ID: 1019659429

View in Genome Browser
Species Human (GRCh38)
Location 7:2215761-2215783
Sequence GGAGGTTGCTGTGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 449}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659429_1019659440 21 Left 1019659429 7:2215761-2215783 CCCACCCCATCACAGCAACCTCC 0: 1
1: 0
2: 5
3: 51
4: 449
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659429_1019659439 2 Left 1019659429 7:2215761-2215783 CCCACCCCATCACAGCAACCTCC 0: 1
1: 0
2: 5
3: 51
4: 449
Right 1019659439 7:2215786-2215808 GTTGTAGGTGAGCAGCTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 185
1019659429_1019659437 -2 Left 1019659429 7:2215761-2215783 CCCACCCCATCACAGCAACCTCC 0: 1
1: 0
2: 5
3: 51
4: 449
Right 1019659437 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 231
1019659429_1019659438 1 Left 1019659429 7:2215761-2215783 CCCACCCCATCACAGCAACCTCC 0: 1
1: 0
2: 5
3: 51
4: 449
Right 1019659438 7:2215785-2215807 TGTTGTAGGTGAGCAGCTGGTGG 0: 1
1: 0
2: 0
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659429 Original CRISPR GGAGGTTGCTGTGATGGGGT GGG (reversed) Intronic
900103185 1:971437-971459 GGAGGCAGCTGTGTGGGGGTGGG + Intronic
900291130 1:1924103-1924125 GGCGGTTGGTGAGATGGGGGGGG - Intronic
900303317 1:1988845-1988867 GGAGGTGGGTGTGGGGGGGTGGG - Intronic
900339436 1:2181085-2181107 GGAGGTGGCGGGGGTGGGGTGGG - Intronic
900585662 1:3431216-3431238 TGAGGTGGCTGTGCTGGAGTAGG - Intronic
900640449 1:3685786-3685808 GGAAGCTGCTGTGCTGGGGCTGG + Intronic
901055629 1:6447594-6447616 GGGGGCAGCTGCGATGGGGTGGG + Intronic
901378710 1:8858321-8858343 GGAAGCTGCTGGGCTGGGGTTGG - Intergenic
902246011 1:15120872-15120894 AGATGTTGCAGAGATGGGGTGGG - Intergenic
902433977 1:16385193-16385215 GAGGGATGCTGTGATGGAGTAGG + Intronic
902658856 1:17887592-17887614 GGAGGGTGTTGGGAGGGGGTTGG - Intergenic
903051327 1:20603435-20603457 GAAGGTGGAGGTGATGGGGTGGG - Intronic
903320413 1:22539715-22539737 GGTGGTTGCTGTGGTGGGGTGGG - Intergenic
903802006 1:25975990-25976012 GAAGCTTGCTGTGTTAGGGTGGG - Intronic
903813324 1:26046615-26046637 GGAGGGTCCTGGGGTGGGGTGGG + Intergenic
904293132 1:29500323-29500345 GGTGCTTCCTGTGCTGGGGTGGG + Intergenic
905013765 1:34763380-34763402 GGAGGAAGCTGGGATGAGGTGGG - Exonic
905015812 1:34777694-34777716 GGAGGTGGCTGGGGTGGTGTGGG - Intronic
905015835 1:34777818-34777840 GGAGGTGGCTGGGGTGGTGTGGG - Intronic
905126316 1:35718443-35718465 GAAGGAAGCTGGGATGGGGTGGG + Intronic
905269494 1:36777848-36777870 GGAAGTTGTTTTGATGGGGTTGG - Intergenic
905546552 1:38804526-38804548 GGGGGTTGTTGGGGTGGGGTGGG + Intergenic
906191633 1:43902959-43902981 GGAGGCTGCTATGATGAGGAAGG + Intronic
906376391 1:45300077-45300099 AGATGTTGCTGTGAGGGGCTTGG + Intronic
906530481 1:46520936-46520958 GGAGCATGCTGTGAAGAGGTGGG - Intergenic
906682946 1:47743123-47743145 GGAGGTGGCAGTGATGGTGATGG + Intergenic
907325857 1:53638314-53638336 TGTGGTTGCTGTGATGGGAACGG - Intronic
907452994 1:54559226-54559248 AGAGGAGGCTGGGATGGGGTGGG - Intronic
907461634 1:54608894-54608916 GGAGGGTCCTGGGAAGGGGTGGG - Intronic
909847740 1:80417215-80417237 GGAGGTAGCTTTGATGGGTCAGG + Intergenic
912712764 1:111961409-111961431 GGAGGCTGGTGTGATGGGGACGG + Intronic
914847153 1:151289638-151289660 GGAGGTTGCTGTTGTGGGGGAGG - Intronic
914986018 1:152457805-152457827 GGCAGCTGCTGTGATGGGATTGG - Intergenic
915100524 1:153495760-153495782 GTAGGATGAGGTGATGGGGTGGG - Intergenic
915898724 1:159831047-159831069 GGAGGTGGCTGTGGTGGAGGTGG - Intronic
915908723 1:159899190-159899212 GGGGTTTGCTGGGATGGGGAGGG - Intronic
916061250 1:161099864-161099886 AGAGGATGGAGTGATGGGGTAGG + Intronic
917848714 1:179042296-179042318 TGGGGCTGCTGTGGTGGGGTAGG + Intronic
918174578 1:182031622-182031644 GGAGGTTGATGGAAAGGGGTGGG + Intergenic
919188796 1:194189098-194189120 GGAGGCTGCTGAGATGGGAAAGG + Intergenic
920028522 1:203020011-203020033 GGGGGGTGCGGGGATGGGGTGGG + Intronic
920181662 1:204135551-204135573 GGAGGATTCTGGGATGGGGTGGG - Intronic
920419006 1:205817622-205817644 GGAGGATGTAGTGATGGGGGTGG + Intergenic
920502811 1:206496233-206496255 GTAGGCTGATGTGATGGGATGGG - Exonic
920670861 1:208002851-208002873 GGAGGGTGCTGTGATTGCGGTGG + Intergenic
922471499 1:225879940-225879962 GGAGGGTGCTGTGGTGGTGCTGG + Intronic
922763568 1:228146572-228146594 GGAGTTGGTGGTGATGGGGTGGG - Intronic
922786418 1:228284711-228284733 GAAGGCTGCGGTGATGGGGCTGG - Intronic
924179171 1:241424130-241424152 GGGGGCTGCAGTGATGGGGCCGG + Intergenic
1063536392 10:6888138-6888160 GGAGGTTGGGGTGATGAGGGTGG - Intergenic
1066638675 10:37533621-37533643 GGAGGCTGCTGTACTGGTGTGGG + Intergenic
1068083346 10:52346758-52346780 GGGGGCTGCTGTGATGTGGCTGG + Intergenic
1068657953 10:59593713-59593735 GGCGGTGTCTGTGATGAGGTGGG - Intergenic
1068700793 10:60017611-60017633 GGAGTGAGCTGTCATGGGGTAGG + Intergenic
1069072087 10:63999180-63999202 GGAGGATGCTGTCCAGGGGTTGG + Intergenic
1069829246 10:71272427-71272449 GGAGGCTGCTGTGGTCTGGTAGG - Intronic
1070098133 10:73358518-73358540 GGAGGTCGCCGGGCTGGGGTTGG + Intronic
1070201076 10:74207080-74207102 GCTGGCTGCTGTGGTGGGGTGGG + Intronic
1070347034 10:75554416-75554438 TGAGATTGATGTGATGAGGTAGG + Intronic
1070815113 10:79318067-79318089 GGAGTTAGCTGAGATGGGGCCGG - Intergenic
1071275175 10:84047819-84047841 GGAGGGTGTAGTGATGGGGTTGG - Intergenic
1071706708 10:88007051-88007073 AGAGGTTGCTGAGCTGGGGGAGG + Intergenic
1072990158 10:100185578-100185600 GGTGGCTGCAGTGGTGGGGTTGG - Exonic
1073792611 10:106955365-106955387 GCCAGCTGCTGTGATGGGGTGGG - Intronic
1075247740 10:120838900-120838922 GGAGGTGGCAGAGATAGGGTAGG + Intergenic
1076112471 10:127871792-127871814 TGAGGTGGTAGTGATGGGGTTGG + Intergenic
1076175278 10:128363406-128363428 GCAGGTTGCAGTGATGCAGTTGG + Intergenic
1076360309 10:129883740-129883762 GGTGGTTGCTGGGGTGGGGGAGG + Intronic
1076882762 10:133247640-133247662 GGAGGTGGCTGTCCTGGGGGAGG + Intergenic
1077186096 11:1236072-1236094 GGAGGCTGGTGTGAGGGCGTGGG + Intronic
1077494488 11:2880304-2880326 GGTGGTTGGTGTGGGGGGGTGGG - Intergenic
1078451879 11:11446619-11446641 GGGAGGTGCTGAGATGGGGTTGG - Intronic
1078568480 11:12437633-12437655 GGATGATGCTATGTTGGGGTTGG + Intronic
1081979488 11:47257666-47257688 GGAGGCTGCTGGGATTGGGGTGG + Intronic
1083236328 11:61353194-61353216 GGAGGAGGCACTGATGGGGTGGG - Intronic
1083281176 11:61628159-61628181 GGAGGTGGCTAGGATGGGGAGGG + Intergenic
1083309759 11:61778165-61778187 TGAGGTTCCTGGGCTGGGGTGGG - Intronic
1083743262 11:64722241-64722263 GGAGGGGGCTTTGCTGGGGTGGG - Intronic
1084006440 11:66325931-66325953 GAAGGTTCCAGAGATGGGGTGGG - Intergenic
1084091098 11:66879809-66879831 GCAGGTTTCTGTGATGGATTTGG + Intronic
1084403144 11:68956323-68956345 GGGGGTCGCTGTGGTGGGGGGGG + Intergenic
1084476099 11:69390620-69390642 GGAGGGTGCTGAGGAGGGGTAGG + Intergenic
1084941508 11:72615693-72615715 GGGGGATGCTGTGATGTGTTTGG - Intronic
1084998854 11:73010966-73010988 GGTGGTGGCTGTGAGGGGGTGGG + Intronic
1085507712 11:77069645-77069667 GGAGGCTGCTGGGGAGGGGTGGG - Intronic
1085531182 11:77192970-77192992 GGAGGTAGTTGTGATGGTGGAGG + Intronic
1085725825 11:78953781-78953803 GGAGGTTGCTGTTGCGGGGAGGG + Intronic
1085737502 11:79051764-79051786 GGAGGTTGGTGCAATGGGGAGGG - Intronic
1086184722 11:83999372-83999394 GGCAGTGGCTGTGATGGGCTGGG - Intronic
1087657241 11:100939025-100939047 GGAGATGGATGTGATGGGGTAGG + Intronic
1088417252 11:109602953-109602975 AGAGCTTTCTGTGATGGGATAGG + Intergenic
1089196063 11:116694689-116694711 GGGGGTGGGTGTGAGGGGGTGGG - Intergenic
1089867492 11:121644363-121644385 GCCGGTTTCTGTGATGGGGAGGG + Intergenic
1091561798 12:1620198-1620220 GGAGGGGGCTGTGATGAGGAAGG - Intronic
1092670312 12:10854381-10854403 AGAGGTGGTTGTGATGGGCTGGG - Intronic
1092760383 12:11805082-11805104 GCAGGTTGCTGGGCTGGGGGAGG + Intronic
1093466779 12:19457495-19457517 GGAGGCTGCTGAGATGGGAAAGG - Intronic
1094721074 12:33064069-33064091 GGTGGTGGCTGTGAAGGGCTTGG - Intergenic
1095644059 12:44521543-44521565 GAAGGTTGCGGTGGTGGGGGAGG + Intronic
1095840277 12:46684922-46684944 GGAGCTTGCTGGGATGGCATGGG + Intergenic
1095921117 12:47532434-47532456 GGCAGTGGCTGTGATGGGCTAGG + Intergenic
1096623705 12:52880022-52880044 GGAGGATGTAGTGAGGGGGTGGG + Intergenic
1096851061 12:54437738-54437760 GGTGGTGGCGGTGGTGGGGTTGG + Intergenic
1097260817 12:57719158-57719180 GTAGGTTGGGGTGATGGGGGAGG - Exonic
1097298857 12:57997298-57997320 GCTGGTTGCTGCAATGGGGTGGG + Intergenic
1098404499 12:70109347-70109369 GGAAGTGGCTGTGATGAGCTAGG - Intergenic
1101872685 12:108578882-108578904 GGAGGTGGTTGTGATGGTGGCGG - Intergenic
1103286582 12:119806621-119806643 GGAGGTTGTTGGGGTGGGGGTGG - Intronic
1103331464 12:120157104-120157126 TGAGGTTTCTGTGGTGGGGCCGG - Intronic
1104315526 12:127696661-127696683 GGAGGTGATGGTGATGGGGTTGG + Intergenic
1104970627 12:132529140-132529162 GGGGGCTGCAGGGATGGGGTGGG - Intronic
1105700716 13:22934449-22934471 GGTGGGGGCTGTGATGGGGGTGG - Intergenic
1105779536 13:23695040-23695062 GGAAGTTGCTGAGCCGGGGTCGG + Intergenic
1105853542 13:24357522-24357544 GGTGGGGGCTGTGATGGGGGTGG - Intergenic
1106082019 13:26508139-26508161 GGAGGTGGCTGTGATTGGCCAGG - Intergenic
1106276579 13:28214645-28214667 GGAGGCTGCTGAGATGGGAAAGG + Intronic
1107229210 13:38087319-38087341 GCTGGCTGCTGTGGTGGGGTGGG - Intergenic
1107602251 13:42025347-42025369 AGAGGTTTCTATGATGGGGGAGG + Intergenic
1107725295 13:43293021-43293043 GAAGGTGGCTGTGGTGGGGATGG - Intronic
1108362430 13:49679423-49679445 GGATGTTGCTGTAATTGGGAAGG + Intronic
1109603696 13:64663899-64663921 GCTGGTTGCTGTGGTGGGGTGGG - Intergenic
1111145265 13:84170566-84170588 AGAGTGTGCTGTGGTGGGGTAGG + Intergenic
1112080088 13:95959641-95959663 GGCAGTAGCTGTGATGGGCTGGG - Intronic
1113498768 13:110756515-110756537 GGAGGTTCCTGGGAGGTGGTGGG + Intergenic
1113966120 13:114154997-114155019 GGAGGGGGCTGTGAGGGTGTGGG + Intergenic
1116801962 14:49452799-49452821 AGAGGTTTCTGTGAAGGTGTGGG - Intergenic
1117254678 14:53965605-53965627 GGTGGTGGCGGTGATGGGGGTGG - Intergenic
1118763782 14:68896469-68896491 GGAGTTTGCGGTGATGGGGAAGG - Intronic
1118980658 14:70713675-70713697 GGAGGCTGCTGAGGTGGGGACGG - Intergenic
1119483734 14:74975239-74975261 GGAGGGGGCCGTGATGGGGCTGG + Intergenic
1119549694 14:75499558-75499580 GAAAGTTCCTGTGATGTGGTTGG - Intergenic
1120626413 14:86831978-86832000 GGTGGTGGCTGTGATGGGCTGGG - Intergenic
1121007003 14:90496717-90496739 GTAGGGGGCAGTGATGGGGTTGG - Intergenic
1121083599 14:91128073-91128095 GGAATTTGCTGTGTTGAGGTGGG - Intronic
1121267730 14:92615323-92615345 GGAGGTGGCAAGGATGGGGTCGG - Intronic
1121431655 14:93892227-93892249 GGAGGCAGTTGTGGTGGGGTGGG + Intergenic
1122785330 14:104160857-104160879 GGAGGTTGCTTCCATTGGGTGGG + Intronic
1202849948 14_GL000225v1_random:9996-10018 GGAGGGTGGTGTGGTGGGGATGG - Intergenic
1124853436 15:33363050-33363072 GAAGGTTGCTGTGTTGGGGAAGG - Intronic
1125024121 15:35013370-35013392 GGAGATTGCGGGGATGGTGTAGG - Intergenic
1125316847 15:38441239-38441261 GGTGCTGGCTGTGATGGGGAGGG + Intergenic
1126661600 15:51038602-51038624 GGTGGTGGCTGTGATGGGCTGGG + Intergenic
1126694630 15:51315425-51315447 GAAGATTGCAGTGATGGGGAGGG - Intronic
1126866091 15:52938366-52938388 GGAGGCTGCTGAGATGGGAAAGG - Intergenic
1127173360 15:56327641-56327663 CGAGGCTGCTGTGATGGCATGGG - Intronic
1127260704 15:57324321-57324343 GGAGGGACCTGTGATGGGGAGGG - Intergenic
1127260716 15:57324355-57324377 GGAGGGACCTGTGATGGGGAGGG - Intergenic
1128876124 15:71202778-71202800 GGTGGTTGCGGGGAGGGGGTGGG + Intronic
1129230732 15:74195963-74195985 TGGGGTTGGTGTGATGGGATGGG - Intronic
1129660942 15:77552611-77552633 GGAGATTGCGGTGGAGGGGTTGG - Intergenic
1129820424 15:78598042-78598064 GGAGGTGGCTGGTAGGGGGTGGG - Intronic
1131871531 15:96769423-96769445 GGTGGTTGCTGGGAGGGGTTGGG - Intergenic
1132410787 15:101577064-101577086 GGAGGCTGCTGGGAAGGGCTGGG - Intergenic
1132435862 15:101802080-101802102 GGAGGATGCTATGAGTGGGTGGG - Intergenic
1134265221 16:12686638-12686660 GGAGGATGCTGGGATGGGAAAGG + Intronic
1135150262 16:19999196-19999218 GGAGGGTTCTCTGTTGGGGTGGG + Intergenic
1135384096 16:22021045-22021067 GTAGTTTGCTGTGGTGGGGGTGG + Intronic
1135421586 16:22308838-22308860 GGAGGTGGCCATGGTGGGGTTGG + Intronic
1137819745 16:51432767-51432789 GGAGGTGGCAGGGATTGGGTGGG - Intergenic
1137965628 16:52930229-52930251 GGAGGGGGCTGTGATGGTGACGG - Intergenic
1138435903 16:56999985-57000007 GGATGGTGCTGTGATGGGTCTGG + Intronic
1139305220 16:65980055-65980077 GGATGGTGCTGAGATGGAGTTGG - Intergenic
1139383211 16:66547680-66547702 GGAGGTTTGTCTGATGGGGGAGG - Intronic
1140414970 16:74768000-74768022 GGCTGTTTCTGTGATGTGGTGGG + Intronic
1141505174 16:84472185-84472207 GGTGGTGGCTGTGATGAGCTGGG - Intergenic
1141919756 16:87127889-87127911 GGATGCAGGTGTGATGGGGTGGG - Intronic
1142287423 16:89177098-89177120 GGAAGATGCTGAGTTGGGGTGGG - Intronic
1142290533 16:89192025-89192047 GGAGGATGCAGTGGTGGGGGGGG - Intronic
1142458486 17:72415-72437 GGAGGCTGCTGTGAGGCAGTAGG + Intergenic
1142654203 17:1380051-1380073 GGTGTTTGCTGTGCTGTGGTGGG - Intronic
1142808647 17:2385066-2385088 GGAGGTGGCTGTGCTGGGGTGGG + Exonic
1143099974 17:4499454-4499476 GGCGGGTGGTGGGATGGGGTGGG - Intronic
1143339016 17:6194455-6194477 GGAGGTGGTGGTGATGGAGTTGG + Intergenic
1144506853 17:15838989-15839011 GGAGGTTGCTGAAATGGATTTGG - Intergenic
1144944342 17:18962109-18962131 GGAGGTGGCTGGCATGGGGGTGG - Intronic
1145171035 17:20656921-20656943 GGAGGTTGCTGAAATGGATTTGG - Intergenic
1145878905 17:28340010-28340032 GGTGGTTTCTGTGTTGGGCTGGG + Intronic
1146055507 17:29578833-29578855 GGAGGTTGCTGGCATGGGCCTGG - Intronic
1146677877 17:34785946-34785968 GGAGGTGAATGTGGTGGGGTGGG - Intergenic
1147901686 17:43790580-43790602 GCTGGCTGCTGTGGTGGGGTGGG + Intergenic
1147987467 17:44314882-44314904 GGAGGTGGGTGTGAGGGGTTGGG - Intronic
1148083874 17:44982551-44982573 GGAGGTGGCTGTGGTGGTGGTGG + Intergenic
1148640486 17:49183799-49183821 TGAGCTTGCAGGGATGGGGTGGG + Intergenic
1148986783 17:51629248-51629270 AGAGGATGCTGTGATGGGGTGGG + Intergenic
1151319582 17:73344351-73344373 GGAGGTCACTGGGGTGGGGTTGG + Intronic
1151880044 17:76889317-76889339 GGAGGTCACTGTGATGGGTTTGG + Intronic
1152165961 17:78706295-78706317 GGTGGTTGCTGGGGCGGGGTGGG - Intronic
1152207525 17:78982274-78982296 GGTGGTTGCTGGGAAGGGGCTGG - Intergenic
1152239248 17:79152965-79152987 GGAGGTGGCTGCGGTCGGGTGGG + Intronic
1152305314 17:79516953-79516975 GGGGGTTGCTGGGCTGGGGATGG + Intergenic
1152414741 17:80152166-80152188 GGAGGTTGCTGTGGGGGAGATGG + Intergenic
1152543377 17:80988349-80988371 GGAGGTGGCTGTGCTGGCTTGGG - Intergenic
1152634448 17:81424910-81424932 TGTGGTTGGTGTGATGTGGTTGG + Intronic
1152634457 17:81424966-81424988 TGTGGTTGGTGTGATGTGGTTGG + Intronic
1152634576 17:81425468-81425490 TGTGGTTGGTGTGATGTGGTTGG + Intronic
1152634590 17:81425526-81425548 TGTGGTTGGTGTGATGTGGTTGG + Intronic
1152634639 17:81425740-81425762 TGTGGTTGGTGTGATGTGGTTGG + Intronic
1152700355 17:81815420-81815442 TGGGGTTGCTGTGATTGGGACGG + Intergenic
1153983080 18:10329189-10329211 GGAGGCTTATGGGATGGGGTCGG - Intergenic
1155404955 18:25477689-25477711 GGAAGTTTCTGTGATGGGTTAGG - Intergenic
1155807628 18:30192222-30192244 GGTGGTGGCTGTGATGGACTGGG + Intergenic
1155932063 18:31718746-31718768 GGAGGTTAATGTGATGGAGTTGG - Intergenic
1156354495 18:36329577-36329599 GGGGGCTGCAGTGATGGGGTAGG + Intronic
1156387418 18:36618725-36618747 GGAGGTGGCAGGGATGGGGTGGG - Intronic
1156973939 18:43193488-43193510 GGAGGTTGCTGTGATGGTCCAGG - Intergenic
1157110308 18:44814310-44814332 GGAGGTTGCTGGGTGGGGTTAGG + Intronic
1157127375 18:44969730-44969752 GGAGGATGTTGTGAGGGGTTGGG - Intronic
1157386060 18:47260833-47260855 GGAGATAGGTGGGATGGGGTGGG + Intergenic
1157822368 18:50782464-50782486 GTGGGTGGCTGTCATGGGGTGGG + Intergenic
1159017409 18:63112568-63112590 GGAGGTTGTTGGCATAGGGTGGG - Intergenic
1159266204 18:66083128-66083150 GGAGGCTGCAGTGATCAGGTCGG - Intergenic
1159442838 18:68504093-68504115 GGTGGATGATGTGATGCGGTTGG - Intergenic
1159919726 18:74216526-74216548 GGAGGTTGGAGAGATGGGGAAGG - Intergenic
1160361406 18:78284950-78284972 GGAGGTTGGGGTTATGGGTTTGG + Intergenic
1160686729 19:440224-440246 GGGAGTGGCTGTGATGGGGACGG + Intronic
1161060330 19:2211463-2211485 GGATGTTGCTGGCATGGGGTGGG + Intronic
1161245105 19:3247068-3247090 GGAGGGGGTTGTGCTGGGGTGGG + Intronic
1161288186 19:3479368-3479390 GGAGGTGGCTCAGATGGGGAGGG + Intronic
1161480179 19:4506415-4506437 GGAAGTGGCTGTGCTGGGGCTGG - Intronic
1162154916 19:8671158-8671180 GGAGGCTGCTTGGCTGGGGTGGG + Intergenic
1162352436 19:10158747-10158769 GGTGGTTGCTGGGTTGGGGCTGG - Intronic
1163223195 19:15936622-15936644 GGAGGTTGGTGTGAAGGCTTTGG - Intergenic
1163304562 19:16469796-16469818 GCAGGTGGCTGTGATCTGGTTGG - Intronic
1163655376 19:18542706-18542728 GGAGGCTGCTTTGAGGGGGTGGG - Intronic
1163718435 19:18886042-18886064 GGAGGTGGACGTGGTGGGGTGGG - Intronic
1164483340 19:28633014-28633036 GGAGCTGGCTGTGATGGGGAAGG - Intergenic
1164617865 19:29677416-29677438 GGAGGGTGCTATGATGGGGACGG + Intergenic
1165434977 19:35790546-35790568 GGAGGGTGCCTTCATGGGGTGGG + Intergenic
1165488117 19:36107639-36107661 GGAGATTGCTTTGATGTGCTTGG + Intergenic
1165775267 19:38400662-38400684 GGAGGCTGCTGTGATGGTTCAGG + Intergenic
1165829244 19:38722404-38722426 GGGGGTGACTGTGGTGGGGTGGG - Intronic
1166025214 19:40076905-40076927 GGAGGTGACTATGATGGGCTGGG - Intronic
1166283697 19:41810866-41810888 GGAAGCTGCTGTCCTGGGGTTGG - Exonic
1167131351 19:47588083-47588105 GGAGGTGGAGGTTATGGGGTGGG + Intergenic
1167780814 19:51597796-51597818 GGAGGGGTCAGTGATGGGGTTGG - Intergenic
1168304731 19:55429318-55429340 GGAGGGGGCTGGGAGGGGGTGGG + Exonic
925123359 2:1436897-1436919 GGAGGGTGCTGAGATGGTGTTGG - Intronic
926366733 2:12140240-12140262 TGAGGTTGATGGGATGAGGTAGG + Intergenic
927464218 2:23324899-23324921 AGGGGCTGCTGTGATGGCGTCGG + Intergenic
928454547 2:31407298-31407320 AGAGGTGGCTGTGCTGGGGTTGG + Intronic
928567162 2:32564751-32564773 GGAGGTTGCTGTGGTAGGATGGG + Intronic
929372763 2:41246631-41246653 GGAGGATGATGTGATAGGGTTGG - Intergenic
929600170 2:43199759-43199781 GGATGTAGCTGTGCTGGGGCTGG + Intergenic
930387907 2:50720843-50720865 TCAGGTTTCAGTGATGGGGTGGG - Intronic
932345965 2:70995161-70995183 GGAGGTTGCTGGGGCGCGGTCGG - Exonic
934600288 2:95652030-95652052 GGAGTGAGCTGTGATGGGGTGGG + Intergenic
935079011 2:99773545-99773567 GGAGGTTGGTGTGATGGGGGTGG + Intronic
935801242 2:106698523-106698545 GGAGGCTGCTGAGATGGGAAAGG - Intergenic
936006243 2:108891798-108891820 GGTGGTTGCTGTGATGGACTGGG + Intergenic
937152848 2:119697744-119697766 CGAGGTTGCTGTGAAGAGGAGGG - Intergenic
937312224 2:120909373-120909395 GGAGGAAGCTGGCATGGGGTAGG - Intronic
937775132 2:125767168-125767190 GGTGGCTGGTGTGATGGGGCTGG + Intergenic
937889927 2:126931041-126931063 GGCAGTTTCTGTGATGGGCTGGG + Intergenic
938056713 2:128221006-128221028 AGAGGTGGGTGGGATGGGGTGGG + Intergenic
938247759 2:129792228-129792250 GTAAGTTGCTGTGATGGTGAAGG - Intergenic
939082079 2:137674401-137674423 GGTGGTGGTGGTGATGGGGTGGG - Intronic
939327606 2:140713810-140713832 GGAGGTTTCTGAGATGGGGTAGG - Intronic
939371571 2:141307951-141307973 GGTGGTGGCTGTGATGGGCTGGG + Intronic
940318551 2:152349946-152349968 GGAGGATGCTGTACTGAGGTGGG + Intronic
940449462 2:153818938-153818960 GGTGCTGGCTGTGATGGGGAGGG - Intergenic
940912630 2:159222403-159222425 AGTGGTGGCTGTGATGGGCTGGG - Intronic
940962074 2:159797693-159797715 TGGGGTTGCTGGGATGGGGGTGG - Intronic
941961183 2:171255396-171255418 GGCTTTTGCAGTGATGGGGTGGG + Intergenic
942524648 2:176840365-176840387 GGGGGATGATGTGATGGAGTGGG - Intergenic
942970683 2:181954322-181954344 GGAGGTCGGGGTGGTGGGGTGGG - Intronic
943412504 2:187560956-187560978 GCTGGTGTCTGTGATGGGGTTGG + Intronic
943558774 2:189436361-189436383 GGAGGTGCCTGTTGTGGGGTGGG + Intergenic
943714366 2:191134203-191134225 GGAAGTAGTTGTGATGGGCTGGG - Intronic
944868447 2:203884957-203884979 GCAGGTTGCTGGGGTGGGGGTGG + Intergenic
945116035 2:206409093-206409115 TGAGGCTGCTGAGCTGGGGTGGG + Intergenic
945618923 2:212108927-212108949 GCAGGTTTCTGTGATGGAGATGG + Intronic
946875625 2:224126764-224126786 GGAGGTGGCTGTGAAGGGTGTGG - Intergenic
947619184 2:231577760-231577782 GGAGGATCCTTTGATGGGGAGGG + Intergenic
948558732 2:238836162-238836184 TGGGGCTCCTGTGATGGGGTGGG - Intergenic
948780870 2:240320830-240320852 GGGGGTGGCAGTGCTGGGGTAGG - Intergenic
948807809 2:240460511-240460533 GGAGGATGGTGTGATGGGCAAGG - Intronic
1169356097 20:4906916-4906938 GAAGGATGCTGTGAAGAGGTGGG + Intronic
1169387167 20:5160355-5160377 GTAGGTTGCTGAGGTGGTGTTGG + Intronic
1170163565 20:13340312-13340334 GGAGGTTGCTGGCATTGGTTCGG - Intergenic
1171456384 20:25275056-25275078 GGAGGGTGTTCTGATGGGATGGG + Intronic
1172120687 20:32597009-32597031 TGAGTTTGCTGGGGTGGGGTGGG - Intronic
1172929049 20:38569523-38569545 TGATGTTGCTGTGATGGGGAAGG + Intronic
1173558476 20:43984896-43984918 GGAGGTGGCTGGGAGGGGGAAGG - Intronic
1173757415 20:45529572-45529594 GGAGGATGGGGTGATGGGGTGGG - Intergenic
1174529048 20:51196479-51196501 AGAGGCTGCTGGGATGGGGAGGG + Intergenic
1175176864 20:57117722-57117744 GGGCGGTGCTTTGATGGGGTGGG - Intergenic
1175176881 20:57117771-57117793 GGGCGGTGCTTTGATGGGGTGGG - Intergenic
1175176891 20:57117797-57117819 GGGCGGTGCTTTGATGGGGTGGG - Intergenic
1175176924 20:57117895-57117917 GGGCGTTGCTTTGATGGGGCGGG - Intergenic
1175176949 20:57117969-57117991 GGGCGGTGCTTTGATGGGGTGGG - Intergenic
1175385742 20:58593960-58593982 GGAGGTTGTTGTGAGGAGGAAGG + Intergenic
1175816985 20:61888315-61888337 GGAGGCTGCAGAGATGGGCTGGG - Intronic
1176026569 20:62988896-62988918 GGAGGTTGCTGTCGAGGGGCTGG - Intergenic
1176347354 21:5761874-5761896 GGTGTTTGCTGTGATGGGCTGGG - Intergenic
1176354168 21:5882458-5882480 GGTGTTTGCTGTGATGGGCTGGG - Intergenic
1176497473 21:7562581-7562603 GGTGTTTGCTGTGATGGGCTGGG + Intergenic
1176541675 21:8159944-8159966 GGTGTTTGCTGTGATGGGCTGGG - Intergenic
1176560626 21:8342989-8343011 GGTGTTTGCTGTGATGGGCTGGG - Intergenic
1176695563 21:9972844-9972866 TGAGGTGGGAGTGATGGGGTGGG - Intergenic
1178329125 21:31671922-31671944 GGAGGCTGTTGTGATGGTGGTGG + Exonic
1178369771 21:32017735-32017757 GATGGTTGCTGTGATAGGCTTGG - Intronic
1179289451 21:40005971-40005993 GGAGGTGGCTGTGAGGAGTTTGG + Intergenic
1180754576 22:18152133-18152155 TGTGGTTGCCATGATGGGGTGGG + Intronic
1181084295 22:20432202-20432224 GGAGTTAGGTGAGATGGGGTGGG - Intronic
1183094539 22:35544236-35544258 GGAGGGGGCTGTCATGGGGTAGG + Intronic
1183282922 22:36942332-36942354 GCAGGTTGCCTTGTTGGGGTTGG - Intergenic
1183403585 22:37618935-37618957 GGAGGTTGCTCTTGTGTGGTGGG - Intronic
1183587366 22:38760726-38760748 GGAGGTTGCAGTGACAGGGCTGG - Intronic
1184274300 22:43401396-43401418 GGAGGTGGATGAGATGGGGCAGG + Intergenic
1184616058 22:45639585-45639607 GGGGGGTGCTGTGAGGGGATTGG - Intergenic
1184726163 22:46347870-46347892 GAAGGCTGCAGTGATGGGGCAGG + Intronic
1185202660 22:49517600-49517622 GGCGGGTGCTGTTTTGGGGTAGG - Intronic
1185331965 22:50255972-50255994 GGAGGCTGTTGAGCTGGGGTGGG - Intronic
1203246614 22_KI270733v1_random:76363-76385 GGTGTTTGCTGTGATGGGCTGGG - Intergenic
949917455 3:8975788-8975810 GGGGGGTGCTGTGGTGGGGTGGG - Intergenic
950195499 3:11006505-11006527 GGAGGTTGCTGTAACAGGGATGG - Intronic
950211576 3:11127166-11127188 GAAGGATGCTGAGATGGGGAGGG + Intergenic
950463579 3:13140076-13140098 GGAGCTTGCTGGGGTGAGGTGGG - Intergenic
950611329 3:14128533-14128555 AGAGGGTCCTGTGATGGGGGTGG - Intronic
950675969 3:14554651-14554673 GGAGGTGGCGGGGATGGGGGTGG - Intergenic
952601498 3:35088916-35088938 GCAGGTAGCTGGGGTGGGGTGGG + Intergenic
953658373 3:44871873-44871895 TGAGGTTGTTGGGATGGGGGGGG + Intronic
954368957 3:50160378-50160400 GGAGGTTTCAGTGATGGGCTGGG + Intronic
954517995 3:51197449-51197471 GGTGGTGGCTCTGATGGGCTGGG + Intronic
954797459 3:53168817-53168839 GGAGGTAACGGTGATGGGGAGGG + Intronic
955690879 3:61589612-61589634 GGTGGTTGATGGGGTGGGGTGGG + Intronic
956333262 3:68134782-68134804 GGAGGTTACTGTCATTGGGAAGG + Intronic
956779285 3:72591565-72591587 TGAGGTTGCTGTGAAGAGTTGGG - Intergenic
957864476 3:86004434-86004456 TGAGGTTACTGTGATGCCGTGGG + Intronic
958615951 3:96493843-96493865 GGAGGATACTGTGGTGGGGGAGG + Intergenic
960520679 3:118651539-118651561 AGAGGTAGCTGTCCTGGGGTTGG - Intergenic
961092394 3:124125513-124125535 AGAGGAAGCTGTGATGTGGTGGG + Intronic
961549661 3:127661799-127661821 GGAGGGTGGTGAGATGGGATGGG - Intronic
961660625 3:128467039-128467061 GGTGGTGGTTGTGATGGAGTTGG + Intronic
963653424 3:148014164-148014186 GGTAGTTGCTGTAATGGGCTAGG - Intergenic
963905990 3:150774075-150774097 GCCGGCTGCTGTGATGGGGCGGG + Intergenic
964667354 3:159188984-159189006 GGAGGACGTAGTGATGGGGTTGG + Intronic
964682302 3:159355689-159355711 GGAGGGGGTTTTGATGGGGTGGG - Intronic
966694571 3:182777221-182777243 GGTTGTGGCTGTGATGGGCTAGG + Intergenic
966863740 3:184244796-184244818 GGAGGTTGCTGTGGTGATGGTGG - Intronic
967446507 3:189573462-189573484 GGAAATTGCTGTGATGTGGAAGG - Intergenic
968942163 4:3644465-3644487 GGGGGGTGCTGGGATGGAGTGGG + Intergenic
969156249 4:5212694-5212716 GGAAGTTGCTGTGTTGGTGAGGG + Intronic
969156780 4:5218348-5218370 GGAAGTTTCTGTGATGGTGCAGG + Intronic
970558099 4:17256235-17256257 AGAGGTTGCTGTGGTGGTGCTGG - Intergenic
970709521 4:18845475-18845497 GGAGGTTGCTGGCATCTGGTAGG + Intergenic
971024078 4:22571025-22571047 GGTGGTGACTGTGATGGGCTGGG + Intergenic
971487366 4:27173850-27173872 GGAGGTTGCTGTGTGAGGCTGGG + Intergenic
972404564 4:38733782-38733804 GGTGGTAGCGGTGATGGTGTTGG + Intergenic
974747468 4:66094203-66094225 TGAGGTGGCTGTGCTGGGGGTGG + Intergenic
977104807 4:92868325-92868347 TGAGGTTGGTGTGAAAGGGTGGG - Intronic
977229444 4:94434341-94434363 GGAGGGTGTGGGGATGGGGTGGG - Intergenic
978138244 4:105289410-105289432 GGCAGTAGCTGTGATGGGCTGGG + Intergenic
979994866 4:127419444-127419466 TGATGCTGCTGTGTTGGGGTTGG + Intergenic
980170766 4:129287242-129287264 GGAGGGTGGTGTGCTGGGGGAGG - Intergenic
980243003 4:130201839-130201861 GGGGGCTGCTGTGATGGGGCTGG + Intergenic
980320076 4:131260177-131260199 GGAGGTTACTGTCTTGGGGAAGG - Intergenic
980602695 4:135045595-135045617 GGAGGCTGCTGAGATGGGAAAGG + Intergenic
981486157 4:145288727-145288749 GGAGTTTGCTATGGTGGGCTAGG - Intergenic
982190948 4:152855084-152855106 GGCAGTGGCTGTGATGGGCTGGG + Intronic
983040124 4:162915129-162915151 GGTGCTGGCTGTGATGGGGTGGG - Intergenic
983776580 4:171615536-171615558 GGAGGTTGATGAGAAGGGCTGGG - Intergenic
985758805 5:1734353-1734375 TGGGGCTGGTGTGATGGGGTGGG + Intergenic
985915840 5:2918490-2918512 GACTGTTGCTGTGATGGGGTGGG + Intergenic
986270908 5:6229964-6229986 GCAGGTAGCAGTGAAGGGGTGGG - Intergenic
986811986 5:11369760-11369782 GGAGGTTGTGGTGTTGGGATAGG + Intronic
988029103 5:25739392-25739414 GGTGGTGGCTGTGATGGGCCAGG - Intergenic
988777566 5:34490861-34490883 GGTGGTGGCTGTGGTGGGGGGGG + Intergenic
989116858 5:37963627-37963649 TGAGGTTGATGGGGTGGGGTTGG - Intergenic
989632141 5:43496301-43496323 GGAGGCTGCTGAGATGGGAAAGG - Intronic
989821807 5:45801371-45801393 GCTGGCTGCTGTGATGGGGCAGG - Intergenic
990004408 5:50929172-50929194 GGATGTTGCTGTAATGGTGGTGG - Intergenic
990756515 5:59077798-59077820 GAAGGTTGCTGTCTTGGAGTGGG - Intronic
992493929 5:77272824-77272846 GGAGGTTTCTGTGCTGGGAAGGG + Intronic
992792965 5:80230146-80230168 TGAGGTTTGGGTGATGGGGTTGG - Intronic
993086342 5:83368089-83368111 AGGAGTTGCTGTGATTGGGTAGG + Intergenic
993901315 5:93585559-93585581 GGTGGTTGCTGTGTGGGGCTGGG + Intronic
996088377 5:119326726-119326748 GGAGGTTGGGGTGATGGGGCTGG + Intronic
996895594 5:128478188-128478210 GGAGGTTGCAGTGGTGCTGTTGG + Intronic
997205618 5:132047333-132047355 GGAGGATGCTGGGATTGGCTGGG + Intergenic
997771826 5:136562144-136562166 GGAGGAAGCTGTGTTGGGCTTGG + Intergenic
999368596 5:151039019-151039041 GGGGGTGCCAGTGATGGGGTGGG + Intronic
1001567168 5:172707173-172707195 GGAGAATGATGTGATGGGGCAGG + Intergenic
1002060941 5:176625708-176625730 GGTGGGAGCTGTGCTGGGGTGGG - Intronic
1002159409 5:177306341-177306363 GGAGATTGGTGTCATGGGGGAGG + Intronic
1002200667 5:177526002-177526024 GGAGGTTGCTGTGGTGCGCCTGG + Intronic
1002297395 5:178239191-178239213 GAAGGTTTCAGTGATGGGGATGG + Intronic
1003344811 6:5257257-5257279 GGAGGTAAGTATGATGGGGTTGG - Intronic
1006197460 6:32254773-32254795 GGAGGGGGGTGTGACGGGGTGGG + Intergenic
1006341410 6:33449119-33449141 GGAGGAGGCTGGGAGGGGGTGGG - Intronic
1006741861 6:36314627-36314649 TGAGGGTGCTGTGGAGGGGTGGG - Intergenic
1006806269 6:36791737-36791759 AGTGGTGGCTGTGATGGGGAGGG + Intronic
1007216462 6:40243853-40243875 GGTGGTTGGTGTACTGGGGTAGG + Intergenic
1007370471 6:41423606-41423628 AGAGGGTGCAATGATGGGGTGGG - Intergenic
1007582478 6:42967661-42967683 GGTGGGTGCTAGGATGGGGTAGG + Intronic
1007665133 6:43509356-43509378 GGAGGGTGCTGTGAAGGCATGGG + Intronic
1011291293 6:85779857-85779879 GGTGGCTGCTGTCATGGGATGGG + Intergenic
1011547740 6:88499523-88499545 GGAGGCTGCAGTGATGGGTTGGG - Intergenic
1013443016 6:110190735-110190757 GGAGGGTCCTGGGAAGGGGTGGG + Intronic
1014239353 6:118997620-118997642 GGAGGTTGCAGTGATACAGTGGG + Intronic
1015342425 6:132116783-132116805 GGACATTGCTGTGGTGGTGTGGG + Intergenic
1018501417 6:164414475-164414497 GGGGGCTGTTGTGCTGGGGTTGG - Intergenic
1018793028 6:167163955-167163977 GTAGTTTGCTGGGAAGGGGTGGG - Intronic
1018860396 6:167707059-167707081 GGAGGCTTCTGTGGTGGGGCTGG - Intergenic
1019246378 6:170712826-170712848 AGAGGCCGCTGTGGTGGGGTGGG + Intergenic
1019264638 7:107235-107257 GGACGTTGGTGTGATGCTGTGGG + Intergenic
1019323087 7:424463-424485 GGAGGGAGCTGGGCTGGGGTGGG + Intergenic
1019626582 7:2018921-2018943 GGAGGTGGCTGAGCTGAGGTGGG - Intronic
1019659429 7:2215761-2215783 GGAGGTTGCTGTGATGGGGTGGG - Intronic
1019803338 7:3104742-3104764 GGAGGATGCTTTGATGGGTCAGG + Intergenic
1019900903 7:4020002-4020024 GGAGCTTGCTGGGATTGGGAAGG + Intronic
1020283449 7:6663549-6663571 GGAGGTGGGGGTGATGGGGGAGG + Intergenic
1021616990 7:22511846-22511868 GGAGGCTGCTGAGATGGGAAAGG - Intronic
1023353087 7:39339794-39339816 GGTGGCTGCTGGGGTGGGGTGGG - Exonic
1024569702 7:50713639-50713661 GGAGGTGGAGGTGATGGGGGAGG - Intronic
1024874030 7:54000394-54000416 GCAGGTTGGTGAGATGGGGGAGG - Intergenic
1025263325 7:57437454-57437476 GGATGTGACTGTGATGGGGATGG - Intergenic
1025740453 7:64192060-64192082 GGATGTGACTGTGATGGGGATGG - Intronic
1026765212 7:73155590-73155612 GGAGGGGGCTGCGATGGGGGAGG - Intergenic
1027041686 7:74965346-74965368 GGAGGGGGCTGCGATGGGGGAGG - Intronic
1027055412 7:75046329-75046351 GGAGGTTGCTAAGAGGCGGTCGG - Intronic
1027081956 7:75237023-75237045 GGAGGGGGCTGCGATGGGGGAGG + Intergenic
1027827440 7:83134626-83134648 GTAGGTGGCTGTGAAGGGGCAGG + Exonic
1028041310 7:86058275-86058297 GGTGCTGGCTGTGATGGGGAGGG + Intergenic
1028259077 7:88639144-88639166 GGAGGCTGCTGAGATGGGAACGG + Intergenic
1029278297 7:99420490-99420512 GGAGGTGGCTTTGATGGGGAGGG - Intronic
1029703443 7:102262647-102262669 GGGTTTGGCTGTGATGGGGTGGG + Intronic
1030597741 7:111560685-111560707 GGAGATGGCTGTTTTGGGGTAGG - Intronic
1030820550 7:114086655-114086677 GGAGGTGGCTGGGACAGGGTGGG - Intronic
1031200888 7:118684017-118684039 GGTGGTTGCTGAGGTGAGGTGGG - Intergenic
1032086468 7:128886503-128886525 GGAGCTTGCAGGGAAGGGGTGGG + Exonic
1032667790 7:134054281-134054303 GGAGGTGGGTGTGTTGGGGTGGG - Intronic
1033742496 7:144285371-144285393 CGAGGCAGGTGTGATGGGGTAGG + Intergenic
1033751406 7:144364243-144364265 CGAGGCAGGTGTGATGGGGTAGG - Exonic
1033779104 7:144648422-144648444 GGAGGCTGCTGAGATGGGAAAGG - Intronic
1035022593 7:155808332-155808354 GGAGGGAGCTGCGGTGGGGTGGG - Intronic
1035279658 7:157769756-157769778 GGAGGGAGCTGTGGTGGAGTGGG - Intronic
1035783099 8:2244290-2244312 GGAGGGGGTGGTGATGGGGTGGG + Intergenic
1035809026 8:2475296-2475318 GGAGGGGGTGGTGATGGGGTGGG - Intergenic
1036223844 8:6942299-6942321 GGTGGTGGCTGTGATGGGAGAGG + Intergenic
1037547970 8:19941678-19941700 GAAAGTTGCTGTGATGGGAGAGG - Intronic
1037788599 8:21918109-21918131 GGAGGTTGGGGTGCGGGGGTGGG + Intergenic
1037876748 8:22552288-22552310 GGAGGCGGCTCTGCTGGGGTGGG - Intronic
1038215403 8:25557560-25557582 GGAGCATGCTGTGATGGCATTGG + Intergenic
1038363652 8:26908656-26908678 GGAGGTTGGGGTGATAGGGAAGG + Intergenic
1038949117 8:32394491-32394513 GTAGGTTGCTGTGAAGGATTAGG - Intronic
1039074514 8:33677691-33677713 GGAGGTTGCTACAATGGGGTGGG + Intergenic
1039711792 8:40062277-40062299 GGAGGTGGCTGCAATGGGTTGGG - Intergenic
1040291807 8:46129399-46129421 GGGGGCTTCTGTGATGGGATAGG + Intergenic
1040313462 8:46248824-46248846 GGGGGTTTCTGGGATGGGGGAGG - Intergenic
1040342447 8:46447752-46447774 GGAGGTTTCTGTGATGGTAGAGG + Intergenic
1042039599 8:64577992-64578014 GGAGGTCGTGGAGATGGGGTCGG + Intergenic
1042400949 8:68346378-68346400 GGAGGATGTTGTGATGGGGGAGG - Intronic
1045277721 8:100722272-100722294 GGAGGCTGCGGTGTGGGGGTGGG + Exonic
1045857414 8:106780487-106780509 GGAGTTTGCTGCTGTGGGGTGGG - Intergenic
1046866264 8:119153783-119153805 GAAGAGTGCTGTGATGGAGTTGG + Intergenic
1047190515 8:122674970-122674992 GGAGATTCATGTGATGGGGATGG - Intergenic
1047303779 8:123637053-123637075 GGAGGGTGCTGGGATGTGGGTGG - Intergenic
1048280233 8:133100326-133100348 GGAGGTTTGAGTGCTGGGGTAGG - Intronic
1048315584 8:133359366-133359388 AGAGGTTGGTGTAATGGGGGTGG + Intergenic
1048376422 8:133826408-133826430 CGAGGTTGCTGTTAGTGGGTGGG + Intergenic
1048790671 8:138100510-138100532 GGCTTTTGCTGTGTTGGGGTGGG + Intergenic
1049228494 8:141469745-141469767 GGTGGTGGCTGTGATGGTGATGG + Intergenic
1049406764 8:142455104-142455126 GGTGGTGGGGGTGATGGGGTGGG - Intronic
1049661137 8:143820215-143820237 GGAGGATGGTTGGATGGGGTGGG - Intronic
1050019868 9:1271651-1271673 GGTGGTGGCTGTGAGAGGGTGGG - Intergenic
1050977767 9:11963742-11963764 GGAGGCAGCTGGGATGGGGAAGG - Intergenic
1051520343 9:17980585-17980607 GCATGATGGTGTGATGGGGTTGG + Intergenic
1051664057 9:19451617-19451639 TGAGGCTGCTGAGCTGGGGTGGG - Exonic
1053632546 9:39958795-39958817 TGAGGTGGGAGTGATGGGGTGGG - Intergenic
1053773214 9:41504736-41504758 TGAGGTGGGAGTGATGGGGTGGG + Intergenic
1054211342 9:62291902-62291924 TGAGGTGGGAGTGATGGGGTGGG + Intergenic
1054313641 9:63556950-63556972 TGAGGTGGGAGTGATGGGGTGGG - Intergenic
1054921961 9:70552119-70552141 GGAGCTTGCTGGTATGGGATTGG + Intronic
1055639444 9:78308161-78308183 GGACTTTGCAGTGATGGGCTTGG + Intronic
1056038790 9:82637845-82637867 GGCTGTGGCTGTGATGGGCTGGG - Intergenic
1056139070 9:83656985-83657007 GGAGGTTGCTGTGGTGGTGGTGG - Intergenic
1058545654 9:106058666-106058688 GCTGGCTGCTGTGGTGGGGTGGG + Intergenic
1059209129 9:112495338-112495360 GAAGGTTTCTGTGATGGAGATGG + Intronic
1059487183 9:114635799-114635821 GGAGGTTGGGGTGTTGGGGACGG + Intronic
1061279490 9:129589100-129589122 GGAGGTAGCCGTGATGTGGGGGG + Intergenic
1061520103 9:131112768-131112790 ACAGGTGGCTGGGATGGGGTGGG - Intronic
1061592549 9:131607329-131607351 GGAGCCTGCTGTGAGGGTGTAGG - Intronic
1061784650 9:133019617-133019639 GGAGGCTGCTGAGATGGGAAAGG + Intergenic
1062186920 9:135223207-135223229 GGAGGTCCCTGGGTTGGGGTGGG - Intergenic
1203462948 Un_GL000220v1:59425-59447 GGTGTTTGCTGTGATGGGCTGGG - Intergenic
1203575080 Un_KI270745v1:1182-1204 GGGAGTTGCTGGGCTGGGGTCGG + Intergenic
1185974315 X:4701967-4701989 AGGGTTTGCTGTCATGGGGTAGG + Intergenic
1186207937 X:7219504-7219526 TGAGGTTGCAGTGATTGAGTAGG + Exonic
1186325723 X:8474837-8474859 GCAGATGGCTGTGGTGGGGTGGG - Intergenic
1186374839 X:8988165-8988187 GGTGCTGGCTGTGATGGAGTGGG + Intergenic
1190817302 X:53939678-53939700 GGAGGTTGGTGTGATGTTGAAGG - Intronic
1190830646 X:54056320-54056342 GGAGGTTGCAGTGAAGTGCTAGG + Intergenic
1190949410 X:55128134-55128156 GGATGTTGCCGAGATGGGATAGG - Intronic
1191920301 X:66248983-66249005 GGAGGTGGGTGTGCTGGTGTAGG + Intronic
1192796424 X:74427318-74427340 GGATCCTGCTGTGGTGGGGTTGG + Intronic
1195211146 X:102652895-102652917 GGAGGTTGGTGAGAAGGGGGAGG + Exonic
1195869574 X:109472195-109472217 GGTGGTTGTAGTGATGGTGTGGG - Intronic
1196893022 X:120308761-120308783 GGGGGTTGCTGGGAGGGGATGGG + Intronic
1196976453 X:121163038-121163060 GCAGATTGCAGGGATGGGGTGGG + Intergenic
1197146492 X:123178134-123178156 GGGGGTGGTGGTGATGGGGTTGG - Intergenic
1198221394 X:134605644-134605666 GGAGGTTGCTGTGAGGGTAGAGG + Intronic
1200062439 X:153489574-153489596 GGATGCTGAGGTGATGGGGTGGG + Intronic
1200254086 X:154570068-154570090 GGAGGTCACTGTGATAGTGTAGG - Intergenic
1200263683 X:154634340-154634362 GGAGGTCACTGTGATAGTGTAGG + Intergenic
1200345437 X:155442274-155442296 GGCAGTGGCTGTGATGGGTTGGG - Intergenic