ID: 1019657216

View in Genome Browser
Species Human (GRCh38)
Location 7:2202279-2202301
Sequence ACTCAGCCACAGGAGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019657210_1019657216 -1 Left 1019657210 7:2202257-2202279 CCCAAGGCAGAAAGCGGCCAGGA 0: 1
1: 0
2: 3
3: 14
4: 181
Right 1019657216 7:2202279-2202301 ACTCAGCCACAGGAGGAGCTGGG No data
1019657208_1019657216 0 Left 1019657208 7:2202256-2202278 CCCCAAGGCAGAAAGCGGCCAGG 0: 1
1: 0
2: 2
3: 11
4: 177
Right 1019657216 7:2202279-2202301 ACTCAGCCACAGGAGGAGCTGGG No data
1019657206_1019657216 9 Left 1019657206 7:2202247-2202269 CCAACACAACCCCAAGGCAGAAA 0: 1
1: 0
2: 0
3: 24
4: 255
Right 1019657216 7:2202279-2202301 ACTCAGCCACAGGAGGAGCTGGG No data
1019657211_1019657216 -2 Left 1019657211 7:2202258-2202280 CCAAGGCAGAAAGCGGCCAGGAC 0: 1
1: 0
2: 3
3: 18
4: 163
Right 1019657216 7:2202279-2202301 ACTCAGCCACAGGAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019657216 Original CRISPR ACTCAGCCACAGGAGGAGCT GGG Intronic
No off target data available for this crispr