ID: 1019659430

View in Genome Browser
Species Human (GRCh38)
Location 7:2215762-2215784
Sequence TGGAGGTTGCTGTGATGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 509}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659430_1019659439 1 Left 1019659430 7:2215762-2215784 CCACCCCATCACAGCAACCTCCA 0: 1
1: 0
2: 3
3: 64
4: 509
Right 1019659439 7:2215786-2215808 GTTGTAGGTGAGCAGCTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 185
1019659430_1019659438 0 Left 1019659430 7:2215762-2215784 CCACCCCATCACAGCAACCTCCA 0: 1
1: 0
2: 3
3: 64
4: 509
Right 1019659438 7:2215785-2215807 TGTTGTAGGTGAGCAGCTGGTGG 0: 1
1: 0
2: 0
3: 19
4: 216
1019659430_1019659437 -3 Left 1019659430 7:2215762-2215784 CCACCCCATCACAGCAACCTCCA 0: 1
1: 0
2: 3
3: 64
4: 509
Right 1019659437 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 231
1019659430_1019659440 20 Left 1019659430 7:2215762-2215784 CCACCCCATCACAGCAACCTCCA 0: 1
1: 0
2: 3
3: 64
4: 509
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659430_1019659442 30 Left 1019659430 7:2215762-2215784 CCACCCCATCACAGCAACCTCCA 0: 1
1: 0
2: 3
3: 64
4: 509
Right 1019659442 7:2215815-2215837 CACAATACCGAGGCTCCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659430 Original CRISPR TGGAGGTTGCTGTGATGGGG TGG (reversed) Intronic
900291131 1:1924104-1924126 GGGCGGTTGGTGAGATGGGGGGG - Intronic
900303318 1:1988846-1988868 TGGAGGTGGGTGTGGGGGGGTGG - Intronic
900339437 1:2181086-2181108 TGGAGGTGGCGGGGGTGGGGTGG - Intronic
900682733 1:3925681-3925703 AGGTGGGTGCTGTGATTGGGAGG + Intergenic
901009165 1:6189170-6189192 TGGAGATTGCTTTGTTGGTGTGG - Intronic
901009167 1:6189190-6189212 TGGAGATTGCTTTGTTGGTGTGG - Intronic
901009169 1:6189210-6189232 TGGAGATTGCTTTGTTGGTGTGG - Intronic
901055628 1:6447593-6447615 TGGGGGCAGCTGCGATGGGGTGG + Intronic
901442177 1:9284982-9285004 CGGAGGTTGCAGTGAGGAGGAGG - Intergenic
901870496 1:12135864-12135886 TGGAGGCTGCTATGAGGGTGGGG - Intronic
902322451 1:15677868-15677890 AGGAGGCTGCTGTGAGAGGGTGG - Intergenic
902811890 1:18892668-18892690 TGGAGGTTGGTGGGGAGGGGAGG - Intronic
903320414 1:22539716-22539738 TGGTGGTTGCTGTGGTGGGGTGG - Intergenic
903334183 1:22614007-22614029 TGCACGTGGCTGTGAGGGGGAGG + Intergenic
903499311 1:23792836-23792858 TGGAGGTGGCAGTGATGAGCAGG + Intronic
904040271 1:27580247-27580269 TGGAGCCTGCTGGGAAGGGGTGG - Intronic
904947978 1:34213255-34213277 GGGAAGGTTCTGTGATGGGGAGG - Intronic
905015813 1:34777695-34777717 TGGAGGTGGCTGGGGTGGTGTGG - Intronic
905126315 1:35718442-35718464 TGAAGGAAGCTGGGATGGGGTGG + Intronic
905169456 1:36100509-36100531 AGGAGGCTGCTGTCCTGGGGAGG - Intronic
905203752 1:36331050-36331072 TGTCGCTTGCTGTGAAGGGGGGG - Intergenic
907189157 1:52633987-52634009 TGGAAGTTGCTGTTAGGGGGAGG - Intronic
907332735 1:53681797-53681819 TCGAGGTTGCTGTGGGTGGGTGG + Intronic
907707526 1:56845603-56845625 TGGAGGATGCAGTGAGGGGCAGG - Intergenic
908570209 1:65401823-65401845 TGGGGTTTGCTTTGATGGGTGGG - Exonic
908596975 1:65698399-65698421 TGGAGGTTGGTGGGATGAGGAGG - Intergenic
912463008 1:109849555-109849577 TGGAGGCAGGTGGGATGGGGAGG - Intergenic
912503426 1:110137577-110137599 TGGAGGTTGCTGGTAAAGGGAGG + Intergenic
913167311 1:116200141-116200163 TGCAGGTTGCAGGGATGTGGGGG + Intergenic
914717625 1:150265610-150265632 TGGAGGGTGCTGTGGTGAGCTGG - Exonic
914825849 1:151137711-151137733 TGGAGGATGCTCGGCTGGGGAGG - Exonic
915063400 1:153205026-153205048 TGGAGGTGGCAGTGGTGGTGGGG - Exonic
915100525 1:153495761-153495783 TGTAGGATGAGGTGATGGGGTGG - Intergenic
915435672 1:155903963-155903985 TGGAGGTTGCAGTGAGGTTGGGG - Intronic
915584670 1:156837895-156837917 TGGAGCTTGGTATTATGGGGCGG + Intronic
915908724 1:159899191-159899213 TGGGGTTTGCTGGGATGGGGAGG - Intronic
917459266 1:175215049-175215071 TGGACTTTGCTGTCATGGGTAGG + Intergenic
918781057 1:188701554-188701576 TGGAGGTGGCTGTGATGGTCTGG + Intergenic
918847146 1:189631197-189631219 ACTAGGTTGCTGTCATGGGGTGG + Intergenic
919060748 1:192629340-192629362 TGGAGGTTGCTGTGGGAGAGAGG - Intergenic
919739221 1:200972381-200972403 GGGAGGTGGCTTGGATGGGGAGG - Intronic
920010169 1:202861424-202861446 TGAAGGATGCTGTGCGGGGGAGG - Intergenic
920028521 1:203020010-203020032 TGGGGGGTGCGGGGATGGGGTGG + Intronic
920181663 1:204135552-204135574 AGGAGGATTCTGGGATGGGGTGG - Intronic
920258091 1:204670155-204670177 TGGAGGCTGTGGAGATGGGGAGG + Intronic
920389427 1:205589852-205589874 GGGAGGTGGCTGGGATGGGGTGG + Intronic
920593430 1:207244722-207244744 TGCTGGTTGACGTGATGGGGTGG + Intergenic
922216951 1:223527426-223527448 TGGAGGGGGCAGTGATGGGGGGG + Intergenic
922478005 1:225920229-225920251 TGGAAGTTGCTCTGAAGGGGTGG - Exonic
923083310 1:230681037-230681059 TGGTGGTGGCTGGGGTGGGGAGG - Intronic
923453948 1:234146579-234146601 TGGAGGTTGCAGTGAGTGGGAGG - Intronic
1063770197 10:9189079-9189101 TGGAAGTTAGTGTGATGGTGGGG + Intergenic
1066638674 10:37533620-37533642 TGGAGGCTGCTGTACTGGTGTGG + Intergenic
1067682584 10:48450222-48450244 TGGAGCCTCCTGTGACGGGGCGG - Intronic
1068657954 10:59593714-59593736 TGGCGGTGTCTGTGATGAGGTGG - Intergenic
1069141274 10:64828895-64828917 AAGAGGTTGCTATGATGGAGAGG - Intergenic
1069417367 10:68212803-68212825 CAGAAGTAGCTGTGATGGGGAGG - Intergenic
1069629944 10:69891528-69891550 CGGAGGCAGCTGTGATGGAGAGG - Intronic
1069741756 10:70689420-70689442 AGGAGGGAGCAGTGATGGGGTGG + Intronic
1070077803 10:73155130-73155152 TGGAGGTTGCAGGGAGGTGGAGG - Intronic
1070081105 10:73188652-73188674 TGGAGGTTGCAGTGAGGTGCAGG + Intronic
1070201075 10:74207079-74207101 TGCTGGCTGCTGTGGTGGGGTGG + Intronic
1071431670 10:85611662-85611684 AGTAGGCAGCTGTGATGGGGTGG - Intronic
1072009759 10:91292515-91292537 TGAATGGTGCAGTGATGGGGAGG + Intergenic
1072941538 10:99768499-99768521 TGGAGGTTGCAGTGAGCTGGAGG + Intergenic
1073081183 10:100861935-100861957 TGGAGACTGCTGCGATGTGGGGG - Intergenic
1073563876 10:104519156-104519178 TGGGGGCTGCTGGGATGGAGAGG - Intergenic
1075037990 10:119085385-119085407 TGAAGGTGGGTGGGATGGGGAGG - Intergenic
1075040478 10:119103926-119103948 TTGATGGTCCTGTGATGGGGCGG + Intergenic
1075659788 10:124185249-124185271 TAGAGCCTGCTGGGATGGGGAGG - Intergenic
1076167489 10:128294109-128294131 TGGTGGTTGTTGTGATGGTGTGG - Intergenic
1076167505 10:128294211-128294233 TGGTGGTTGCTGTGATGGTGTGG - Intergenic
1077137132 11:1006101-1006123 TGCATGTTGCAGTCATGGGGCGG + Intronic
1077600453 11:3571178-3571200 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1077600459 11:3571212-3571234 AGGAGGTTGCAGTGAAGAGGTGG - Intergenic
1079533759 11:21485987-21486009 TGGCGGTGGCTGTGATGGGCTGG - Intronic
1081611839 11:44567576-44567598 TGGAGTTTGGTATGGTGGGGAGG + Intronic
1083281175 11:61628158-61628180 TGGAGGTGGCTAGGATGGGGAGG + Intergenic
1083771110 11:64868064-64868086 TGGAGGCTGCTGGGGTAGGGCGG - Intronic
1084256365 11:67945800-67945822 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1084337506 11:68468657-68468679 TGGTGGTTTCAGTGTTGGGGAGG + Intronic
1084403143 11:68956322-68956344 TGGGGGTCGCTGTGGTGGGGGGG + Intergenic
1084665295 11:70573181-70573203 TGCAGGCTGCTGTGATGTGACGG + Intronic
1084816403 11:71649519-71649541 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1084998853 11:73010965-73010987 TGGTGGTGGCTGTGAGGGGGTGG + Intronic
1085089395 11:73697412-73697434 TGGAGGTTGCAGTGAGGCGGAGG - Intronic
1085270249 11:75265933-75265955 TGGAGATGGCAGAGATGGGGTGG + Exonic
1085630967 11:78116284-78116306 TGGAGGTTGCAGTGAGGTGGAGG + Intronic
1085725824 11:78953780-78953802 TGGAGGTTGCTGTTGCGGGGAGG + Intronic
1085737503 11:79051765-79051787 TGGAGGTTGGTGCAATGGGGAGG - Intronic
1086184723 11:83999373-83999395 TGGCAGTGGCTGTGATGGGCTGG - Intronic
1086949124 11:92873288-92873310 GGGAAGTGGCTGTGATGTGGTGG - Intronic
1087987713 11:104705227-104705249 TGGAGGCTGTTGTTGTGGGGTGG - Intergenic
1088690069 11:112318744-112318766 TGGAGGCTGTTGGCATGGGGAGG - Intergenic
1089051919 11:115553065-115553087 TGGAGGTGGTTGTGTTTGGGGGG - Intergenic
1089867491 11:121644362-121644384 TGCCGGTTTCTGTGATGGGGAGG + Intergenic
1090387763 11:126366476-126366498 TGTAGGTTACTGACATGGGGAGG + Intronic
1091320690 11:134647233-134647255 TGGAGGCTCCTGTGCTGGGAGGG - Intergenic
1091323125 11:134665504-134665526 TGGAGGTGGCTGTGATGATGGGG - Intergenic
1091663381 12:2400923-2400945 TGGAGGTGCCTGGCATGGGGAGG - Intronic
1091668847 12:2438216-2438238 TGGTGGTGGTTGTGATGGTGGGG + Intronic
1091668866 12:2438306-2438328 TGGTGGTTGTGGTGATGGTGGGG + Intronic
1092670313 12:10854382-10854404 TAGAGGTGGTTGTGATGGGCTGG - Intronic
1093639631 12:21511339-21511361 TGGAGGATGGTGGGTTGGGGAGG - Intronic
1094395297 12:29998920-29998942 TGGTGCCTGTTGTGATGGGGAGG + Intergenic
1094470483 12:30797007-30797029 TGGAGGATGGTGCGGTGGGGAGG + Intergenic
1095649303 12:44588082-44588104 TGGAGGTTGCAGGGAGGCGGAGG + Intronic
1096647002 12:53044353-53044375 TGGAGGTTGCTGTAGCTGGGCGG - Intergenic
1097298856 12:57997297-57997319 TGCTGGTTGCTGCAATGGGGTGG + Intergenic
1097801946 12:63924072-63924094 TGGAGGTTGCAGGGAGGTGGAGG + Intronic
1100454819 12:94741840-94741862 TGGGAGAGGCTGTGATGGGGTGG - Intergenic
1100995692 12:100298631-100298653 TGGAGGTTGCAGGGAGGTGGAGG - Intronic
1101332895 12:103771552-103771574 TGGGTTTTGCAGTGATGGGGAGG - Intronic
1101899429 12:108780272-108780294 TGGAGGTGGTTTTGCTGGGGAGG - Intergenic
1103316183 12:120057722-120057744 GGAAGGTGGCTGTGATGTGGTGG + Intronic
1105836736 13:24218368-24218390 AGGAGGTAGCAGTGCTGGGGTGG + Intronic
1105898808 13:24740082-24740104 TCTGGGTTGCTGTGATGGGATGG + Intergenic
1107229211 13:38087320-38087342 TGCTGGCTGCTGTGGTGGGGTGG - Intergenic
1107605766 13:42054570-42054592 TGGAGGTTACTAAGAAGGGGAGG + Intronic
1108063109 13:46552863-46552885 TGGAGGTTGCGGGGATAGGGGGG - Intergenic
1109136808 13:58661997-58662019 TGAACGTTGCTGTGGTGGGAAGG + Intergenic
1109140122 13:58704198-58704220 TGGACTTTGCTGTCATGGGTAGG + Intergenic
1109521183 13:63512224-63512246 TGCTGGCTGCTGTGGTGGGGCGG - Intergenic
1109603697 13:64663900-64663922 TGCTGGTTGCTGTGGTGGGGTGG - Intergenic
1109941818 13:69377225-69377247 TGGAGGTGGCTCTCAGGGGGTGG + Intergenic
1110822584 13:79933916-79933938 TGGAAGTTTGTGTGTTGGGGGGG - Intergenic
1111015100 13:82370301-82370323 AGGAGGCTGCTGTTATTGGGGGG + Intergenic
1111057068 13:82964872-82964894 TGGAGGTTGCAGTGAGTGGAGGG + Intergenic
1112080089 13:95959642-95959664 TGGCAGTAGCTGTGATGGGCTGG - Intronic
1112265046 13:97915902-97915924 TGGAGGCTGCAGTGAGGTGGAGG + Intergenic
1112279735 13:98052025-98052047 TGAAGGTTGGGGTGTTGGGGTGG - Intergenic
1113498767 13:110756514-110756536 TGGAGGTTCCTGGGAGGTGGTGG + Intergenic
1113604579 13:111596134-111596156 TGGATGTGGCTGTGGTCGGGTGG + Intronic
1113966119 13:114154996-114155018 TGGAGGGGGCTGTGAGGGTGTGG + Intergenic
1114730622 14:24989121-24989143 TGGAGGTTGTAGAGATGGTGGGG - Intronic
1117401104 14:55358955-55358977 GGGTGGTTGCTGGGATGGGAAGG + Intronic
1119159190 14:72438981-72439003 TGGCTGTTCCTCTGATGGGGAGG + Intronic
1119566049 14:75630289-75630311 TGGAGGCAGCTGGGATGGGAAGG - Intronic
1119922601 14:78460184-78460206 TGGAGGGTGGTGTGCTGGAGAGG - Intronic
1120093902 14:80366072-80366094 TGGGAGTAGCTGTGGTGGGGAGG - Intronic
1120589300 14:86356370-86356392 AGGAGGTTGCCGGGATGTGGAGG - Intergenic
1120626414 14:86831979-86832001 TGGTGGTGGCTGTGATGGGCTGG - Intergenic
1121083600 14:91128074-91128096 TGGAATTTGCTGTGTTGAGGTGG - Intronic
1121431654 14:93892226-93892248 TGGAGGCAGTTGTGGTGGGGTGG + Intergenic
1122291939 14:100685623-100685645 TGGAGGGGGCTGTGGTGGAGGGG - Intergenic
1122291945 14:100685638-100685660 TGGAGGGGGCTGTGGTGGAGGGG - Intergenic
1122291998 14:100685777-100685799 TGGAGGGGGCTGTGGTGGAGGGG - Intergenic
1122292247 14:100686436-100686458 TGGAGGGGGCTGTGGTGGAGGGG - Intergenic
1124026099 15:25967298-25967320 TGGAGGATTCTGTGGTGAGGGGG + Intergenic
1125017874 15:34955405-34955427 AGGAGGTTGTTGGGATAGGGGGG - Intronic
1125316846 15:38441238-38441260 AGGTGCTGGCTGTGATGGGGAGG + Intergenic
1126366692 15:47901895-47901917 TCCAGGTTGTTGTGATGTGGTGG - Intergenic
1126661599 15:51038601-51038623 TGGTGGTGGCTGTGATGGGCTGG + Intergenic
1126694631 15:51315426-51315448 TGAAGATTGCAGTGATGGGGAGG - Intronic
1127260705 15:57324322-57324344 GGGAGGGACCTGTGATGGGGAGG - Intergenic
1127260717 15:57324356-57324378 GGGAGGGACCTGTGATGGGGAGG - Intergenic
1127572400 15:60257181-60257203 TGGAGGTTGCAGGGAGGCGGAGG - Intergenic
1127609434 15:60622543-60622565 TGGAGGTTGCAGTGAGGCGGAGG + Intronic
1127920695 15:63492058-63492080 TCTAGGTTCCTGTGATGGGGTGG - Intergenic
1127976369 15:64000256-64000278 GGGAGTTTGCTGTAGTGGGGTGG - Intronic
1128841256 15:70853513-70853535 TGGACTTTGCGGCGATGGGGAGG + Intronic
1128876123 15:71202777-71202799 TGGTGGTTGCGGGGAGGGGGTGG + Intronic
1129156622 15:73722195-73722217 AGGAGGTTGCTGAGGTTGGGAGG - Intergenic
1129300885 15:74624818-74624840 TGGGAGTTGCTGGGTTGGGGTGG + Intronic
1129640959 15:77377534-77377556 TGGAGGTTGCAGTGAGCTGGAGG - Intronic
1130066340 15:80608110-80608132 TGGAGGTTGCACTCTTGGGGTGG - Intergenic
1130878621 15:88035416-88035438 ATGAGATTGGTGTGATGGGGAGG - Intronic
1131007319 15:88988388-88988410 TGTAGGTTTCTGAGATGGGTGGG - Intergenic
1132113874 15:99121416-99121438 TGGAGGTGGCTGTGGTAGGAGGG + Intronic
1132435863 15:101802081-101802103 TGGAGGATGCTATGAGTGGGTGG - Intergenic
1132570227 16:641193-641215 TGGAGGTCTCTGTGCTTGGGGGG - Intronic
1132988506 16:2780490-2780512 TGCAGGTTGAGGTGCTGGGGAGG - Intergenic
1133371672 16:5249907-5249929 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1133371675 16:5249924-5249946 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1133371684 16:5249992-5250014 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1133371690 16:5250026-5250048 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1133457878 16:5958921-5958943 TTTAGGTTGTTGAGATGGGGAGG - Intergenic
1135128868 16:19835197-19835219 TGGAGGTTGCAGTGAGGTGGAGG + Intronic
1135150261 16:19999195-19999217 TGGAGGGTTCTCTGTTGGGGTGG + Intergenic
1135247327 16:20868157-20868179 CAGAGGTGGCAGTGATGGGGAGG - Intronic
1135344202 16:21674398-21674420 CGGAGGTTGCAGTGACTGGGAGG - Intergenic
1135943850 16:26846581-26846603 TGGAGGTTGTTGACTTGGGGAGG - Intergenic
1135972964 16:27085572-27085594 AGGAGGTAGCTGTGATGGTCAGG - Intergenic
1136023793 16:27456906-27456928 TGGAAGGCGGTGTGATGGGGAGG + Intergenic
1136690274 16:32023812-32023834 TGGAAGGTGCTGGGATGGGTGGG - Intergenic
1136790863 16:32967376-32967398 TGGAAGGTGCTGGGATGGGTGGG - Intergenic
1136878952 16:33886556-33886578 TGGAAGGTGCTGGGATGGGTGGG + Intergenic
1137588762 16:49680682-49680704 TGCTGGCTGCTGTGGTGGGGCGG - Intronic
1137745687 16:50818534-50818556 CAGAGGTTGCTGTGGTGGGCGGG + Intergenic
1138415583 16:56869781-56869803 TGGAGATGGCTGAGATGGAGAGG - Exonic
1139934813 16:70561859-70561881 TGGAGGAGGCTGTGAAGAGGTGG + Intronic
1140186202 16:72774489-72774511 TAGAGTTTGCTGCTATGGGGAGG - Intergenic
1140812166 16:78588845-78588867 TGGTGGTAGTGGTGATGGGGTGG + Intronic
1140838129 16:78814535-78814557 AAGAGGTTGCAGTGATGGCGTGG + Intronic
1140941236 16:79723299-79723321 TGGAGGTGGTGGTGATGGTGAGG + Intergenic
1140947837 16:79786817-79786839 TGATGGTGGCTGTGATGGTGGGG - Intergenic
1141504657 16:84467728-84467750 TAGAGGTTGCTGGGATTAGGAGG - Intergenic
1141505175 16:84472186-84472208 TGGTGGTGGCTGTGATGAGCTGG - Intergenic
1141641117 16:85342083-85342105 GGGAGGTGGCAGTGATGGGCTGG - Intergenic
1142290534 16:89192026-89192048 GGGAGGATGCAGTGGTGGGGGGG - Intronic
1203093066 16_KI270728v1_random:1228833-1228855 TGGAAGGTGCTGGGATGGGTGGG - Intergenic
1142654204 17:1380052-1380074 TGGTGTTTGCTGTGCTGTGGTGG - Intronic
1142808646 17:2385065-2385087 CGGAGGTGGCTGTGCTGGGGTGG + Exonic
1143237028 17:5411495-5411517 TGGAGGTTGCGGTGAGCTGGAGG + Intronic
1143828935 17:9635556-9635578 TGTAGGTACCTGTGATGGGGAGG + Exonic
1145878904 17:28340009-28340031 TGGTGGTTTCTGTGTTGGGCTGG + Intronic
1147153129 17:38529947-38529969 TGGAAGGTGCTGGGATGGGTGGG - Intergenic
1147422032 17:40326703-40326725 TGGAGGTGGCTGGCATAGGGTGG + Intronic
1147811207 17:43171086-43171108 TGGAGATTGCGTCGATGGGGCGG - Intronic
1147901685 17:43790579-43790601 TGCTGGCTGCTGTGGTGGGGTGG + Intergenic
1147987468 17:44314883-44314905 TGGAGGTGGGTGTGAGGGGTTGG - Intronic
1148214947 17:45829412-45829434 TGGGGGTTGCTGGGAGAGGGTGG + Intronic
1148475663 17:47927050-47927072 GGGATTTTCCTGTGATGGGGAGG + Intronic
1148629060 17:49092598-49092620 TGGAGGTGCCTGGGCTGGGGCGG + Intergenic
1148986782 17:51629247-51629269 GAGAGGATGCTGTGATGGGGTGG + Intergenic
1151097165 17:71511587-71511609 TAGAGATTGCTGTCATGGGGGGG - Intergenic
1151437324 17:74105941-74105963 TGGGGGCTGCTGTTGTGGGGAGG - Intergenic
1151438820 17:74115140-74115162 GGGAGGTGGCGGTGATGGTGGGG - Intergenic
1151569830 17:74920756-74920778 TGGGGGTTGCTGTGACAGTGGGG - Intronic
1151813853 17:76461329-76461351 TGGAGAGGGATGTGATGGGGAGG - Intronic
1152239247 17:79152964-79152986 TGGAGGTGGCTGCGGTCGGGTGG + Intronic
1153082707 18:1247196-1247218 TGGAGGGGTCTGTGAAGGGGGGG + Intergenic
1153197836 18:2620309-2620331 TGGAGATTGGTGTGGTGTGGGGG - Intergenic
1153791332 18:8582469-8582491 TGGAGGTATCTGTGGTGGTGAGG - Intergenic
1153799640 18:8658034-8658056 TGGAGGTTGCTGTGTTGCCATGG + Intergenic
1153824615 18:8864164-8864186 TTGTGGCTACTGTGATGGGGAGG - Intergenic
1154164975 18:12008060-12008082 TGGAGGTTGCAGTGAGCCGGAGG - Intronic
1154179793 18:12124764-12124786 TGGAAGTAACTGTGATGTGGTGG + Intronic
1155807627 18:30192221-30192243 TGGTGGTGGCTGTGATGGACTGG + Intergenic
1156387419 18:36618726-36618748 GGGAGGTGGCAGGGATGGGGTGG - Intronic
1157282336 18:46354236-46354258 AGGAGGTAGCTGTGATGTAGGGG + Intronic
1157677953 18:49581191-49581213 TTGAGGCTGCTGTGAGCGGGGGG + Intronic
1158556958 18:58483257-58483279 TGGAGAATGCATTGATGGGGAGG - Intronic
1159111912 18:64069527-64069549 TGGCAGTGGCTGTGATGGGTGGG + Intergenic
1160992479 19:1865367-1865389 TGGGGGCTGCTGGGATGGTGGGG - Intergenic
1161060329 19:2211462-2211484 GGGATGTTGCTGGCATGGGGTGG + Intronic
1161245104 19:3247067-3247089 TGGAGGGGGTTGTGCTGGGGTGG + Intronic
1161288185 19:3479367-3479389 AGGAGGTGGCTCAGATGGGGAGG + Intronic
1161305815 19:3567011-3567033 TGGAGGTTGCAGGGAGGTGGAGG + Intronic
1161618793 19:5287454-5287476 TGGAGATTGGGGAGATGGGGAGG - Intronic
1161874368 19:6896297-6896319 TGGAGGTGACTGTTATGGGTTGG - Intronic
1162345490 19:10115834-10115856 GGGAGGTGGCTGTGAGGGGGAGG + Intronic
1162712837 19:12608931-12608953 TGCAGGTGGCTGTGTTGGGATGG + Intronic
1162782128 19:13011894-13011916 TGGAGGTAGAGGTGGTGGGGAGG + Intronic
1163149587 19:15403085-15403107 TGGAGTTTGGTGTGAAGGGTGGG - Intronic
1163272991 19:16265453-16265475 GGGAGGCTGGTGTGTTGGGGAGG + Intergenic
1163438451 19:17309560-17309582 TGGAAGTTACTGTGAGGCGGCGG + Exonic
1163455609 19:17404269-17404291 TGGAGGTTGGGGTAAGGGGGAGG - Intronic
1163655377 19:18542707-18542729 AGGAGGCTGCTTTGAGGGGGTGG - Intronic
1164077175 19:21830182-21830204 CGGAGGTTGCAGTGAGGCGGAGG + Intronic
1164570816 19:29372995-29373017 TGGGGGTTGGGGTGGTGGGGAGG + Intergenic
1164576032 19:29405742-29405764 TGGAGGGTGCTGAGAAGGGAGGG - Intergenic
1165553942 19:36613505-36613527 TGGAGGTTGCAGGGAAGCGGAGG - Intronic
1165573674 19:36796303-36796325 TGGAGGTTGCAGTGAGCCGGAGG - Intergenic
1165829245 19:38722405-38722427 TGGGGGTGACTGTGGTGGGGTGG - Intronic
1166025215 19:40076906-40076928 TGGAGGTGACTATGATGGGCTGG - Intronic
1166048625 19:40244727-40244749 TGGAAGATGCTGTGAAGGGCTGG - Intronic
1166134883 19:40770123-40770145 TGGAGGTTGCAGTGAGATGGAGG + Intergenic
1166303219 19:41923701-41923723 GGGAGGGGGCTGTGCTGGGGGGG + Intronic
1166303261 19:41923815-41923837 GGGAGGGAGCTGTGCTGGGGGGG + Intronic
1166870019 19:45865287-45865309 TGGAGGTTGCTGGACTGGCGGGG - Intronic
1167131350 19:47588082-47588104 TGGAGGTGGAGGTTATGGGGTGG + Intergenic
1167738989 19:51312558-51312580 GGGAGGTTGCAGTTATGTGGGGG + Intronic
1167857442 19:52254048-52254070 TGGAGCTTCCTGAGATAGGGAGG - Intergenic
925258167 2:2507428-2507450 TGGAGGTTACAGTGAATGGGAGG + Intergenic
925398779 2:3557032-3557054 TGTTGGTATCTGTGATGGGGTGG - Intronic
925643187 2:6006913-6006935 TGGAGGGTGCAGGGGTGGGGGGG - Intergenic
926625168 2:15085050-15085072 TGGGGGCTGCTGTGACGGGCCGG + Intergenic
927696360 2:25242206-25242228 TGGAAACTGCTCTGATGGGGAGG - Intronic
927768447 2:25835637-25835659 TGGATATTGCTGGGATGGGAAGG - Intronic
928199192 2:29236370-29236392 CAGAGATTGCTGGGATGGGGAGG + Intronic
928567161 2:32564750-32564772 AGGAGGTTGCTGTGGTAGGATGG + Intronic
929510580 2:42563093-42563115 GGGAGGTTGGTGAGAAGGGGTGG - Intronic
929944302 2:46358917-46358939 TGAAGGTTTCTGTGCAGGGGTGG + Intronic
930819480 2:55630985-55631007 TGGAGGTTGCAGGGAGGTGGAGG + Intergenic
930819485 2:55631002-55631024 TGGAGGTTGCAGGGAGGTGGAGG + Intergenic
931579865 2:63760851-63760873 TGGAGATTCCTGTGGTGGGCAGG - Intronic
931856034 2:66302517-66302539 TGGTGGTAGCTGTGCTGGAGCGG - Intergenic
933315813 2:80713662-80713684 TGGAGGGAACTGTGATGTGGGGG + Intergenic
934575899 2:95401504-95401526 TGGGGGTGGCTGTGATCAGGGGG - Intergenic
934600287 2:95652029-95652051 TGGAGTGAGCTGTGATGGGGTGG + Intergenic
934638021 2:96009061-96009083 TGGGGGTGGCTGTGATCAGGGGG - Intergenic
934795633 2:97096352-97096374 TGGGGGTGGCTGTGATCAGGGGG + Intergenic
935877900 2:107531806-107531828 TGGTGGTGGTTGTGATGGTGGGG + Intergenic
936006242 2:108891797-108891819 TGGTGGTTGCTGTGATGGACTGG + Intergenic
936898368 2:117455076-117455098 CTGTGGTTGCTGTGATGGGTTGG - Intergenic
937152849 2:119697745-119697767 GCGAGGTTGCTGTGAAGAGGAGG - Intergenic
937482923 2:122281450-122281472 TGGAAGGTGCCGTGATGGGTGGG + Intergenic
937486290 2:122318113-122318135 TGGAGTTTGGGGTGATGTGGGGG + Intergenic
937872927 2:126798801-126798823 TGGAGGGTGGTGTGGTGTGGGGG - Intergenic
937889926 2:126931040-126931062 TGGCAGTTTCTGTGATGGGCTGG + Intergenic
938056712 2:128221005-128221027 TAGAGGTGGGTGGGATGGGGTGG + Intergenic
938517079 2:132021779-132021801 TTGAGGTTGCTAAGATGTGGTGG - Intergenic
939082080 2:137674402-137674424 TGGTGGTGGTGGTGATGGGGTGG - Intronic
939371570 2:141307950-141307972 TGGTGGTGGCTGTGATGGGCTGG + Intronic
939408396 2:141790448-141790470 TGGAGGCTGCTGTGGGGTGGAGG + Intronic
940318550 2:152349945-152349967 TGGAGGATGCTGTACTGAGGTGG + Intronic
940422674 2:153498499-153498521 TGCTGGCTGCTGTGGTGGGGCGG + Intergenic
940449463 2:153818939-153818961 AGGTGCTGGCTGTGATGGGGAGG - Intergenic
941056524 2:160795683-160795705 CGGAGGTTGCAGTGAGGTGGAGG + Intergenic
941961182 2:171255395-171255417 TGGCTTTTGCAGTGATGGGGTGG + Intergenic
942970684 2:181954323-181954345 TGGAGGTCGGGGTGGTGGGGTGG - Intronic
943016581 2:182517836-182517858 TGGTGGTTGCAGTGATGGCAAGG - Intronic
943714367 2:191134204-191134226 TGGAAGTAGTTGTGATGGGCTGG - Intronic
944889742 2:204105034-204105056 TGGAGGTTGCTGGAGTGAGGAGG + Intergenic
945116034 2:206409092-206409114 TTGAGGCTGCTGAGCTGGGGTGG + Intergenic
946063798 2:216968634-216968656 TGGTGGTTGCTTGGATGGGAAGG + Intergenic
946401806 2:219472260-219472282 AGGTGGTGGCTGTGACGGGGAGG + Exonic
947619183 2:231577759-231577781 TGGAGGATCCTTTGATGGGGAGG + Intergenic
947666842 2:231911260-231911282 TGGAGGTGACTGTGAGGAGGCGG + Intergenic
948597515 2:239089888-239089910 GGGAGGCGGCTGTGATGGGGAGG - Intronic
1169163819 20:3406504-3406526 TGGAGGTTGGAATGATGGAGGGG - Intronic
1171103508 20:22409722-22409744 TTGAGGTTGCAGTGAGGTGGAGG - Intergenic
1172601793 20:36189165-36189187 TGGAGGCGGGTGTGATGGAGAGG - Intronic
1172914939 20:38436368-38436390 TGGGAGTCTCTGTGATGGGGAGG + Intergenic
1173424479 20:42931014-42931036 TGGTGGTGGCTAAGATGGGGAGG - Intronic
1173565039 20:44032498-44032520 TGGGGGTGGATGTGATGGAGAGG + Intronic
1173757416 20:45529573-45529595 AGGAGGATGGGGTGATGGGGTGG - Intergenic
1174228335 20:49023222-49023244 GGGAGGTTGCTTTGATGTAGTGG + Intronic
1174461821 20:50688740-50688762 TGGACGCTGCTGTGCTGGGCAGG + Intronic
1174529047 20:51196478-51196500 CAGAGGCTGCTGGGATGGGGAGG + Intergenic
1175176865 20:57117723-57117745 TGGGCGGTGCTTTGATGGGGTGG - Intergenic
1175176882 20:57117772-57117794 TGGGCGGTGCTTTGATGGGGTGG - Intergenic
1175176892 20:57117798-57117820 TGGGCGGTGCTTTGATGGGGTGG - Intergenic
1175176925 20:57117896-57117918 TGGGCGTTGCTTTGATGGGGCGG - Intergenic
1175176950 20:57117970-57117992 TGGGCGGTGCTTTGATGGGGTGG - Intergenic
1175177039 20:57118248-57118270 TGGGCGGTGCTTTGATGGGGCGG - Intergenic
1175781443 20:61684741-61684763 GGGAGGCTGCTGTGCTGGGTGGG - Intronic
1176013433 20:62913330-62913352 TGGAGGCTGCTGTGTGAGGGGGG + Intronic
1176293098 21:5056465-5056487 TGCAGGTGGGTGTGAGGGGGTGG + Intergenic
1176347355 21:5761875-5761897 TGGTGTTTGCTGTGATGGGCTGG - Intergenic
1176354169 21:5882459-5882481 TGGTGTTTGCTGTGATGGGCTGG - Intergenic
1176497472 21:7562580-7562602 TGGTGTTTGCTGTGATGGGCTGG + Intergenic
1176541676 21:8159945-8159967 TGGTGTTTGCTGTGATGGGCTGG - Intergenic
1176560627 21:8342990-8343012 TGGTGTTTGCTGTGATGGGCTGG - Intergenic
1176695564 21:9972845-9972867 TTGAGGTGGGAGTGATGGGGTGG - Intergenic
1177759876 21:25391479-25391501 TGGAGGTTGAAGTGCTGGGAGGG - Intergenic
1179656273 21:42846952-42846974 CGGAGGTTGCAGTGAGGTGGAGG + Intronic
1179658428 21:42859952-42859974 TAGAGGTTGCTGTGCTGTTGGGG - Intronic
1179714587 21:43280547-43280569 TGGAGGTGGAGGGGATGGGGAGG + Intergenic
1179714641 21:43280665-43280687 TGGAGGTGGAGGGGATGGGGAGG + Intergenic
1179813757 21:43889887-43889909 AGGTGGTTGCTGAAATGGGGTGG + Intronic
1179864162 21:44207185-44207207 TGCAGGTGGGTGTGAGGGGGTGG - Intergenic
1180124274 21:45778544-45778566 TGGTGGTGGCTGTGATGAGCAGG + Intronic
1180754575 22:18152132-18152154 TTGTGGTTGCCATGATGGGGTGG + Intronic
1183356112 22:37360561-37360583 TGGAGGTTGCTAAGCAGGGGTGG - Intergenic
1183747261 22:39698894-39698916 TGAAGGAGGCAGTGATGGGGAGG - Intergenic
1184048837 22:41989504-41989526 TGGTGGTGGCTGAGTTGGGGAGG + Intronic
1184645742 22:45893925-45893947 TGGAGGCTTCTGTGCTTGGGAGG - Intergenic
1184657956 22:45951553-45951575 TGGTGGTTGCTGGGTCGGGGAGG - Intronic
1184666861 22:45993882-45993904 TGGAGGTTATGGTTATGGGGTGG + Intergenic
1184833696 22:47007687-47007709 TGGGGGTAGCGGTGGTGGGGAGG + Intronic
1185150910 22:49163599-49163621 TGGCGGGTGCTAGGATGGGGTGG - Intergenic
1185246320 22:49775136-49775158 GGGAGCCTCCTGTGATGGGGTGG + Intronic
1185288321 22:50012110-50012132 TGGAGGTGGCTGGGTTGGGGTGG - Intronic
1203246615 22_KI270733v1_random:76364-76386 TGGTGTTTGCTGTGATGGGCTGG - Intergenic
949917456 3:8975789-8975811 TGGGGGGTGCTGTGGTGGGGTGG - Intergenic
950079834 3:10213430-10213452 TGGAGGCTGCAGGGGTGGGGCGG + Intronic
950211575 3:11127165-11127187 GGAAGGATGCTGAGATGGGGAGG + Intergenic
950650162 3:14402274-14402296 TGGAGGCTGCTGTGAAGGAAAGG + Intergenic
951626527 3:24670398-24670420 AGGAGGTTGCTGCAATGGCGTGG + Intergenic
953275020 3:41486545-41486567 TGGATGTTGTTGGCATGGGGAGG + Intronic
953415315 3:42712268-42712290 TGGAGGGGGCTGGGATGGGTGGG + Intronic
953658372 3:44871872-44871894 ATGAGGTTGTTGGGATGGGGGGG + Intronic
954296458 3:49677031-49677053 TGGAGGTGGCAGGGATGGGAGGG + Intronic
954368956 3:50160377-50160399 GGGAGGTTTCAGTGATGGGCTGG + Intronic
954517994 3:51197448-51197470 TGGTGGTGGCTCTGATGGGCTGG + Intronic
954797458 3:53168816-53168838 GGGAGGTAACGGTGATGGGGAGG + Intronic
955916830 3:63915000-63915022 TGGAGGTTGCACTGAGGAGGTGG - Intronic
956106205 3:65821365-65821387 TGGAGCTTGTAGTCATGGGGAGG - Intronic
956726755 3:72162869-72162891 TGGAGCTGCCTGTGCTGGGGTGG - Intergenic
957071275 3:75569829-75569851 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
957071278 3:75569846-75569868 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
960078647 3:113516367-113516389 GGGAACTTGCTGTGAAGGGGAGG + Intergenic
961484803 3:127209221-127209243 TGGTGGTGGCTGTGATGTGCTGG + Intergenic
961511630 3:127407205-127407227 AGGTGGTTGCTGTGCAGGGGTGG - Intergenic
962478076 3:135774394-135774416 TGGCCTCTGCTGTGATGGGGAGG + Intergenic
962968736 3:140379364-140379386 TGGAGGTTGCCGAGAAGGGAAGG + Intronic
963475031 3:145793885-145793907 TGGAGGTTGCAGTGAGGCAGAGG + Intergenic
963905989 3:150774074-150774096 TGCCGGCTGCTGTGATGGGGCGG + Intergenic
964255114 3:154766808-154766830 TGGCTGTAGCTGTGCTGGGGAGG + Intergenic
964563035 3:158019438-158019460 TGGAGGTTGATGTAGTGTGGAGG - Intergenic
965558799 3:170042716-170042738 TGGTGGTGGCTGAGGTGGGGAGG + Intronic
965672153 3:171158101-171158123 TGGGGTTTGGTGTGAGGGGGTGG - Intronic
966742030 3:183242833-183242855 TTGTGGTTGCTTTGATGGGCTGG - Intronic
968675120 4:1873129-1873151 TGAAGGTTGCTGGGTTTGGGTGG - Intronic
968702419 4:2063242-2063264 TGGAGTTTGCCGTGATGGCCCGG + Intronic
968834446 4:2952874-2952896 TGGAGGTTGCAGTGAGGTGGAGG + Intronic
968942162 4:3644464-3644486 TGGGGGGTGCTGGGATGGAGTGG + Intergenic
969156248 4:5212693-5212715 TGGAAGTTGCTGTGTTGGTGAGG + Intronic
969272654 4:6113296-6113318 TGCAGGCTGCTGAGATGGGCTGG - Intronic
969330128 4:6470092-6470114 TGGAGGTTTCTGTGAGGAGCAGG - Intronic
969497503 4:7534539-7534561 TGGAGGATGTTGTGATGGGAAGG + Intronic
969717743 4:8876512-8876534 TGAAGGTTGTTGAGCTGGGGAGG + Intergenic
969739046 4:9010770-9010792 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
969739056 4:9010838-9010860 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
969798240 4:9542407-9542429 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
969798245 4:9542424-9542446 AGGAGGTTGCAGTGAGGAGGGGG + Intergenic
969798251 4:9542458-9542480 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
969827361 4:9768082-9768104 TGGAGGGTGCTGAGCAGGGGAGG - Intergenic
970060200 4:12025094-12025116 TGGAGGGTAATGTGATGGTGTGG - Intergenic
971024077 4:22571024-22571046 TGGTGGTGACTGTGATGGGCTGG + Intergenic
971819369 4:31531119-31531141 TGGAGGCTCCAGTGAAGGGGTGG + Intergenic
972201548 4:36719178-36719200 GGGAGATTGCAGTGATGGAGAGG - Intergenic
972312781 4:37896309-37896331 TGTAGTTTGCTGTGAAGGAGTGG + Intronic
972385405 4:38560809-38560831 TTGAGGTTGCTGCCCTGGGGTGG - Intergenic
974146067 4:57948989-57949011 TTGGGGTTTCTGTGATGGGTAGG + Intergenic
975471402 4:74773082-74773104 TGTAGGTTGCTGGGGTGGGCAGG - Intronic
975519328 4:75281898-75281920 TGGATGTGGCTGTGATGTTGTGG - Intergenic
975754864 4:77562175-77562197 GGGGGGCTGCAGTGATGGGGGGG - Intronic
976072800 4:81260804-81260826 GGGAAGGTGCTGTGGTGGGGAGG + Intergenic
976119708 4:81766347-81766369 TGGAGTTCGCTCTGATGAGGAGG - Intronic
976462611 4:85330179-85330201 TGGAGGTTGAGGACATGGGGTGG + Intergenic
976861516 4:89671730-89671752 TGGAGCTTGGTGTGAGGGAGGGG + Intergenic
978138243 4:105289409-105289431 TGGCAGTAGCTGTGATGGGCTGG + Intergenic
978595965 4:110378006-110378028 AGGAGGTTGCAGTGAGGAGGAGG - Intronic
980007417 4:127558698-127558720 GGGAGGGTGCTGGGATGAGGTGG + Intergenic
980158505 4:129133717-129133739 TAGAGGTGGCAGAGATGGGGTGG + Intergenic
982190947 4:152855083-152855105 TGGCAGTGGCTGTGATGGGCTGG + Intronic
983040125 4:162915130-162915152 AGGTGCTGGCTGTGATGGGGTGG - Intergenic
984377672 4:178953635-178953657 TGGCGGTGGCGGTGATGGGGTGG - Intergenic
985915839 5:2918489-2918511 GGACTGTTGCTGTGATGGGGTGG + Intergenic
986690337 5:10308470-10308492 TGGAGGTTGCAGTGAGGTTGAGG - Intergenic
988777565 5:34490860-34490882 CGGTGGTGGCTGTGGTGGGGGGG + Intergenic
989276754 5:39598730-39598752 GGGAGTGTGCTGTGCTGGGGGGG + Intergenic
991039558 5:62161847-62161869 TGCTGGTTGCTGTGATGGGGTGG + Intergenic
992493928 5:77272823-77272845 AGGAGGTTTCTGTGCTGGGAAGG + Intronic
993917097 5:93756470-93756492 TGGAGGTGGCTGTGGTGTGCAGG - Intronic
996583212 5:125054684-125054706 TGGAGGTTGTGGTGAGGGGGCGG - Intergenic
997698290 5:135878566-135878588 TGGAGGCTGCTGTGAGGTGCTGG + Intronic
997709095 5:135988349-135988371 TGGGGGGTGCGGTGATGGGAGGG - Intergenic
998790740 5:145764007-145764029 TGGAGGTTGCAGAGAGGTGGAGG + Intronic
999368595 5:151039018-151039040 TGGGGGTGCCAGTGATGGGGTGG + Intronic
1001833715 5:174811704-174811726 AGGTGGTTGCTGGGATGGGTGGG - Intergenic
1003134025 6:3419206-3419228 TGGTGATTGATTTGATGGGGAGG - Intronic
1003303695 6:4907786-4907808 TTTAGGTTGCTGTTATGGTGAGG + Intronic
1003565670 6:7220066-7220088 TGGAGGTTCCTATTATGGGGTGG - Intronic
1003715653 6:8643226-8643248 TGGAGGTGGCAGTGATGGAAAGG - Intergenic
1005838647 6:29725528-29725550 TGGTCGCTGCTGTGATGTGGAGG + Exonic
1006002485 6:30976291-30976313 TGGAGGATGGAGTGCTGGGGAGG - Intergenic
1006627940 6:35410889-35410911 TGGGGGCTGCTGTCATGGAGGGG - Intronic
1006806268 6:36791736-36791758 GAGTGGTGGCTGTGATGGGGAGG + Intronic
1007234220 6:40378829-40378851 TGGAGGTTTCAGAGATGGGCTGG - Intergenic
1007460761 6:42017128-42017150 TGCAGGATGCTGTGTGGGGGAGG - Intronic
1007654127 6:43441973-43441995 TGGAGGTTGCAGTGGCAGGGAGG + Intronic
1007665132 6:43509355-43509377 TGGAGGGTGCTGTGAAGGCATGG + Intronic
1007761965 6:44138619-44138641 AGGAGGGTGCTGTGCTGGCGAGG - Intronic
1010839976 6:80637438-80637460 TGGAGGAAACTGTGGTGGGGAGG + Intergenic
1011547741 6:88499524-88499546 GGGAGGCTGCAGTGATGGGTTGG - Intergenic
1011968232 6:93187642-93187664 TGGTTGTTGCTGGTATGGGGAGG + Intergenic
1013935101 6:115584854-115584876 TTGAGGTAGCGGTGAGGGGGAGG - Intergenic
1014239352 6:118997619-118997641 TGGAGGTTGCAGTGATACAGTGG + Intronic
1017974308 6:159341777-159341799 TGGAGGTGGCAGTGAGGTGGAGG + Intergenic
1019363465 7:617900-617922 TGGAGGTGTCTGTGCAGGGGCGG - Intronic
1019490483 7:1311041-1311063 TGGAGGGTGCTGGGCTGCGGGGG - Intergenic
1019626583 7:2018922-2018944 TGGAGGTGGCTGAGCTGAGGTGG - Intronic
1019659430 7:2215762-2215784 TGGAGGTTGCTGTGATGGGGTGG - Intronic
1020816740 7:12915014-12915036 TGGAGGTAGCTTGGATGAGGAGG - Intergenic
1021533239 7:21673491-21673513 TGGAGGATGCTGTGGGGGGAGGG - Intronic
1023040334 7:36167568-36167590 TGGAGGCTGCTGCGTGGGGGTGG - Intronic
1023353088 7:39339795-39339817 TGGTGGCTGCTGGGGTGGGGTGG - Exonic
1023759438 7:43450241-43450263 TGGAGGTTGGGGGGTTGGGGAGG - Intronic
1024258053 7:47553870-47553892 TGGAGGTTGCAGTGAGCCGGAGG - Intronic
1024427192 7:49239872-49239894 TGGAAGTTGGGGGGATGGGGAGG + Intergenic
1024613286 7:51085227-51085249 TGGTGGTGGCTGTGGTGGAGGGG + Exonic
1026481672 7:70784977-70784999 AGGAAGTTGCTGTGATGAGGAGG - Exonic
1028041309 7:86058274-86058296 AGGTGCTGGCTGTGATGGGGAGG + Intergenic
1029073558 7:97919146-97919168 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1029166603 7:98595858-98595880 GGGAGGTGGCTGTCCTGGGGAGG + Intergenic
1029278298 7:99420491-99420513 GGGAGGTGGCTTTGATGGGGAGG - Intronic
1029703442 7:102262646-102262668 TGGGTTTGGCTGTGATGGGGTGG + Intronic
1030040783 7:105447981-105448003 TGGAGGCTGCTGTGATAAAGAGG - Intronic
1030465244 7:109893472-109893494 AGGAGGTTCCTGTGATATGGGGG + Intergenic
1030820551 7:114086656-114086678 TGGAGGTGGCTGGGACAGGGTGG - Intronic
1031101576 7:117486864-117486886 TGGAGGTGGGTGGGGTGGGGGGG + Intronic
1031200889 7:118684018-118684040 TGGTGGTTGCTGAGGTGAGGTGG - Intergenic
1032062111 7:128733630-128733652 TGGAGTTTTCTGTAAAGGGGTGG - Intergenic
1032086467 7:128886502-128886524 TGGAGCTTGCAGGGAAGGGGTGG + Exonic
1032401964 7:131629965-131629987 TGCAGGCTGCGGGGATGGGGAGG + Intergenic
1032667791 7:134054282-134054304 AGGAGGTGGGTGTGTTGGGGTGG - Intronic
1032792304 7:135251555-135251577 TGGAGGTGGCTGTGAGGGACAGG - Intronic
1033483580 7:141765298-141765320 TGGTGGTTGCGGAGGTGGGGAGG + Intronic
1034132394 7:148732043-148732065 TGCAGGGTGCTATGATGGGTAGG + Intronic
1034732990 7:153404180-153404202 TGGAGGTGGCTGTGTTGAGCTGG + Intergenic
1035625519 8:1067892-1067914 TGTGGGCTGCTGTAATGGGGGGG - Intergenic
1036244136 8:7102145-7102167 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1036256627 8:7211747-7211769 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036256635 8:7211798-7211820 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036256641 8:7211832-7211854 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036256654 8:7211917-7211939 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036308671 8:7670298-7670320 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036308678 8:7670349-7670371 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036308686 8:7670400-7670422 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036308692 8:7670434-7670456 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036308698 8:7670468-7670490 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036308705 8:7670519-7670541 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036360838 8:8075592-8075614 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1036360845 8:8075643-8075665 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1036360851 8:8075677-8075699 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1036360857 8:8075711-8075733 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1036360864 8:8075762-8075784 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1036360867 8:8075779-8075801 AGGAGGTTGCAGTGAGGAGGAGG + Intergenic
1036422892 8:8614332-8614354 TGGAGACTGCTGGCATGGGGAGG + Intergenic
1036773163 8:11592636-11592658 TGGAGGGTGGTGTGGTGGGCAGG - Intergenic
1036890085 8:12591111-12591133 AGGAGGTTGCGGTGAGGAGGAGG - Intergenic
1036890099 8:12591193-12591215 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036890102 8:12591210-12591232 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036890109 8:12591261-12591283 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036890115 8:12591295-12591317 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036890121 8:12591329-12591351 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036890129 8:12591380-12591402 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036897699 8:12649265-12649287 AGGAGGTTGCAGTGAGGAGGAGG - Intergenic
1036897702 8:12649282-12649304 AGGAGGTTGCGGTGAGGAGGAGG - Intergenic
1036897706 8:12649299-12649321 AGGAGGTTGCGGTGAGGAGGAGG - Intergenic
1037758635 8:21727525-21727547 TGGGGGGGGCCGTGATGGGGAGG - Intronic
1039074513 8:33677690-33677712 TGGAGGTTGCTACAATGGGGTGG + Intergenic
1039552917 8:38456162-38456184 TGGAGGTGCGCGTGATGGGGTGG - Intronic
1039711793 8:40062278-40062300 TGGAGGTGGCTGCAATGGGTTGG - Intergenic
1040106112 8:43542975-43542997 TGGAGGCTGCTGAGAAGGGAAGG + Intergenic
1040333753 8:46405712-46405734 TGGGGGTTTCTGGGATGGGAGGG - Intergenic
1040553280 8:48455919-48455941 TGGGGCTTGTTGTGATGGGTGGG + Intergenic
1042274144 8:66985683-66985705 TGGAAGTTGCTCTGGTTGGGAGG + Intronic
1045277720 8:100722271-100722293 TGGAGGCTGCGGTGTGGGGGTGG + Exonic
1046529721 8:115427835-115427857 TGGAGGGGGCAGTGCTGGGGAGG + Intronic
1047749262 8:127867497-127867519 TGGAGGATGCTCCGCTGGGGAGG + Intergenic
1048173908 8:132134292-132134314 GGGAGATTGCTGGGATGGGAAGG + Exonic
1049406765 8:142455105-142455127 TGGTGGTGGGGGTGATGGGGTGG - Intronic
1049985140 9:943385-943407 TGCAGGTTGCTGTCACAGGGAGG + Intronic
1050952735 9:11618323-11618345 TGGAGGTTCCTGGGAGAGGGTGG - Intergenic
1051664058 9:19451618-19451640 TTGAGGCTGCTGAGCTGGGGTGG - Exonic
1053387126 9:37701669-37701691 TGGAGGCTGGAGTGATGGGCGGG + Intronic
1053449143 9:38178997-38179019 GGGAGGTTGCTGGAATGAGGAGG - Intergenic
1053632547 9:39958796-39958818 TTGAGGTGGGAGTGATGGGGTGG - Intergenic
1053773213 9:41504735-41504757 TTGAGGTGGGAGTGATGGGGTGG + Intergenic
1054211341 9:62291901-62291923 TTGAGGTGGGAGTGATGGGGTGG + Intergenic
1054313642 9:63556951-63556973 TTGAGGTGGGAGTGATGGGGTGG - Intergenic
1056038791 9:82637846-82637868 TGGCTGTGGCTGTGATGGGCTGG - Intergenic
1056923542 9:90813305-90813327 TGGAGGTGGCTGGGGTGGGGAGG - Intronic
1057028991 9:91759191-91759213 TGGAGGTGGAGGTGATGGAGAGG + Intronic
1057147588 9:92768585-92768607 TGGAGGTAGCTGTGATGATGGGG - Intergenic
1057161523 9:92892056-92892078 TGGAGGTGGGTGTGGGGGGGCGG - Intergenic
1057259139 9:93574703-93574725 TAGAGGCTGCTGTGATGCAGGGG - Intergenic
1058545653 9:106058665-106058687 TGCTGGCTGCTGTGGTGGGGTGG + Intergenic
1058909621 9:109508855-109508877 TGGAGGTTGGTGGGTGGGGGGGG - Intergenic
1059609554 9:115878036-115878058 TGGAGGTGGCGGGGTTGGGGAGG + Intergenic
1060112665 9:120917806-120917828 TGAAGGATTCTGAGATGGGGAGG - Intronic
1060219130 9:121755134-121755156 TGGTCATTGCCGTGATGGGGAGG + Intronic
1060603699 9:124895694-124895716 TGGAGGGTTCTGTGTTGTGGAGG - Intronic
1060831528 9:126720649-126720671 TGGAGGTTGCAGTGAGCTGGAGG + Intergenic
1060846645 9:126842635-126842657 TTGAGGCTGCTGTGAGGGAGTGG - Intergenic
1061279489 9:129589099-129589121 AGGAGGTAGCCGTGATGTGGGGG + Intergenic
1061520104 9:131112769-131112791 TACAGGTGGCTGGGATGGGGTGG - Intronic
1061682140 9:132248099-132248121 TGGTGGGGGCTGTGGTGGGGAGG - Intergenic
1061696539 9:132380000-132380022 TAGTGGTTGCTGTGATGAAGAGG - Intronic
1061970203 9:134040892-134040914 TGGAGGTGGCTGCAGTGGGGAGG - Intronic
1061988281 9:134143111-134143133 TGGAGTTAGCTTTGATGGGCGGG + Intronic
1062141684 9:134962639-134962661 CGGAGGTTGCTGAGAGGTGGAGG - Intergenic
1062141687 9:134962656-134962678 TGGAGGTTGCTGGGGGGCGGAGG - Intergenic
1203462949 Un_GL000220v1:59426-59448 TGGTGTTTGCTGTGATGGGCTGG - Intergenic
1186325724 X:8474838-8474860 TGCAGATGGCTGTGGTGGGGTGG - Intergenic
1186710642 X:12192483-12192505 TGGAGTGAGCTCTGATGGGGTGG + Intronic
1188860110 X:35245103-35245125 TGGGGGCTGCCGTGATGGGACGG - Intergenic
1190041314 X:47074620-47074642 TGGAGGTTGCAGTGAGTGAGCGG - Intergenic
1190284058 X:48950624-48950646 TGGAGGTTGCAGTGAGGTGGGGG - Intronic
1190623569 X:52313680-52313702 TAGAGGTTGCTGTGGAGGGAAGG - Intergenic
1190875471 X:54456977-54456999 TGGAGCTTTCTGAGATGGGAGGG - Intronic
1190892962 X:54586961-54586983 TGGAACTGGCTGTGATGGGTTGG - Intergenic
1191605351 X:63056840-63056862 TGCAGCTTGCTGAGATGGGGTGG + Intergenic
1192456217 X:71278280-71278302 TGGAGGTTGCAGGGAGGTGGAGG + Intergenic
1192811594 X:74552224-74552246 TGGAGGGTGCGGTAATGGGGAGG - Intergenic
1195093753 X:101487268-101487290 TGGAGGTTGGTGTGAAGTGGGGG + Intronic
1195512908 X:105738375-105738397 TGGAGCTTGTTGTAATTGGGAGG + Intronic
1195869575 X:109472196-109472218 TGGTGGTTGTAGTGATGGTGTGG - Intronic
1196577914 X:117342186-117342208 TGGTGGTTGCTGATATTGGGTGG + Intergenic
1196976452 X:121163037-121163059 TGCAGATTGCAGGGATGGGGTGG + Intergenic
1200345438 X:155442275-155442297 TGGCAGTGGCTGTGATGGGTTGG - Intergenic
1201103099 Y:10693365-10693387 TGGAGGGTGCTGTGGTGTGGTGG - Intergenic