ID: 1019659428

View in Genome Browser
Species Human (GRCh38)
Location 7:2215758-2215780
Sequence GGTTGCTGTGATGGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2766
Summary {0: 1, 1: 1, 2: 9, 3: 114, 4: 2641}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659428_1019659434 -10 Left 1019659428 7:2215758-2215780 CCTCCCACCCCATCACAGCAACC 0: 1
1: 1
2: 9
3: 114
4: 2641
Right 1019659434 7:2215771-2215793 CACAGCAACCTCCATGTTGTAGG 0: 1
1: 0
2: 8
3: 255
4: 4820
1019659428_1019659437 1 Left 1019659428 7:2215758-2215780 CCTCCCACCCCATCACAGCAACC 0: 1
1: 1
2: 9
3: 114
4: 2641
Right 1019659437 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 231
1019659428_1019659438 4 Left 1019659428 7:2215758-2215780 CCTCCCACCCCATCACAGCAACC 0: 1
1: 1
2: 9
3: 114
4: 2641
Right 1019659438 7:2215785-2215807 TGTTGTAGGTGAGCAGCTGGTGG 0: 1
1: 0
2: 0
3: 19
4: 216
1019659428_1019659440 24 Left 1019659428 7:2215758-2215780 CCTCCCACCCCATCACAGCAACC 0: 1
1: 1
2: 9
3: 114
4: 2641
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659428_1019659439 5 Left 1019659428 7:2215758-2215780 CCTCCCACCCCATCACAGCAACC 0: 1
1: 1
2: 9
3: 114
4: 2641
Right 1019659439 7:2215786-2215808 GTTGTAGGTGAGCAGCTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659428 Original CRISPR GGTTGCTGTGATGGGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr