGTTTCCTTGG + Intergenic
941447480 2:165620011-165620033 CTGTGATATATCAGTTCCCTAGG - Intronic
942080844 2:172398230-172398252 CTGTGCAGAATCAAGTCACTTGG - Intergenic
946482109 2:220067103-220067125 CTTTGGAGAAAGAGTTTCCTAGG - Intergenic
947053043 2:226068284-226068306 CAGTGGAGACTCAGCTACCTAGG + Intergenic
948865923 2:240774880-240774902 CTGAGGATACACAGTTCCCTGGG - Intronic
1176299510 21:5092066-5092088 ATGTGGAGAACCAGACCCCTTGG + Intergenic
1178248112 21:30973646-30973668 CTTTGGAGAATCAGTTCCTGAGG - Intergenic
1178829371 21:36042691-36042713 CTGTAGAGAAGCAGTTTTCTAGG - Intronic
1179857516 21:44169881-44169903 ATGTGGAGAACCAGACCCCTTGG - Intergenic
1180227359 21:46402738-46402760 CTGAGGAGAGGCACTTCCCTAGG + Intronic
1185244134 22:49764265-49764287 CTGTGGAGCAGCAGGTCCCCTGG - Intergenic
949936624 3:9121021-9121043 GGATGGAGACTCAGTTCCCTTGG - Intronic
951043249 3:18011435-18011457 GTCTGGAGACTGAGTTCCCTGGG + Intronic
951109856 3:18790120-18790142 GGGTGGAGAATGAGTTCTCTTGG + Intergenic
953456771 3:43048611-43048633 CTGTGGGGTATCATTCCCCTGGG + Intronic
953818458 3:46183087-46183109 GGGTGGAGGATCAGTTCCTTGGG + Intronic
954117752 3:48476552-48476574 CAGTGGACAAACAGTGCCCTTGG + Intronic
954908055 3:54079631-54079653 TGGTGGAGAATGACTTCCCTGGG + Intergenic
955251775 3:57289979-57290001 TTGAGGAGAATAAATTCCCTCGG + Intronic
956266910 3:67406637-67406659 ATCTGGAGTATCAGGTCCCTGGG + Intronic
956314547 3:67919853-67919875 CTGTGGACATTCCCTTCCCTAGG + Intergenic
957681824 3:83446443-83446465 CTGCTGAGACTCAGTTTCCTGGG - Intergenic
959514530 3:107250257-107250279 CTGTGGAAAACTAGTTCCATAGG + Intergenic
962447755 3:135483330-135483352 ATGTGAAGAAGCATTTCCCTGGG + Intergenic
962832974 3:139160326-139160348 CTGTGGTGGATCAGCTCCTTGGG + Intronic
965628051 3:170701949-170701971 CTGTGGAGAATGGTTTCTCTGGG + Intronic
967347671 3:188476165-188476187 CTTTGGAGTATAAGTTCCATGGG + Intronic
968914075 4:3489558-3489580 CTGTGGAGTGGCAGTCCCCTGGG - Intronic
975369601 4:73569075-73569097 GTGTGGAGAATCTGTGCACTTGG - Intergenic
975715287 4:77199644-77199666 CTGTGCTGAAGCAGTTCCCTTGG + Intronic
976997537 4:91454277-91454299 GAGGAGAGAATCAGTTCCCTTGG + Intronic
978076676 4:104539813-104539835 CGATTGAGAATCAGTGCCCTTGG - Intergenic
979269834 4:118746655-118746677 CTGTGCACATTCTGTTCCCTTGG + Intronic
980620474 4:135295000-135295022 CTGAGAAGAATCAGTCCACTTGG + Intergenic
980744728 4:136999646-136999668 ATGTGGAAAAGCAGTTTCCTAGG + Intergenic
981574046 4:146185148-146185170 CTCTTTAGAATCAATTCCCTGGG + Intronic
981757688 4:148158827-148158849 ATGTCGATAATCAGCTCCCTAGG - Intronic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983274087 4:165596547-165596569 CTGTGGAGAATGAGTTACAGTGG + Intergenic
983786353 4:171734991-171735013 TTGTAGAGAGTCAGTTCCATAGG - Intergenic
985047612 4:185956245-185956267 CTGTGCAGAATGAGTTGCTTGGG + Exonic
985628372 5:1001917-1001939 CAGTGGAGAAGCAGTTCTCTGGG + Intergenic
985930163 5:3051048-3051070 GTGTGGATAACCAGTTCCTTTGG - Intergenic
987147805 5:15009555-15009577 CTGTGATGATTCAGTTCCTTTGG + Intergenic
988757163 5:34268507-34268529 CATAGGAAAATCAGTTCCCTTGG + Intergenic
988971384 5:36471838-36471860 ATGTGGACAAGCATTTCCCTGGG + Intergenic
989303285 5:39920065-39920087 CTGTGGTGATTCAGTTCCCTTGG - Intergenic
995816492 5:116175000-116175022 ATGTGGAGAACCAGTTTGCTGGG + Intronic
996109215 5:119545257-119545279 ATTTAGAGAGTCAGTTCCCTAGG + Intronic
996933432 5:128919040-128919062 CTGTGGAGAATTCTGTCCCTTGG + Intronic
998386100 5:141757954-141757976 CTGTGGGGAATGAGCTCCTTTGG + Intergenic
998749683 5:145305838-145305860 ATGTGGGGAAGCATTTCCCTGGG - Intergenic
1001244984 5:170099225-170099247 CTGGGAAGAATCTGTTTCCTTGG + Intergenic
1001631854 5:173181350-173181372 CTGGGGTGAATCAGTGCTCTAGG - Intergenic
1004200583 6:13544018-13544040 CTGTGGAGAATCAGTTAGAAAGG + Intergenic
1004289695 6:14355094-14355116 CTGTGCACAATTTGTTCCCTAGG - Intergenic
1005150921 6:22749544-22749566 ATGTGGACAATCATTTCCATTGG - Intergenic
1007431272 6:41778937-41778959 CTCTGGAGAAACACTTCCCAGGG + Intronic
1009618323 6:66039114-66039136 GTGTGGAGAATCTGTTCACTTGG + Intergenic
1009848335 6:69163013-69163035 CTGTGGGGATTCTGTTCCCTTGG + Intronic
1011547159 6:88493937-88493959 CTGGGGAGAACAATTTCCCTTGG - Intergenic
1012650432 6:101745333-101745355 CTATGAAGAATCAGTTACATGGG + Intronic
1015403670 6:132814296-132814318 CTCCGTAGAATGAGTTCCCTGGG + Intergenic
1017063631 6:150508618-150508640 CTTTGCAGAATCAGATGCCTGGG - Intergenic
1018377458 6:163226742-163226764 CTGGGGAGAACCTGTTCTCTAGG + Intronic
1019655516 7:2192611-2192633 CTGTGGAGAATCAGTTCCCTAGG - Intronic
1020311683 7:6873169-6873191 GTGTAGGGCATCAGTTCCCTTGG + Intergenic
1023539634 7:41251610-41251632 ATGTGGGGAATTAGTTTCCTAGG + Intergenic
1024384991 7:48740455-48740477 CTGGGGAGAATTAGTTCCTTGGG + Intergenic
1026507445 7:70997413-70997435 CTTTGGAAAATCTGTTCCCCAGG + Intergenic
1036126316 8:6066041-6066063 CTTTGGAGAATCAGTTCAGGAGG + Intergenic
1036372844 8:8175480-8175502 CAGTAGAGCATCTGTTCCCTTGG - Intergenic
1036878062 8:12490161-12490183 CAGTAGAGCATCTGTTCCCTTGG + Intergenic
1038244821 8:25845616-25845638 CTGGGCAGAATCACTTCCCAGGG + Intronic
1039013610 8:33122704-33122726 AGGAGGTGAATCAGTTCCCTTGG - Intergenic
1039381221 8:37087334-37087356 TTGTGCAGAGTTAGTTCCCTGGG - Intergenic
1040422299 8:47251869-47251891 CAGTGGAGGCTCAGTTCCCTAGG + Intergenic
1040809236 8:51432190-51432212 CTGTGGATAATGAGTTGCCCAGG + Intronic
1042028814 8:64451844-64451866 CAGTGGAGAATGAGATCCTTTGG - Intergenic
1044935457 8:97289549-97289571 TAGAGGAGAATCCGTTCCCTTGG + Intergenic
1045707530 8:104943665-104943687 CTGTGGAAGCTCAGTTCCCTGGG + Intronic
1047596377 8:126381798-126381820 CTGAGGCGAAACAGTTGCCTTGG - Intergenic
1049215323 8:141405205-141405227 CTGTGGGGACCCAGGTCCCTTGG + Intronic
1049636499 8:143692309-143692331 CTGTGGAGTGTCAGGTTCCTAGG + Intronic
1049636509 8:143692348-143692370 CTGTGGAGTGTCAGGTCCCTGGG + Intronic
1056196349 9:84232554-84232576 TTGTGGAGGAGCAGCTCCCTTGG - Intergenic
1057288750 9:93785059-93785081 CAATGGAGACTCAGGTCCCTGGG + Intergenic
1059819401 9:117955575-117955597 CTCTGGAGAATCAGATTGCTGGG - Intergenic
1060787628 9:126463154-126463176 CTGTCAAGAACCATTTCCCTGGG - Intronic
1185970052 X:4652632-4652654 CTATGGAGACTCAGCTCTCTAGG - Intergenic
1186260894 X:7778107-7778129 CTGTTGAGAATCACTTACCTAGG + Intergenic
1186430859 X:9503266-9503288 CTGTGGAAAAGCAGTTTCCCCGG - Intronic
1186638877 X:11434001-11434023 CTGTTGAGAATCACTGGCCTAGG - Intronic
1186655205 X:11604914-11604936 CTTTGGACAGCCAGTTCCCTGGG + Intronic
1187694293 X:21903157-21903179 CTGTAGCTAATCATTTCCCTAGG - Intergenic
1189376970 X:40474115-40474137 CTGTGGGAAATCAGCTCACTAGG - Intergenic
1190506636 X:51133145-51133167 CTTAGGAGAAACAGTCCCCTAGG + Intergenic
1190948600 X:55120126-55120148 CTGTGGAGAATTTGTTACCTAGG - Intronic
1192248266 X:69390712-69390734 CTCTGGAGCATCAGTTACCCTGG + Intergenic
1196528305 X:116752621-116752643 GGGTGGAGAATAAGTTCTCTAGG - Intergenic
1199548382 X:149032114-149032136 CTGTGGCAAATCAGTTCCCCAGG + Intergenic