ID: 1019659431

View in Genome Browser
Species Human (GRCh38)
Location 7:2215765-2215787
Sequence ACATGGAGGTTGCTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 2, 2: 1, 3: 25, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659431_1019659442 27 Left 1019659431 7:2215765-2215787 CCCCATCACAGCAACCTCCATGT 0: 1
1: 2
2: 1
3: 25
4: 349
Right 1019659442 7:2215815-2215837 CACAATACCGAGGCTCCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 66
1019659431_1019659437 -6 Left 1019659431 7:2215765-2215787 CCCCATCACAGCAACCTCCATGT 0: 1
1: 2
2: 1
3: 25
4: 349
Right 1019659437 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 231
1019659431_1019659439 -2 Left 1019659431 7:2215765-2215787 CCCCATCACAGCAACCTCCATGT 0: 1
1: 2
2: 1
3: 25
4: 349
Right 1019659439 7:2215786-2215808 GTTGTAGGTGAGCAGCTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 185
1019659431_1019659440 17 Left 1019659431 7:2215765-2215787 CCCCATCACAGCAACCTCCATGT 0: 1
1: 2
2: 1
3: 25
4: 349
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659431_1019659438 -3 Left 1019659431 7:2215765-2215787 CCCCATCACAGCAACCTCCATGT 0: 1
1: 2
2: 1
3: 25
4: 349
Right 1019659438 7:2215785-2215807 TGTTGTAGGTGAGCAGCTGGTGG 0: 1
1: 0
2: 0
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659431 Original CRISPR ACATGGAGGTTGCTGTGATG GGG (reversed) Intronic
900319577 1:2075940-2075962 ACATGGAGGTTGAACTGTTGGGG + Intronic
900695926 1:4010432-4010454 ACCTGGAGGAGGCTGTGGTGGGG + Intergenic
900923655 1:5689688-5689710 CCAGGGAGTTTGCTGTGAAGGGG - Intergenic
901275379 1:7987046-7987068 AGGTGGAGGTTGCTGTGAGCCGG - Intergenic
901367346 1:8764134-8764156 ACCTGGAGGAGGCAGTGATGAGG - Intronic
901442178 1:9284985-9285007 AGACGGAGGTTGCAGTGAGGAGG - Intergenic
903320415 1:22539719-22539741 GAATGGTGGTTGCTGTGGTGGGG - Intergenic
903853382 1:26321320-26321342 ACGTGGAGGTTAGTGTGATGGGG - Intergenic
905371210 1:37483511-37483533 ACCTGGTGGAGGCTGTGATGGGG + Exonic
905611322 1:39354472-39354494 AGATGGAGGTTGCGGTGAGCTGG - Intronic
905691055 1:39943083-39943105 ACATGGAGGTTCCTGTAGGGTGG - Intergenic
905874240 1:41422220-41422242 AGAAGGAAGGTGCTGTGATGAGG + Intergenic
907189158 1:52633990-52634012 AGATGGAAGTTGCTGTTAGGGGG - Intronic
908133826 1:61106395-61106417 ACAGGGAGGGTGCAGTGAGGAGG - Intronic
909986278 1:82164086-82164108 GCAAGGAGGCTGCTGTGCTGCGG + Intergenic
910797497 1:91113495-91113517 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
912702819 1:111890912-111890934 ACATGGAGGTCACAGTGATCTGG + Intronic
913416549 1:118615175-118615197 ACAAGGTGCATGCTGTGATGGGG - Intergenic
914239636 1:145844979-145845001 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
914854058 1:151337321-151337343 AAATGGAGGTTGCAGTGAGCCGG + Intergenic
917814708 1:178695340-178695362 ACATGGAGGTTTCTTTAATCAGG + Intergenic
918013009 1:180605058-180605080 AGATGGCGGGTGGTGTGATGTGG + Intergenic
918932674 1:190875958-190875980 TCATGGAAGTTGCAGTGAGGCGG - Intergenic
919806478 1:201383682-201383704 AAGTGGCGATTGCTGTGATGGGG - Intronic
920319719 1:205110088-205110110 ATATGGAGGTTGCGGTGAGCCGG - Intronic
920389426 1:205589849-205589871 AGAGGGAGGTGGCTGGGATGGGG + Intronic
921472262 1:215563554-215563576 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
921612710 1:217231339-217231361 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
921784301 1:219209771-219209793 ATATGGAGATAGCTGTTATGAGG - Intronic
921941040 1:220839984-220840006 TCATGGAGGTTTCTGAGAAGAGG + Intergenic
922216948 1:223527423-223527445 ATATGGAGGGGGCAGTGATGGGG + Intergenic
923669922 1:236031641-236031663 ACCTGGAGTTTGTTGTGCTGGGG - Intronic
924543860 1:245006862-245006884 AGGTGGAGGTTGCAGTGATCTGG + Intronic
1064237022 10:13585804-13585826 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
1065604016 10:27397440-27397462 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
1065863659 10:29894052-29894074 ACATGGATGTTGTTGTGTTGGGG + Intergenic
1067122294 10:43483936-43483958 AGATGGAGGTTGCAGGGAGGCGG - Intergenic
1067801189 10:49360700-49360722 AGATAGGGGTTGCTGTGATCTGG + Intergenic
1068083344 10:52346754-52346776 CCCTGGGGGCTGCTGTGATGTGG + Intergenic
1070129965 10:73648955-73648977 AGAGGGAGCTTGCTGGGATGGGG - Intronic
1070731365 10:78830913-78830935 ACATGGGGGCTGCAGGGATGGGG - Intergenic
1071082088 10:81824787-81824809 AAATGGAGGTTGTTGTGTGGAGG - Intergenic
1072809599 10:98448770-98448792 ACATTGTGGTTGCTATGAGGAGG - Intergenic
1072941537 10:99768496-99768518 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1073237525 10:102030853-102030875 AGGTGGAGGTTGCAGTGAGGCGG - Intronic
1074587529 10:114782955-114782977 AAATGGAGGATGCTGGGATGGGG + Intergenic
1074639994 10:115369226-115369248 GGATGGAGGATTCTGTGATGAGG + Intronic
1076617574 10:131766192-131766214 TCATGCAGGCTGCTGTGTTGTGG - Intergenic
1077078497 11:712214-712236 AAATGGAGGTTGCAGTGAGCCGG + Intronic
1077453425 11:2664262-2664284 ACAAGGAGGTTGCTGCAAAGGGG + Intronic
1078025257 11:7689013-7689035 ACATGGAGCTTCATGGGATGTGG - Intergenic
1078094864 11:8290534-8290556 ACAGGGACGTTGATGGGATGGGG + Intergenic
1078225699 11:9389827-9389849 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1078380229 11:10833448-10833470 ATATGGAGGTTGCAGTGAGCCGG + Intronic
1080569731 11:33545005-33545027 ACATGTAGGTTGGTGTGAATGGG - Exonic
1081205910 11:40275495-40275517 AGAAGCAGGTTGCTTTGATGAGG + Intronic
1082836011 11:57650449-57650471 ATATGGAGGTAGCTGTTAAGGGG - Intronic
1083254266 11:61486649-61486671 ACAGGGAGGTTTCTGGGAAGAGG + Intronic
1083281174 11:61628155-61628177 TCATGGAGGTGGCTAGGATGGGG + Intergenic
1083870543 11:65485319-65485341 AGGTGGAGGTTGCAGTGAGGCGG + Intergenic
1084482915 11:69432427-69432449 AAATGGAAGCTGCAGTGATGAGG - Intergenic
1084639508 11:70416318-70416340 AGGTGGAGGTAGCTGTGGTGTGG + Intronic
1085630966 11:78116281-78116303 AGGTGGAGGTTGCAGTGAGGTGG + Intronic
1086342213 11:85857989-85858011 ACATGGAGATTGATGTCAAGTGG + Intronic
1086405247 11:86493909-86493931 GCAGGGAGGATGCTGTCATGAGG - Intronic
1087657240 11:100939021-100939043 AAATGGAGATGGATGTGATGGGG + Intronic
1088502472 11:110496618-110496640 CCATGGGGGTTGCTATGAGGAGG - Intergenic
1088554204 11:111045140-111045162 ACAAGGAAGTAGCTGTGCTGTGG + Intergenic
1089005021 11:115083990-115084012 AGATGGAGGTAGCGGTGGTGGGG - Intergenic
1089567159 11:119377880-119377902 CCATGAAGGTTACTGGGATGTGG - Intronic
1091046046 11:132326607-132326629 CCAAGAAGGTTGCTGAGATGAGG - Intronic
1091791801 12:3276187-3276209 ACTGGGAGGCTGCTGTGATTAGG - Intronic
1092782069 12:11996513-11996535 ACATGGAGGTTGCTGGAGGGTGG - Intergenic
1092957735 12:13565061-13565083 ACACTGAGGTTGCTCTGCTGTGG + Intronic
1093588152 12:20867670-20867692 ACATGGAAGCTTCTGTAATGTGG + Intronic
1094395296 12:29998917-29998939 ACATGGTGCCTGTTGTGATGGGG + Intergenic
1096261449 12:50094865-50094887 AAGTGGAGGTTGCCGTGAGGCGG - Intronic
1097260820 12:57719162-57719184 ACCTGTAGGTTGGGGTGATGGGG - Exonic
1097298855 12:57997294-57997316 ACATGCTGGTTGCTGCAATGGGG + Intergenic
1097331506 12:58336911-58336933 ACATGGAGATTGTTGGTATGTGG - Intergenic
1098770519 12:74547006-74547028 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1100400450 12:94224835-94224857 AGATGGAGGTTGCAGTGAGCCGG + Intronic
1101112360 12:101498268-101498290 AGGTGGAGGTTGCAGTGATTGGG + Intergenic
1101165832 12:102031684-102031706 ACATGAAGGTTTGTGGGATGGGG - Intronic
1102055180 12:109891461-109891483 AGGTGGAGGTTGCTGTGAGTGGG - Intergenic
1103338077 12:120204866-120204888 ACATGGAGGCTTCTATGGTGAGG + Intergenic
1104184519 12:126417062-126417084 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1104675256 12:130708097-130708119 ACCTTGAGGATGCTGTGCTGAGG + Intronic
1106846873 13:33746228-33746250 ATATGAAGGTGGATGTGATGTGG - Intergenic
1107102323 13:36606920-36606942 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
1107523071 13:41202320-41202342 AGATGGAGGTTGCAGTGAGTTGG + Intergenic
1108189400 13:47921985-47922007 AGATGGAGGTTGCAGTGAGCCGG + Intergenic
1108218648 13:48210975-48210997 AAATGGAAGTTGCAGTGATCCGG - Intergenic
1109332020 13:60942027-60942049 ACATGGAGGTTCCTGAAAGGTGG - Intergenic
1109603698 13:64663903-64663925 CCATGCTGGTTGCTGTGGTGGGG - Intergenic
1113597373 13:111543155-111543177 AAATGGAGCTTGTTGAGATGTGG + Intergenic
1113949343 13:114062857-114062879 ACATTGTGGATGCTGTGGTGTGG - Intronic
1115307916 14:31951269-31951291 ACAGGGAGGCTGCTTTGTTGGGG - Intergenic
1116009893 14:39339015-39339037 CCATGGAGGTTGCAGGGAGGAGG + Intronic
1117055690 14:51910092-51910114 ACATGGAGGTTCCTGTCTAGTGG + Intronic
1117166160 14:53036086-53036108 ACATGGAAGTTTCTGGGGTGAGG + Intergenic
1118763784 14:68896473-68896495 ACCAGGAGTTTGCGGTGATGGGG - Intronic
1119566781 14:75635792-75635814 AGGTGGAGGTTGCTGTGAACTGG + Intronic
1120207314 14:81600629-81600651 ACATGGAGGTTGCTAGGGGGAGG - Intergenic
1122138917 14:99650503-99650525 GCAGGGAGGGTGCTGTGGTGTGG + Intronic
1122540448 14:102495142-102495164 AGATGGAGGTTGCAGTGAGCCGG + Intronic
1122629126 14:103099363-103099385 ACATGGGGGTGGCTGAGCTGCGG - Intergenic
1122878965 14:104681510-104681532 ACGTGGAGTTTGCTGAGAGGGGG - Intergenic
1124368256 15:29089033-29089055 ACAGGGAGGCTGCTCTGGTGAGG - Intronic
1124853437 15:33363054-33363076 AGATGAAGGTTGCTGTGTTGGGG - Intronic
1126694632 15:51315429-51315451 AAATGAAGATTGCAGTGATGGGG - Intronic
1127609433 15:60622540-60622562 AGGTGGAGGTTGCAGTGAGGCGG + Intronic
1127803823 15:62500266-62500288 AGATGGAGGTTGCAGTGAGCTGG + Intronic
1128184844 15:65636077-65636099 CCATGGAGGTTGGTGGGGTGAGG + Intronic
1128346532 15:66856559-66856581 AGGTGGAGGTTGCTGTGAGCCGG - Intergenic
1128933864 15:71728907-71728929 AGTTGGAGGTTGCTGTGAGCTGG - Intronic
1129646791 15:77443100-77443122 AGGTGGAGGTTGCAGTGATGAGG - Intronic
1129686057 15:77686716-77686738 CCATTGAGGAGGCTGTGATGGGG - Intronic
1129997367 15:80018229-80018251 AGGTGGAGGTTGCTGTGAGCTGG - Intergenic
1131326410 15:91451185-91451207 AAATGGATGTTGGGGTGATGCGG - Intergenic
1132123494 15:99198372-99198394 ACATGGAGATTGATTGGATGTGG - Intronic
1132489908 16:222210-222232 ACAGGGAGGTTTGTGTGCTGAGG + Intronic
1133096086 16:3446909-3446931 AGATGGAGGTTGCAGTGAGCAGG - Intronic
1133441012 16:5820939-5820961 ACAGGGAGGGCACTGTGATGAGG - Intergenic
1134087605 16:11369001-11369023 ACATGGAGGTTGCAGTGAACCGG - Intronic
1135128867 16:19835194-19835216 AGGTGGAGGTTGCAGTGAGGTGG + Intronic
1135781184 16:25302090-25302112 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1136296415 16:29306301-29306323 ACATGGAGTTGGTTGTGTTGTGG + Intergenic
1136503284 16:30685648-30685670 AGGTGGAGGTTGCAGTGAGGCGG - Intergenic
1136537300 16:30907564-30907586 AGATGGAGGCTGCTGAGCTGAGG + Intergenic
1137404489 16:48178960-48178982 GCTAGGTGGTTGCTGTGATGTGG - Intronic
1137489525 16:48919922-48919944 ACATGGACTTTGCCCTGATGGGG + Intergenic
1139273050 16:65701178-65701200 ACATGGAGGTTCCTGGAAGGTGG + Intergenic
1139327101 16:66161078-66161100 ACCTGGTGGCTGCTGGGATGTGG + Intergenic
1139488986 16:67276485-67276507 AGATGGAGGTTGCAGTGGTGGGG + Intergenic
1140457587 16:75114083-75114105 GCAGGGTGGTGGCTGTGATGAGG + Exonic
1142058010 16:88012446-88012468 ACATGGAGTTGGTTGTGTTGTGG + Intronic
1142890877 17:2941750-2941772 AGGCGGAGGTTGCTGTGAGGAGG - Intronic
1142972891 17:3624721-3624743 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1143976605 17:10835046-10835068 GCATGGAGGCAGCTGTGAAGGGG + Intronic
1144057999 17:11558772-11558794 ACTAGGAGATTTCTGTGATGCGG - Exonic
1144690895 17:17262963-17262985 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1146073163 17:29702583-29702605 AGGTGGAGGTTGCAGTGATCTGG + Intronic
1146683410 17:34824563-34824585 ACATTGACCTTGCTGTCATGAGG + Intergenic
1148378051 17:47168054-47168076 ACATGGAGGTTCCTGGCAGGTGG - Intronic
1148443320 17:47723115-47723137 AGTTGGAGGTTGCAGTGATCTGG - Intergenic
1148929411 17:51116113-51116135 AGATGGAGGTTGCAGTGAGCTGG - Intronic
1148986781 17:51629244-51629266 TCAGAGAGGATGCTGTGATGGGG + Intergenic
1149172622 17:53830031-53830053 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
1149403503 17:56323202-56323224 ACATGGAGGGTGGAGTAATGGGG + Intronic
1150428239 17:65094259-65094281 AAATGGAAGTTGATGTGGTGTGG - Intergenic
1150695870 17:67404904-67404926 ACATGGTGGTTGCTTCGTTGAGG + Intronic
1150923829 17:69512008-69512030 ACAGTGATGTTGCTGTCATGAGG + Intronic
1151226055 17:72649124-72649146 ACATGGAGGATGCTGTGACATGG + Intronic
1153218884 18:2845710-2845732 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
1154179792 18:12124761-12124783 CCATGGAAGTAACTGTGATGTGG + Intronic
1155155634 18:23155224-23155246 ACATGGAGGCTGGTGAGATCTGG + Intronic
1156409310 18:36812487-36812509 ACATGGAAGTTCCTGTAGTGTGG + Intronic
1156460646 18:37319632-37319654 TCCTGGAGGGTGCTGTGGTGTGG - Intronic
1156498635 18:37542992-37543014 AAATGGAGGTGGGTGTGATGGGG - Intronic
1157791621 18:50536823-50536845 AGACGCAGGTTGCTGTAATGTGG + Intergenic
1158228808 18:55230566-55230588 CCATGGAGTTTCTTGTGATGGGG - Intronic
1158522470 18:58183147-58183169 ACATGGAGGTTGCTGGGAGGAGG + Intronic
1159864667 18:73690094-73690116 ACATGGAGGTTGCTGAGGGGAGG + Intergenic
1160413229 18:78688744-78688766 ACATGGAGGCTGCAGAGTTGGGG + Intergenic
1161175108 19:2837369-2837391 AGGTGGAGGTTGCTGTGAGCTGG + Intergenic
1161511518 19:4674907-4674929 GCATGGAGGATGCTGTAATTTGG + Intergenic
1162671665 19:12263154-12263176 AGATGGAGGTTGCGGTGAGCGGG - Intronic
1162753889 19:12845724-12845746 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1163681070 19:18683042-18683064 AGATGGAGGTAAATGTGATGCGG - Intergenic
1164049993 19:21577575-21577597 AGGTGGAGGTTGCTGTGAGCCGG + Intergenic
1164453830 19:28390494-28390516 AGATGGTGGCAGCTGTGATGGGG + Intergenic
1166988890 19:46678723-46678745 CCATGGAGGGTGGTGTGGTGGGG - Intronic
1167016938 19:46847301-46847323 AGGTGGAGGTTGCAGTGAGGCGG - Intronic
1167503674 19:49860662-49860684 ACATGGAGGATGGTGTCCTGAGG + Exonic
1167642712 19:50690599-50690621 ACATGGATGTTACTGGGATCTGG - Intronic
1167835855 19:52069141-52069163 AGTTGGAGGTTGCAGTGAGGTGG - Intronic
1168323699 19:55526076-55526098 AGCTGGAGGTGGCTGGGATGCGG - Intergenic
926689560 2:15724100-15724122 ACTTGGTGGTGGCTGTGGTGAGG + Intronic
929762322 2:44816478-44816500 ACACGGAGGTTGTTGAGATGTGG + Intergenic
931823501 2:65975935-65975957 ACATGGAGATTCCTGGGCTGGGG - Intergenic
932463300 2:71897230-71897252 ACGTGGAGCTGGCTGTGAGGAGG - Intergenic
934025513 2:87998858-87998880 ACATGGAGGTTCCTGGAAGGTGG + Intergenic
935079009 2:99773541-99773563 GGGTGGAGGTTGGTGTGATGGGG + Intronic
935156015 2:100484336-100484358 ACATGGAGGTTGCTGGAGGGTGG + Intergenic
935313841 2:101811675-101811697 ACATGGTGTTTGCTATGAAGTGG + Intronic
935619733 2:105118297-105118319 ACCTGGAGGATGCTGTGCTGCGG + Intergenic
936591156 2:113806001-113806023 AGACGGAGGTTGCTGTGAGCCGG + Intergenic
937152850 2:119697748-119697770 TCAGCGAGGTTGCTGTGAAGAGG - Intergenic
937680739 2:124641377-124641399 TCATGGAGGCAGATGTGATGAGG - Intronic
938288837 2:130138865-130138887 ACATGGACATGGCTGTGCTGTGG + Intergenic
938994051 2:136658789-136658811 ACATGGAGGTTAAGGGGATGAGG + Intergenic
939463084 2:142522768-142522790 ACATGGAAATTGATTTGATGTGG - Intergenic
939993759 2:148901025-148901047 AAATGGTGGTTGCTGAGATGCGG + Intronic
942770686 2:179514727-179514749 ACATGGAGGTTGGGAAGATGAGG + Intronic
943486553 2:188492111-188492133 ACAAAGAGGTTGCTGGGATATGG + Intronic
944124298 2:196275795-196275817 ACATAGTGGTTGCTGTTATGAGG - Intronic
945953382 2:216062113-216062135 AGATGGAGGTTGCAGTGAGCTGG - Intronic
946042927 2:216798013-216798035 AGATAGAGATTGGTGTGATGAGG + Intergenic
946195416 2:218029986-218030008 ACATGGAGATGGCTTGGATGTGG - Intergenic
946501198 2:220249210-220249232 ACATGTAGGTTTCTGTGGAGGGG - Intergenic
946617294 2:221523661-221523683 AGATGGAGGTTGCAGTGAGCCGG - Intronic
947110111 2:226709184-226709206 AAATGGAGGTTGCTGGGTGGAGG + Intergenic
947666841 2:231911257-231911279 CCATGGAGGTGACTGTGAGGAGG + Intergenic
947727750 2:232410345-232410367 CCAAGGAGGCTGCTGTGGTGGGG + Exonic
948365961 2:237454911-237454933 ACATGGAGGTTGATATGGTTTGG - Intergenic
1170724509 20:18914489-18914511 ACATGGAGGTTCCTGGACTGTGG + Intergenic
1170866482 20:20162253-20162275 ACATGAAGGGTTCTATGATGAGG - Intronic
1172782351 20:37444360-37444382 ACATGGAGCTTCCTGGGAAGAGG + Intergenic
1172971859 20:38879437-38879459 ACATGGAGGTTGGGGTGAGGTGG - Intronic
1173078406 20:39843036-39843058 ACATGGAGGTTGGTGTAACCAGG - Intergenic
1173630178 20:44507358-44507380 GCATGGAGCTTGCTGTGAACTGG - Intronic
1173757417 20:45529576-45529598 ACAAGGAGGATGGGGTGATGGGG - Intergenic
1173917258 20:46716951-46716973 AGATGGAGGTTGCAGTGAGCCGG + Intronic
1175858682 20:62137382-62137404 ACATTGAACTTGCTGTCATGAGG - Exonic
1178754985 21:35340419-35340441 ACAGGGAGGTGGCAGTGAGGTGG - Intronic
1179955515 21:44736093-44736115 AGACAGAGGTTGCAGTGATGCGG - Intergenic
1180835357 22:18926956-18926978 ACATGGAGGCCTCTGGGATGCGG - Intronic
1181967461 22:26666978-26667000 ACATGGAGCTTGGTTTCATGGGG + Intergenic
1182442248 22:30371399-30371421 CCATGGAGGCAACTGTGATGAGG - Intronic
1182490599 22:30668793-30668815 GCCTGGAGGATGCAGTGATGGGG - Intronic
1182994989 22:34803657-34803679 AGACAGAGGTTGGTGTGATGTGG - Intergenic
1183242964 22:36672074-36672096 ACATGGACCTTGGTGTGCTGGGG + Intronic
1183843491 22:40520474-40520496 AGATGGAGGTTGCAGTGAACGGG - Intronic
1184440090 22:44505872-44505894 ACATGGATGGTGCTGTGGTTTGG + Intergenic
1184946393 22:47807274-47807296 GGATGGAGGTTGCTGTCACGAGG + Intergenic
1185198550 22:49488370-49488392 ACATGGGGGCTGTTGTGTTGGGG - Intronic
1203285445 22_KI270734v1_random:152255-152277 ACATGGAGGCCTCTGGGATGCGG - Intergenic
949917457 3:8975792-8975814 GCATGGGGGGTGCTGTGGTGGGG - Intergenic
950080377 3:10217859-10217881 GTATGCAGGTTGCTGTGATAAGG + Intronic
950349290 3:12331734-12331756 ACATGGCGATTGGTTTGATGGGG + Intronic
950611331 3:14128537-14128559 ACACAGAGGGTCCTGTGATGGGG - Intronic
952253787 3:31678419-31678441 ACAAGGAGGTGGCTGTGCAGTGG - Intronic
953367039 3:42353956-42353978 ACATGGAGGTGGGTGGGAGGAGG - Intergenic
953465570 3:43116438-43116460 ACATGGACGTTGCAGAGTTGAGG - Intergenic
953705614 3:45227612-45227634 ACATGGTGGTTGCTGTGATGTGG + Intergenic
954167824 3:48774710-48774732 ACATGGAGGTTGCTATATTAAGG - Intronic
954661595 3:52229604-52229626 ACATGGAGATTGGAGTGATAGGG + Intronic
954704801 3:52473805-52473827 TCATCGAGGTTGCTGAGAAGCGG - Exonic
954736885 3:52714625-52714647 CCCTGGAGGTTGCTAGGATGGGG + Intronic
956994674 3:74811319-74811341 TCATGGAGGTAGCTGGTATGTGG + Intergenic
957303117 3:78419688-78419710 ACATGGAGGTTCCTGGAAGGTGG - Intergenic
959393874 3:105811777-105811799 AGGTGGAGGTTGCTGTGAGCCGG - Intronic
961629536 3:128285793-128285815 ACATGGGGATGGCTGTGAAGGGG - Intronic
963876396 3:150480250-150480272 AGATGGAGGTTGCAGTGAGCAGG + Intergenic
963905988 3:150774071-150774093 GCATGCCGGCTGCTGTGATGGGG + Intergenic
966748911 3:183303641-183303663 ACAAGGAGGTGGCAGAGATGGGG - Intronic
966994924 3:185270134-185270156 AGAAGGTGATTGCTGTGATGAGG - Intronic
967446508 3:189573466-189573488 AGATGGAAATTGCTGTGATGTGG - Intergenic
967997249 3:195176124-195176146 AGATGGAGGTTGCAGTGAGTTGG - Intronic
968420696 4:482231-482253 AGATGGAGGTTGCAGTGAGCCGG - Intronic
968834445 4:2952871-2952893 AGGTGGAGGTTGCAGTGAGGTGG + Intronic
971405776 4:26320084-26320106 ACACGGTGGTGGCTGCGATGGGG + Intronic
972301580 4:37790128-37790150 AAATGGAGGTTGCTGAGAGGAGG - Intergenic
976119709 4:81766350-81766372 AGATGGAGTTCGCTCTGATGAGG - Intronic
976290545 4:83413082-83413104 ACATGGAGGGTGCTGTGCCCAGG + Intronic
976355849 4:84116938-84116960 AAGTGGAGGTTGCTGTGAGCCGG - Intergenic
976462610 4:85330176-85330198 ACATGGAGGTTGAGGACATGGGG + Intergenic
978036287 4:103999342-103999364 ACATGGAACATACTGTGATGTGG + Intergenic
979778945 4:124625145-124625167 ACATGAAGCTTGCTGTGGTTTGG + Intergenic
980122763 4:128744811-128744833 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
980243001 4:130201835-130201857 CCCTGGGGGCTGCTGTGATGGGG + Intergenic
982158203 4:152541172-152541194 CCCTGGGGGCTGCTGTGATGGGG - Intergenic
982841600 4:160194797-160194819 ACATGTGGGTTGCTGTGTTGTGG + Intergenic
983943244 4:173558365-173558387 ACAGAGAGGTTGTTGTGGTGTGG + Intergenic
984904191 4:184611561-184611583 ACATGGAGGTTCCTGTAGGGTGG - Intergenic
985306883 4:188553065-188553087 ACAAGAATGTTGCTATGATGAGG - Intergenic
985943929 5:3162398-3162420 ACCTAGTGGTTGCTGTGCTGGGG - Intergenic
986235743 5:5908256-5908278 GGTTGGAGGTTGCAGTGATGGGG + Intergenic
987326762 5:16819380-16819402 AGATGGAGCTTAATGTGATGTGG - Intronic
989717623 5:44482903-44482925 ACATCAAGGTTCCTGTGAAGAGG + Intergenic
989761783 5:45024186-45024208 ACATGAAGGTTCCTGGGAGGTGG - Intergenic
991039557 5:62161844-62161866 GCATGCTGGTTGCTGTGATGGGG + Intergenic
991165535 5:63562671-63562693 ACCTGGAGCTTGCTGAGCTGCGG + Intergenic
991369006 5:65898642-65898664 ATATTAAGGTTGGTGTGATGTGG - Intergenic
992266908 5:75028342-75028364 ATACCGAGGTTGCTATGATGAGG + Exonic
993509519 5:88754293-88754315 ACATAGATCTTGCTGTGATCTGG + Intronic
993722232 5:91333220-91333242 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
994327178 5:98462057-98462079 ACATTCTGGTTGCTTTGATGGGG + Intergenic
994518132 5:100795428-100795450 ATTTGGATGGTGCTGTGATGGGG + Intergenic
995009025 5:107237176-107237198 AAGTGGAGGTTGCTGTGAGCCGG + Intergenic
997867422 5:137476853-137476875 AGGTGGAGGTTGCTGTGAGCTGG + Intronic
998790739 5:145764004-145764026 AGATGGAGGTTGCAGAGAGGTGG + Intronic
999401987 5:151272003-151272025 AGGTGGAGGTTGCAGTGATCTGG + Intergenic
1000596736 5:163223452-163223474 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
1002000423 5:176193766-176193788 GCATGGATGGTGCTGTGCTGAGG - Intergenic
1002253912 5:177945215-177945237 GCATGGATGGTGCTGTGCTGAGG + Intergenic
1002320547 5:178372996-178373018 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1002981861 6:2145466-2145488 AGATGGAGGTTGCAGTGAGCTGG + Intronic
1005622453 6:27632546-27632568 ACCTGGAGGGAGCTCTGATGTGG + Intergenic
1006337279 6:33427414-33427436 ATGTGGAGGTTGCTGTATTGGGG + Intronic
1006512701 6:34530232-34530254 ACATGGATGTAGCTGTGCTCAGG - Exonic
1007764403 6:44152383-44152405 TCAGGGCGGTTGCAGTGATGGGG - Intronic
1008749582 6:54716282-54716304 AGGTGGAGGTTGCTGTGAGCTGG - Intergenic
1009941010 6:70287886-70287908 ACTTAGAGATTGCTGAGATGAGG - Intronic
1010693933 6:78946573-78946595 ACATGCAAGTTCCTATGATGTGG - Intronic
1011939248 6:92822264-92822286 ACATCGAGGTTGCTTTGGTCAGG + Intergenic
1013098929 6:106971868-106971890 ACATGGAGGTAGCTGTGATGTGG - Intronic
1013186408 6:107763454-107763476 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1013274225 6:108568763-108568785 GCATCGATGTTGATGTGATGTGG + Intronic
1013438811 6:110140251-110140273 ACATGGAGGTTCCTGGAAAGTGG + Intronic
1013608402 6:111772207-111772229 ACCTGGATTTTGCTGTGATTAGG - Intronic
1014023669 6:116619090-116619112 ACATGGAGGTTGCTGGAGGGTGG - Intronic
1014814456 6:125920356-125920378 ATAGGGAGTTTGCGGTGATGAGG - Intronic
1015173884 6:130285206-130285228 ACATGGAGCTTGAAGAGATGTGG + Intronic
1015406385 6:132841551-132841573 AGATGGAGGTTGCAGTGAGCCGG + Intergenic
1017805284 6:157940485-157940507 AGATGGAGGTTGCAGTGAGCCGG - Intronic
1018284777 6:162225627-162225649 CCATGGAGGGTGCAGAGATGAGG - Intronic
1018968995 6:168512316-168512338 ACAAGGCGGGTGCTGGGATGGGG - Intronic
1019003246 6:168773439-168773461 AGATGGAGGTTGGTGCCATGAGG - Intergenic
1019484622 7:1283868-1283890 AGATGGAGGTTGCAGTGAGCCGG + Intergenic
1019659431 7:2215765-2215787 ACATGGAGGTTGCTGTGATGGGG - Intronic
1020644319 7:10795711-10795733 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1022103365 7:27182265-27182287 ACTTGGAGGTAGCTTTGAGGTGG - Exonic
1022947382 7:35300917-35300939 ACATGAAGGTTGCTGACAGGAGG + Intergenic
1023047739 7:36225704-36225726 ACACGTAGGTTGGTGTTATGGGG - Intronic
1025115770 7:56256624-56256646 ACATGGAGGTTGCTAGGTGGGGG - Intergenic
1025957918 7:66196848-66196870 AGATGGAGGTTGCAGTGAGCTGG - Intergenic
1026200218 7:68207826-68207848 ACATGGAGGTTGCTAGGTGGAGG - Intergenic
1026231952 7:68491513-68491535 AGGTGGAGGTTGCTGGGATGAGG - Intergenic
1026639011 7:72108175-72108197 AGATGGAGATTGGAGTGATGGGG - Intronic
1026879474 7:73899724-73899746 ACAAAGAGGTTCATGTGATGGGG - Intergenic
1026906426 7:74065542-74065564 AGATGGAGGTTGCAGTGAGCCGG + Intronic
1026922761 7:74168566-74168588 AGATGGAGGTTGCAGTGAGATGG - Intergenic
1026930925 7:74222563-74222585 AAATGGAGGTGGCAGTGGTGGGG - Intronic
1027545664 7:79524531-79524553 ACATGGTGGCTGCTGCCATGTGG + Intergenic
1029278299 7:99420494-99420516 AGAGGGAGGTGGCTTTGATGGGG - Intronic
1029651447 7:101895504-101895526 ACTTTGAAATTGCTGTGATGGGG + Intronic
1032532555 7:132634201-132634223 AAATGGAGGTTGCTAGGTTGAGG + Intronic
1032851409 7:135798806-135798828 ACATCTGGGTGGCTGTGATGTGG - Intergenic
1033849520 7:145478601-145478623 TCATGGTGGATGCTGCGATGTGG + Intergenic
1034266121 7:149781563-149781585 ACATGCAGATTGCTGTGTTTTGG - Intergenic
1035831462 8:2699166-2699188 AGATGGTGGTTGCAGTGAGGTGG - Intergenic
1037692621 8:21195042-21195064 GCATGGAGGGGGCTGTGAGGTGG + Intergenic
1037876817 8:22552502-22552524 CCCTGGAGGTTCCTGTGGTGGGG + Intronic
1038314064 8:26467626-26467648 ACATGAAAATTGCTGTCATGAGG - Intronic
1039785785 8:40833166-40833188 ACATGGAGAGAGGTGTGATGGGG - Intronic
1039862347 8:41469547-41469569 ACATAGAGCTGGCTGTGGTGGGG + Intergenic
1040002602 8:42591787-42591809 AGGTGGAGGCAGCTGTGATGTGG - Intergenic
1040544931 8:48391761-48391783 ACATGCAGATTGCTATGGTGTGG + Intergenic
1041540213 8:58976000-58976022 ACACGGAGGTTGCAGTGAGCCGG + Intronic
1042537981 8:69878267-69878289 ATATGGAGGTTGCAGTGAGCCGG - Intergenic
1045025585 8:98083641-98083663 ACATAGAGGTTCCTGTGAGGAGG - Intronic
1046444480 8:114299086-114299108 AGATGGAGGTTGCAGTGAGCCGG - Intergenic
1046645618 8:116782570-116782592 AGGTGGAGGTTGCTGTGAGCCGG - Intronic
1047280240 8:123439246-123439268 AGATGGAGGTTGCAGTGAGCTGG - Intronic
1047303781 8:123637057-123637079 ATGTGGAGGGTGCTGGGATGTGG - Intergenic
1047482878 8:125301460-125301482 ACATGGAGGTGGCGGTGGGGTGG + Intronic
1049568458 8:143356120-143356142 ACATGCAGGATGCTGTGGTGGGG - Intronic
1049711318 8:144064621-144064643 ACATGGAGGTTGCAGCGAGCAGG + Intergenic
1053137718 9:35662139-35662161 CCAGGAAGGGTGCTGTGATGAGG - Intronic
1055962961 9:81837521-81837543 AGATGGAGGTTGCAGTGAGCAGG + Intergenic
1056950187 9:91035524-91035546 ACATGCAGGGTGCTGTCCTGTGG - Intergenic
1057327357 9:94077635-94077657 ACATGGAGGTTGCTGGAGGGTGG - Intronic
1057462141 9:95272623-95272645 ACGTGGAGGTTGCAGTGAGCTGG + Intronic
1057469957 9:95348725-95348747 AGATGGAGGTTGCAGTGAGCTGG + Intergenic
1057785454 9:98084078-98084100 AACTGGAGGGAGCTGTGATGTGG + Intronic
1057793755 9:98141419-98141441 AGGTGGAGGTTGCAGTGATCCGG - Intronic
1058951268 9:109906083-109906105 ACATGGAAGTGGCTGAGAGGTGG + Intronic
1059000613 9:110344523-110344545 AGATTGAGGCTGCAGTGATGGGG - Intergenic
1059822025 9:117983999-117984021 ACATGTAGGTTTCTGTGTGGGGG + Intergenic
1061607404 9:131721494-131721516 TCATGGAGCTTGCTGTGACTGGG - Intronic
1186769484 X:12803658-12803680 ACATTGAGGATCCTGAGATGGGG - Intronic
1189234483 X:39476905-39476927 ACAGGGAGCTTGCTGGAATGTGG + Intergenic
1189236845 X:39493819-39493841 ACATGGATGCTGCTGGGCTGGGG - Intergenic
1190735666 X:53254616-53254638 ATATGGAGGCTCCTGTGGTGGGG - Exonic
1190927647 X:54923267-54923289 GGATGGAGGCTGCTGTGGTGTGG - Exonic
1191965971 X:66758555-66758577 ACAGGGAGGTTACTGAGCTGAGG - Intergenic
1192168945 X:68842731-68842753 CCATGGTGGTGGCTGTGGTGTGG - Intergenic
1193172619 X:78353998-78354020 ACATGGAGACTGCTCTCATGGGG - Intergenic
1195093750 X:101487265-101487287 GCATGGAGGTTGGTGTGAAGTGG + Intronic
1196794349 X:119490233-119490255 GGATGGAGGCTGCTGTGATGGGG + Intergenic
1197347377 X:125340785-125340807 AGATGGGGGTTCATGTGATGGGG - Intergenic
1197614753 X:128678947-128678969 ACAAGCAGGTTCTTGTGATGAGG - Intergenic
1197918617 X:131563454-131563476 ACATTGTGGTTGCTGTGCTGAGG + Intergenic
1198557272 X:137808396-137808418 AGGTGGAGGTTGCAGTGGTGGGG + Intergenic
1198809346 X:140519885-140519907 AGCTGGAGGTTGCTGTGAGCTGG - Intergenic
1201039196 Y:9812532-9812554 ACATGGATGTTTTTGTGCTGAGG + Intergenic