ID: 1019659432

View in Genome Browser
Species Human (GRCh38)
Location 7:2215766-2215788
Sequence AACATGGAGGTTGCTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 373}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659432_1019659438 -4 Left 1019659432 7:2215766-2215788 CCCATCACAGCAACCTCCATGTT 0: 1
1: 0
2: 0
3: 28
4: 373
Right 1019659438 7:2215785-2215807 TGTTGTAGGTGAGCAGCTGGTGG 0: 1
1: 0
2: 0
3: 19
4: 216
1019659432_1019659439 -3 Left 1019659432 7:2215766-2215788 CCCATCACAGCAACCTCCATGTT 0: 1
1: 0
2: 0
3: 28
4: 373
Right 1019659439 7:2215786-2215808 GTTGTAGGTGAGCAGCTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 185
1019659432_1019659437 -7 Left 1019659432 7:2215766-2215788 CCCATCACAGCAACCTCCATGTT 0: 1
1: 0
2: 0
3: 28
4: 373
Right 1019659437 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 231
1019659432_1019659442 26 Left 1019659432 7:2215766-2215788 CCCATCACAGCAACCTCCATGTT 0: 1
1: 0
2: 0
3: 28
4: 373
Right 1019659442 7:2215815-2215837 CACAATACCGAGGCTCCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 66
1019659432_1019659440 16 Left 1019659432 7:2215766-2215788 CCCATCACAGCAACCTCCATGTT 0: 1
1: 0
2: 0
3: 28
4: 373
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659432_1019659443 30 Left 1019659432 7:2215766-2215788 CCCATCACAGCAACCTCCATGTT 0: 1
1: 0
2: 0
3: 28
4: 373
Right 1019659443 7:2215819-2215841 ATACCGAGGCTCCTCCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659432 Original CRISPR AACATGGAGGTTGCTGTGAT GGG (reversed) Intronic
901348095 1:8565638-8565660 AAGGTGGAGGTTGCAGTGAGCGG + Intronic
901831075 1:11892877-11892899 AAGGTGGAGGTTGCAGTGAGCGG - Intergenic
902231168 1:15028576-15028598 AACAAGGAGGCTGGTGCGATGGG - Intronic
902330795 1:15730369-15730391 AAGATGGAGGTTGCAGTGAGTGG + Intronic
903062070 1:20675967-20675989 GAGATGGAGGTTGCAGTGAGCGG + Intronic
903249724 1:22044027-22044049 GAGATGGAGGTTGCAGTGAGAGG - Intergenic
903320416 1:22539720-22539742 AGAATGGTGGTTGCTGTGGTGGG - Intergenic
903423906 1:23238795-23238817 AACAAGGGGGTTGCTGAGCTGGG + Intergenic
903433470 1:23327617-23327639 AAGGTGGAGGTTGCAGTGAGCGG + Intronic
903853383 1:26321321-26321343 AACGTGGAGGTTAGTGTGATGGG - Intergenic
904006988 1:27368243-27368265 GAGATGGAGGTTGCGGTGAGTGG + Intergenic
904553898 1:31344927-31344949 AAGATTGAGGTTGCAGTGAGCGG - Intronic
904791149 1:33022424-33022446 AAGGTGGAGGTTGCAGTGAGGGG - Intronic
905055126 1:35087061-35087083 GAGATGGAGGCTGCTGTGAGTGG - Intronic
905090248 1:35425139-35425161 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
906943675 1:50277392-50277414 AACTTGGAAGTTACTGTGCTAGG - Intergenic
907189159 1:52633991-52634013 AAGATGGAAGTTGCTGTTAGGGG - Intronic
907490147 1:54804123-54804145 GACAAGGAAGCTGCTGTGATGGG + Intergenic
908206369 1:61854345-61854367 AACGTGAATGCTGCTGTGATTGG + Intronic
908609340 1:65839315-65839337 AACATGCAGGTTTCTTAGATAGG + Intronic
908837656 1:68244052-68244074 AAGGTGGAGGTTGCAGTGAGCGG + Intergenic
908838133 1:68249359-68249381 AAGGTGGAGGTTGCAGTGAGCGG + Intergenic
908957993 1:69658990-69659012 AAATTGGAGGTAGCTGTAATTGG + Intronic
910575273 1:88755981-88756003 GAGGTGGAGGTTGCTGTGAGCGG - Intronic
912011897 1:104976910-104976932 GAGATGGAGGTTGCAGTGAGTGG + Intergenic
912407602 1:109453468-109453490 AACCTGGAGGTTTCTTTGTTTGG - Intergenic
913155890 1:116097930-116097952 AATTGGGAGGTGGCTGTGATAGG + Intergenic
914503279 1:148265742-148265764 CAGATGGAGGTTGCAGTGAGGGG - Intergenic
914510475 1:148328184-148328206 CAGATGGAGGTTGCAGTGAGGGG + Intergenic
915735709 1:158083626-158083648 GACATGGAGGTTACTGTAATAGG + Intronic
915766657 1:158369917-158369939 AACATAGAGGTTGATTTGAAGGG + Intergenic
916272019 1:162953296-162953318 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
917751756 1:178059694-178059716 AACAAGGAGGCTGCTATGGTTGG + Intergenic
918792674 1:188850058-188850080 GAGGTGGAGGTTGCAGTGATCGG - Intergenic
920389425 1:205589848-205589870 AAGAGGGAGGTGGCTGGGATGGG + Intronic
920774735 1:208924956-208924978 AACCTGGAGGTTGGTGAGTTAGG - Intergenic
921623895 1:217357029-217357051 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
923312296 1:232746922-232746944 AACAGGGAGGTTAGTGGGATGGG - Intergenic
923617885 1:235552830-235552852 GAGATGGAGGTTGCAGTGAGCGG - Intronic
924252096 1:242143096-242143118 GAGATGGAGGTTGCAGTGAGCGG - Intronic
1065863658 10:29894051-29894073 CACATGGATGTTGTTGTGTTGGG + Intergenic
1066115632 10:32236878-32236900 AAAGTGGAGGTTGCAGTGAGTGG - Intergenic
1067857264 10:49805543-49805565 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1068007713 10:51409781-51409803 GAGGTGGAGGTTGCAGTGATTGG + Intronic
1068372379 10:56134072-56134094 AAGGTGGAGGTTGCAGTGAGAGG - Intergenic
1068508688 10:57936679-57936701 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
1068897855 10:62227480-62227502 AACAAGGAGGTCACTGTGACTGG + Intronic
1070129966 10:73648956-73648978 AAGAGGGAGCTTGCTGGGATGGG - Intronic
1071545510 10:86526023-86526045 GAGGTGGAGGTTGCAGTGATTGG - Intergenic
1072343475 10:94478884-94478906 AAGGTGGAGGTTGCAGTGAGCGG + Intronic
1072602748 10:96945069-96945091 AAGATGGTGGTTACTGTGATGGG + Intronic
1074345306 10:112679461-112679483 AACATGGAAGCTGATGTGATAGG + Intronic
1074587528 10:114782954-114782976 GAAATGGAGGATGCTGGGATGGG + Intergenic
1075827638 10:125373279-125373301 AAGGTGGAGGTTGCAGTGAGCGG + Intergenic
1075853249 10:125605670-125605692 AAGGTGGAGGTTGCAGTGAGCGG - Intronic
1075891759 10:125957593-125957615 GAGATGGAGGTTGCAGTGAGTGG - Intronic
1076117387 10:127909625-127909647 AACATGGAGGCTGGTGGAATTGG - Intronic
1076149944 10:128153737-128153759 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
1076272394 10:129165844-129165866 CACATGCAGGTTGCAGAGATGGG - Intergenic
1077067658 11:650301-650323 GAGATGGAGGTTGCAGTGAGTGG + Intronic
1077070420 11:668039-668061 GAAATGGAGGTTGCAGTGAGCGG + Intronic
1077453424 11:2664261-2664283 AACAAGGAGGTTGCTGCAAAGGG + Intronic
1077758193 11:5059188-5059210 AACAAGGTTGTTTCTGTGATTGG - Exonic
1078562418 11:12384755-12384777 AAGAAGGAGGTTGATGTGACTGG + Intronic
1080569732 11:33545006-33545028 TACATGTAGGTTGGTGTGAATGG - Exonic
1082836012 11:57650450-57650472 AATATGGAGGTAGCTGTTAAGGG - Intronic
1083232126 11:61329313-61329335 AACTGTGAGGTTGATGTGATAGG - Intronic
1083290469 11:61687133-61687155 AAGATGGAGGTTGGAGGGATGGG - Intronic
1083658040 11:64239502-64239524 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1084938492 11:72600078-72600100 CACAAGGAGGTTGGTGTGACTGG + Intronic
1085837143 11:79969099-79969121 AACCTGGAGGTTGTAGTGAGCGG + Intergenic
1086102035 11:83110783-83110805 AACCTGGAGGTTGCAGTGAGTGG - Intergenic
1086483185 11:87267761-87267783 GAGGTGGAGGTTGCTGTGAGTGG - Intronic
1087677747 11:101182025-101182047 AACATGGTTGTTGCTTTCATTGG - Intergenic
1089787185 11:120916088-120916110 AACAAGGAGGTGGCTCTGAGTGG + Intronic
1091554847 12:1564865-1564887 AAGGTGGAGGTTGCAGTGAGCGG + Intronic
1092112847 12:5976163-5976185 GACATGGAGGATGCCGTGATGGG - Exonic
1092210369 12:6642129-6642151 AATATGCAGGATGGTGTGATGGG - Intronic
1093039337 12:14360834-14360856 GACGTGGAGGTTGCAGTGAGGGG - Intergenic
1093669831 12:21860662-21860684 TACGTGGAGCTTGCTGTAATAGG - Intronic
1095390288 12:41697984-41698006 AAAATGCATGTTGCTCTGATAGG - Intergenic
1098637380 12:72800999-72801021 GAGACGGAGGTTGCAGTGATCGG + Intergenic
1100327859 12:93556596-93556618 AAGATGAAGGTTGCAGTGAGTGG + Intergenic
1100500082 12:95165706-95165728 GAAATGGAGGTTGCAGTGAGTGG - Intronic
1100563204 12:95769825-95769847 GAGATGGAGGTTGCAGTGAGCGG - Intronic
1101112359 12:101498267-101498289 GAGGTGGAGGTTGCAGTGATTGG + Intergenic
1101117502 12:101546690-101546712 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1101702038 12:107183285-107183307 AACATGGTGGCTGCTGTTAGAGG - Intergenic
1102055181 12:109891462-109891484 GAGGTGGAGGTTGCTGTGAGTGG - Intergenic
1102821090 12:115909816-115909838 GACATGGAGGTTGTAGTGAGCGG - Intergenic
1103472357 12:121192048-121192070 AACAAGCAGGATGCTGTGATAGG + Intergenic
1104424205 12:128661330-128661352 AACCTAGCTGTTGCTGTGATGGG - Intronic
1104755237 12:131265033-131265055 AACGTGGAGGATGCTGTGCTGGG + Intergenic
1105382122 13:19897000-19897022 GAGGTGGAGGTTGCAGTGATCGG + Intergenic
1105512881 13:21065708-21065730 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
1105690314 13:22831181-22831203 GAGGTGGAGGTTGCTGTGAGCGG - Intergenic
1107930589 13:45304059-45304081 AGCATGGAGGATGCTGAGACTGG - Intergenic
1110792670 13:79602350-79602372 CACATGGAGGTTGCTGGGGAGGG - Intergenic
1111371852 13:87329391-87329413 AACATAGATGCTGCTGTGAAGGG + Intergenic
1111924021 13:94443682-94443704 AACAGTCAGGTTGGTGTGATCGG - Intronic
1112256125 13:97832825-97832847 AGCCTGCAGGTTGCTGTGTTTGG - Intergenic
1113554819 13:111224300-111224322 GTGATGGTGGTTGCTGTGATTGG + Intronic
1114067109 14:19070248-19070270 AAGATGGAGCTTGGAGTGATTGG + Intergenic
1114067148 14:19070799-19070821 AACATGGAGCTTGAAATGATTGG + Intergenic
1114067202 14:19071499-19071521 AAGATGGAGCTTGGAGTGATTGG + Intergenic
1114095060 14:19328529-19328551 AAGATGGAGCTTGGAGTGATTGG - Intergenic
1114095114 14:19329229-19329251 AACATGGAGCTTGAAATGATTGG - Intergenic
1114095156 14:19329780-19329802 AAGATGGAGCTTGGAGTGATTGG - Intergenic
1114500509 14:23164919-23164941 GAGATGGAGGTTGCAGTGAGTGG + Intronic
1115253095 14:31369861-31369883 GAGACGGAGGTTGCTGTGACCGG + Intronic
1115780569 14:36763956-36763978 AAGGTGGAGGTTGCAGTGAGTGG + Intronic
1116019708 14:39445232-39445254 AAGGTGGAGGTTGCCGTGAGCGG + Intergenic
1116697699 14:48199220-48199242 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1116791822 14:49347724-49347746 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1117697240 14:58378063-58378085 AACTAGGAGGTTGCAGTGAGCGG + Intergenic
1118025517 14:61764003-61764025 GAGGTGGAGGTTGCAGTGATAGG - Intronic
1118763785 14:68896474-68896496 AACCAGGAGTTTGCGGTGATGGG - Intronic
1118769798 14:68935091-68935113 GAGATGGAGGTTGCAGTGAGCGG - Intronic
1119237820 14:73034438-73034460 GAGGTGGAGGTTGCTGTGAGGGG - Intergenic
1119321318 14:73732713-73732735 AAGACGGAGGTTGCAGTGAGTGG + Intronic
1119566050 14:75630293-75630315 AACATGGAGGCAGCTGGGATGGG - Intronic
1121672125 14:95718562-95718584 AATATGTAGGTTGCTTTGAGTGG + Intergenic
1121901192 14:97694717-97694739 GAGGTGGAGGTTGCTGTGAGCGG + Intergenic
1123167207 14:106337388-106337410 AACCTGGAGGTTTCTTTGTTTGG + Intergenic
1123169825 14:106362099-106362121 AACCTGGAGGTTTCTTTGTTTGG + Intergenic
1123199195 14:106645763-106645785 AACCTGGAGGTTTCTTTGTTTGG + Intergenic
1124853438 15:33363055-33363077 CAGATGAAGGTTGCTGTGTTGGG - Intronic
1125005472 15:34811860-34811882 AAGGTGGAGGTTGCAGTGAGTGG - Intergenic
1125033421 15:35095588-35095610 GAGATGGAGGTTGCAGTGAGTGG + Intergenic
1125585591 15:40816998-40817020 AAGGTGGAGGTTGCAGTGAGCGG + Intronic
1125702844 15:41703669-41703691 GAGATGGAGGTTGCAGTGAGTGG + Intronic
1125857108 15:42961181-42961203 GAGATGGAGGTTGCAGTGAGTGG - Intronic
1126534435 15:49745980-49746002 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
1127909015 15:63400335-63400357 GAGATGGAGGTTGCAGTGAGCGG + Intergenic
1128029556 15:64467772-64467794 GAGATGGAGGTTGCAGTGAGTGG + Intronic
1129360820 15:75022873-75022895 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
1129654799 15:77516919-77516941 AGGGTGGAGGCTGCTGTGATAGG + Intergenic
1130016002 15:80186938-80186960 GACATGCAGGGTGCTGTGATGGG - Exonic
1131277182 15:90991994-90992016 AGCAAGGAGGTCGCTGTGACAGG - Intronic
1131541216 15:93276927-93276949 AAGGTGGAGGTTGCAGTGAGCGG + Intergenic
1131899898 15:97076484-97076506 AGCATGGAGTATGCTGTGACTGG - Intergenic
1132137544 15:99357477-99357499 AGCATGAAGGTTGCTGTGCCTGG - Intronic
1133247379 16:4458152-4458174 GAGGTGGAGGTTGCAGTGATTGG + Intergenic
1133300719 16:4780906-4780928 AGGTTGGAGGTTGCTGTGAACGG + Intronic
1134669388 16:16043670-16043692 GAGGTGGAGGTTGCTGTGAGTGG - Intronic
1134987416 16:18665543-18665565 AAGACGGAGGTTGCAGTGAGCGG + Intergenic
1134998693 16:18758922-18758944 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1135181549 16:20278931-20278953 TACATGGAGGGTGCTTTTATGGG - Intergenic
1135424922 16:22327647-22327669 AACACAGAGGTGGCTGGGATCGG - Intronic
1138497689 16:57418173-57418195 GACCTGGAGACTGCTGTGATTGG + Intergenic
1139488985 16:67276484-67276506 GAGATGGAGGTTGCAGTGGTGGG + Intergenic
1139592494 16:67941231-67941253 GAGATGGAGGTTGCAGTGAGTGG + Intronic
1141959846 16:87398091-87398113 GACACGGAGGTTGCAGTGAGCGG - Intronic
1142339726 16:89513443-89513465 GAGGTGGAGGTTGCTGTGAGTGG + Intronic
1143548849 17:7616238-7616260 AAGGTGGAGGTTGCAGTGAGTGG + Intronic
1145233634 17:21193078-21193100 CAACTGGAGGTTGATGTGATAGG + Intronic
1149425226 17:56548374-56548396 GACGTGGAGGTTGCAGTGAGTGG + Intergenic
1149746206 17:59100949-59100971 GAGATGGAGGTTGCAGTGAGCGG + Intronic
1149932492 17:60769843-60769865 GAGATGGAGGTTGCAGTGAGCGG - Intronic
1150327459 17:64268439-64268461 AACAGGGTGGTTGAAGTGATAGG + Intergenic
1151106984 17:71626471-71626493 AAGAAGGAGGTTGCTATGAATGG + Intergenic
1151737880 17:75956615-75956637 AAGGTGGAGGTTGCAGTGAGCGG + Intronic
1153025652 18:670112-670134 GAGATGGAGGTTGCCGTGAGCGG - Intronic
1153246306 18:3075834-3075856 CAACTGGAGATTGCTGTGATCGG + Intronic
1153639505 18:7144460-7144482 AAGTTGGAGGTTGCAGTGAGCGG + Intergenic
1155070992 18:22316008-22316030 GAGATGGAGGTTGCAGTGAGTGG + Intergenic
1155261249 18:24044554-24044576 AAGGTGGAGGTTGGTGTGACAGG + Intronic
1155699446 18:28724903-28724925 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
1156498636 18:37542993-37543015 AAAATGGAGGTGGGTGTGATGGG - Intronic
1156536570 18:37870401-37870423 AAGGTGGAGGTTGCAGTGAGTGG - Intergenic
1156933271 18:42671322-42671344 AACAAGGCGGAAGCTGTGATTGG + Intergenic
1157037691 18:43996188-43996210 AAAATTGGGGTTACTGTGATTGG - Intergenic
1158683869 18:59595039-59595061 GAGATGGAGGTTGCAGTGAGCGG + Intronic
1160250405 18:77198895-77198917 GACATGGACGTTGCTGTCCTGGG - Intergenic
1160413228 18:78688743-78688765 AACATGGAGGCTGCAGAGTTGGG + Intergenic
1162113121 19:8412029-8412051 AAGGTGGAGGTTGCAGTGAGCGG - Intronic
1162557045 19:11393642-11393664 AAGGTGGAGGTTGCAGTGAGTGG - Intronic
1162671666 19:12263155-12263177 GAGATGGAGGTTGCGGTGAGCGG - Intronic
1162984975 19:14263992-14264014 GAGGTGGAGGTTGCTGTGAGCGG + Intergenic
1163513694 19:17750527-17750549 GAGATGGAGGTTGCAGTGAGCGG - Intronic
1164106468 19:22110660-22110682 AACCTGGAGGTTTCTATGTTTGG - Intergenic
1165836275 19:38758515-38758537 GAGATGGAGGTTGCAGTGAGCGG - Intronic
1166120258 19:40682195-40682217 GACTTGGAGGTTGCGGTGAGCGG - Intronic
1166296248 19:41891351-41891373 GAGATGGAGGTTGCAGTGAGTGG - Intronic
1166945969 19:46396435-46396457 GAGGTGGAGGTTGCAGTGATCGG + Intergenic
1166988892 19:46678724-46678746 ACCATGGAGGGTGGTGTGGTGGG - Intronic
1167002545 19:46754675-46754697 GAGATGGAGGTTGCAGTGAGCGG - Intronic
1167879640 19:52445265-52445287 GAGTTGGAGGTTGCAGTGATCGG - Intronic
1168032407 19:53691251-53691273 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1168156261 19:54474528-54474550 AAGGTGGAGGTTGCAGTGAGTGG - Intergenic
926091124 2:10050334-10050356 GAGATGGAGGTTGCAGTGAATGG + Intronic
926749247 2:16185529-16185551 TACATGGAGATTGCTGTGAGTGG - Intergenic
926927388 2:18001531-18001553 AACCTGGAGGTTTCTTTGTTTGG + Intronic
927289287 2:21388854-21388876 AACATGCAGGAGTCTGTGATGGG + Intergenic
927392709 2:22612866-22612888 AAGATGGAGGTTGCAGTAAGTGG + Intergenic
927545456 2:23949009-23949031 GAGATGGAGGTTGCAGTGAGGGG - Intronic
927668611 2:25050057-25050079 GAGGTGGAGGTTGCTGTGAGTGG + Intronic
929065290 2:37966911-37966933 AAAATGCATGTTGCTCTGATAGG - Intronic
929518049 2:42622322-42622344 GACAGGGAGGTTGCAGTGAGCGG + Intronic
930730936 2:54726640-54726662 AACATGGTAGTTGTTGTGCTTGG + Intronic
930796265 2:55394914-55394936 AAGGTGGAGGTTGCAGTGAGTGG - Intronic
931290361 2:60867625-60867647 AAGATGGAGGCTGCAGTGAGCGG + Intergenic
931598427 2:63976238-63976260 TACTTGGGGGTTGCTGAGATGGG + Intronic
931823502 2:65975936-65975958 AACATGGAGATTCCTGGGCTGGG - Intergenic
932167663 2:69522872-69522894 AACATGGAGGTTGTGCTGTTTGG - Intronic
932736072 2:74255647-74255669 AACGTGGAGGCTGCTGGGAAGGG - Intronic
935679166 2:105621137-105621159 AAGATGGAGCATGCTGTGATTGG - Intergenic
937482920 2:122281446-122281468 AACCTGGAAGGTGCCGTGATGGG + Intergenic
938340775 2:130534689-130534711 AAGGTGGAGGTTGCAGTGAGCGG + Intergenic
938349055 2:130586022-130586044 AAGGTGGAGGTTGCAGTGAGCGG - Intergenic
938484537 2:131690876-131690898 AACATGGAGCTTGAAATGATTGG + Intergenic
938484572 2:131691411-131691433 AAGATGGAGTTTGTTGTAATTGG + Intergenic
938484585 2:131691559-131691581 AAGATGGAGCTTGGAGTGATTGG + Intergenic
939723000 2:145678515-145678537 AACAAGGAGGCTGCAGTGAGCGG + Intergenic
942944098 2:181654853-181654875 GAGTTGGAGGTTGCTGTGAGCGG - Intronic
943272604 2:185826365-185826387 AGCAAGGAGGTTAGTGTGATTGG - Intronic
943323903 2:186475314-186475336 AAGGTGGAGGTTGCAGTGAACGG + Intergenic
944074190 2:195709300-195709322 GAGGTGGAGGTTGCTGTGAGTGG - Intronic
944795315 2:203178233-203178255 GAGATGGAGGTTGCAGTGAGCGG - Intronic
945484358 2:210377590-210377612 CACATTGATGTTGCTGTGAGGGG - Intergenic
946258800 2:218467956-218467978 AAGGTGGAGGTTGCAGTGAGCGG - Intronic
946418209 2:219551118-219551140 GACATGGAACTTGCTGAGATGGG + Intronic
946667824 2:222069175-222069197 AACACTGGGCTTGCTGTGATGGG - Intergenic
947210789 2:227706698-227706720 GAGATGGAGGTTGCAGTGAGTGG + Intronic
947582725 2:231331667-231331689 AGCCTGCAAGTTGCTGTGATTGG + Intronic
948303639 2:236929691-236929713 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
1169631235 20:7634921-7634943 AAGGTGGAGGTTGCAGTGAGTGG - Intergenic
1170527611 20:17256669-17256691 AACATGGAGGTTTCTTACATAGG + Intronic
1172354107 20:34267600-34267622 GAGGTGGAGGTTGCTGTGAGTGG - Intronic
1172509456 20:35490240-35490262 AAGGTGGAGGTTGCAGTGAGCGG + Intronic
1173304005 20:41830805-41830827 AACATGGTGGTGGGAGTGATGGG - Intergenic
1174461819 20:50688736-50688758 ACCATGGACGCTGCTGTGCTGGG + Intronic
1175032676 20:55971283-55971305 AACATAGAGATTGGTGTGAGAGG + Intergenic
1175917586 20:62433903-62433925 GACAAGGAGGTGTCTGTGATGGG + Intergenic
1177725384 21:24960328-24960350 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
1178021084 21:28409249-28409271 GAGGTGGAGGTTGCAGTGATCGG - Intergenic
1180485586 22:15792832-15792854 AAGATGGAGCTTGGAGTGATTGG + Intergenic
1180485625 22:15793366-15793388 AACATGGAGCTTGAAATGATTGG + Intergenic
1180485678 22:15794066-15794088 AAGATGGAGCTTGGAGTGATTGG + Intergenic
1182161723 22:28129132-28129154 AACTTTGAGATTGCTGTCATTGG - Intronic
1182453169 22:30433090-30433112 CACATGGAGTTTGCTGTGGTTGG + Intergenic
1182490600 22:30668794-30668816 AGCCTGGAGGATGCAGTGATGGG - Intronic
1183204067 22:36406426-36406448 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
1183242963 22:36672073-36672095 AACATGGACCTTGGTGTGCTGGG + Intronic
1183843492 22:40520475-40520497 GAGATGGAGGTTGCAGTGAACGG - Intronic
1184401906 22:44279342-44279364 ACCAAGGAGGCTTCTGTGATTGG - Intronic
1184555010 22:45228413-45228435 GTCATGGAGGCTGCTGTGACAGG - Intronic
1184917694 22:47583330-47583352 GAGATGGAGGTTGCAGTGAACGG - Intergenic
1185055968 22:48578501-48578523 AACATGGAGATCTCTGTGAAGGG - Intronic
1185198551 22:49488371-49488393 AACATGGGGGCTGTTGTGTTGGG - Intronic
950963106 3:17126130-17126152 AAAATGGTGCTTGCTATGATTGG - Intergenic
951590719 3:24261426-24261448 GAGATGGAGGTTGCAGTGAGCGG + Intronic
952067260 3:29585604-29585626 CACATGTCGGTTGCTGTGCTAGG - Intronic
954661594 3:52229603-52229625 CACATGGAGATTGGAGTGATAGG + Intronic
955019365 3:55104372-55104394 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
956024545 3:64969194-64969216 AACTTGGAGGCTGCTCTGACAGG + Intergenic
956583656 3:70841450-70841472 AAGGTGGAGGTTGCAGTGAGCGG - Intergenic
957559186 3:81799819-81799841 AACTTGGAGAATGCTGTGCTAGG - Intergenic
958592389 3:96174754-96174776 AACATGGAGGTTTCTTTTCTTGG + Intergenic
959365644 3:105454737-105454759 AAGGTAGAGGTTGCAGTGATCGG - Intronic
959493757 3:107023929-107023951 AACATGGATGATGCTATGAGGGG + Intergenic
959669283 3:108956302-108956324 GAGACGGAGGTTGCTGTGAGCGG + Intergenic
959780831 3:110231395-110231417 GACATGCAGGATGCTGTTATTGG + Intergenic
961334299 3:126160960-126160982 ACCATGAAGATTGCAGTGATTGG - Exonic
963875340 3:150469015-150469037 GAGGTGGAGGTTGCTGTGAGCGG - Intergenic
965935983 3:174112474-174112496 GAAATAGAAGTTGCTGTGATCGG - Intronic
969117835 4:4883936-4883958 AAGTTTGAGCTTGCTGTGATGGG + Intergenic
971336954 4:25732001-25732023 GAAGTGGAGGTTGCAGTGATCGG + Intergenic
971460777 4:26893654-26893676 ACCAAGGAGGTTGCTGGGTTAGG + Intronic
971490340 4:27205479-27205501 GAGATGGAGGTTGCAGTGAGTGG + Intergenic
971611670 4:28733685-28733707 AACGTGGAGGTTTGTTTGATAGG + Intergenic
973058863 4:45694074-45694096 AAAATGGAGGTTCCTGGGCTAGG - Intergenic
973665286 4:53153011-53153033 ACCATGAAGGTTGCTGTCATGGG + Intronic
976554250 4:86432343-86432365 GAGATGGAGGTTGCAGTGAGTGG - Intronic
977538473 4:98284772-98284794 TACCTGGAGGTTGCTGTGTCAGG + Intronic
977568679 4:98608459-98608481 AACATGCAGCTTGCTGTGCTGGG - Intronic
979951667 4:126900407-126900429 AAGGTGGAGGTTGCTGTGAACGG + Intergenic
980176218 4:129347945-129347967 AAGATGGAGGTTGCAGTGAGCGG + Intergenic
981903729 4:149895498-149895520 AACAAGGAGGTCACTCTGATGGG + Intergenic
982745398 4:159101075-159101097 AACATGGAGGCTAATGTGCTTGG + Intergenic
983001274 4:162417782-162417804 GACGTGGAGGTTGCAGTGAGCGG + Intergenic
985587769 5:749797-749819 AACATGGAGGCTGCTGGGGAAGG + Intronic
985602434 5:842264-842286 AACATGGAGGCTGCTGGGGAAGG + Intronic
986235742 5:5908255-5908277 AGGTTGGAGGTTGCAGTGATGGG + Intergenic
987257880 5:16175398-16175420 AACATGAAGGTGGCTAGGATGGG + Intronic
987567614 5:19613072-19613094 AAGACGGAGGTTGCAGTGAGCGG + Intronic
989191419 5:38673391-38673413 AACAAGCAGGTTGCTGTGACTGG + Intergenic
990042206 5:51388945-51388967 TACATGGATGTTCCTGAGATGGG - Intronic
990748830 5:58989806-58989828 AGCATGGATATTGTTGTGATAGG + Exonic
991039556 5:62161843-62161865 GGCATGCTGGTTGCTGTGATGGG + Intergenic
991606457 5:68406798-68406820 AGCATGCAGCTTGCTGTGCTTGG - Intergenic
991700796 5:69314392-69314414 GACATGGAGGTTGCAGTGAGCGG + Intronic
992414243 5:76537771-76537793 AACATGCAGGTCTGTGTGATGGG + Intronic
992493927 5:77272819-77272841 AACTAGGAGGTTTCTGTGCTGGG + Intronic
994327177 5:98462056-98462078 AACATTCTGGTTGCTTTGATGGG + Intergenic
994518131 5:100795427-100795449 AATTTGGATGGTGCTGTGATGGG + Intergenic
995150139 5:108833801-108833823 AAGGTGGAGGTTGCAGTGAGCGG + Intronic
995675781 5:114660846-114660868 AGCATGAAGTTTGCTGGGATGGG - Intergenic
995924179 5:117349914-117349936 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
996677660 5:126195159-126195181 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
997087310 5:130817287-130817309 GACACGGAGGTTGCAGTGAGTGG - Intergenic
999456685 5:151722538-151722560 AGCAAGGAGGTAGTTGTGATTGG - Intergenic
999462780 5:151771448-151771470 GACACGGAGGTTGCTCTGCTCGG - Exonic
1000740977 5:164969494-164969516 AACCTGGAGGTTTCTTTGTTTGG - Intergenic
1000854902 5:166385903-166385925 AAGATGGAGGTTGCAGTGAGTGG - Intergenic
1000956894 5:167554106-167554128 AAAATGGATATTGCTGTGGTGGG - Intronic
1000993249 5:167932891-167932913 AACATGTAGGCTGCTATGGTTGG - Intronic
1003541580 6:7022877-7022899 AAGGTGGAGGTTGCAGTGAGCGG + Intergenic
1004393910 6:15231772-15231794 GAGGTGGAGGTTGCTGTGAGCGG - Intergenic
1004672759 6:17813407-17813429 GAGATGGAGGTTGCAGTGAGCGG + Intronic
1004718125 6:18238624-18238646 GAGATGGAGGTTGCAGTGAGTGG + Intronic
1005332386 6:24762288-24762310 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
1005389220 6:25316480-25316502 GAGATGGAGGTTGCGGTGAGTGG - Intronic
1006341070 6:33447358-33447380 AAAATGGAGGTGGCTCTGGTTGG - Intronic
1006898704 6:37486493-37486515 GACATGGAAGTGGCTGAGATGGG - Intronic
1007450723 6:41939265-41939287 AGCAAGCAGGCTGCTGTGATTGG - Intronic
1007654125 6:43441969-43441991 AAGATGGAGGTTGCAGTGGCAGG + Intronic
1010563582 6:77381522-77381544 GAGATGGAGGTTGCTGTCAGCGG + Intergenic
1010938663 6:81889824-81889846 AACATGGATTTTGCTCTGCTCGG + Intergenic
1013077802 6:106786590-106786612 GAGATGGAGGTTGCAGTGAGTGG + Intergenic
1013184534 6:107746318-107746340 ACCAGGGAGGTTGCTGTGGGTGG + Intronic
1013197053 6:107853418-107853440 AGAATGGTGGTTGCTGGGATGGG - Intergenic
1015044843 6:128764637-128764659 AATATGGATGTTCCTGTGTTGGG - Intergenic
1016580931 6:145628814-145628836 AACATGGGAGTGGCTGTCATGGG - Intronic
1016609895 6:145976851-145976873 GAGATGGAGGTTGCAGTGAGTGG + Intergenic
1018144593 6:160872313-160872335 AACATAGAGGTCAGTGTGATTGG + Intergenic
1018601296 6:165545301-165545323 AAGATGGAGCTTGAGGTGATGGG - Intronic
1019659432 7:2215766-2215788 AACATGGAGGTTGCTGTGATGGG - Intronic
1019731274 7:2630965-2630987 GAGATGGAGGTTGCGGTGAGTGG - Intergenic
1022115305 7:27255622-27255644 AAGGTGAAGGTTGCAGTGATTGG - Intergenic
1023333331 7:39142014-39142036 GAGATGGAGGTTGCAGTGAGCGG + Intronic
1023755013 7:43408148-43408170 AACTGGGAGGTTCCTGGGATAGG + Intronic
1024014690 7:45302000-45302022 AGAATGGTGGTTGCTGGGATTGG + Intergenic
1025076632 7:55949601-55949623 AAGGTGGAGGTTGCAGTGAGCGG - Intergenic
1025189049 7:56882843-56882865 GAGGTGGAGGTTGCAGTGATCGG - Intergenic
1026263389 7:68775060-68775082 AAAGTGGAGGTTGCGGTGAGCGG + Intergenic
1026639012 7:72108176-72108198 AAGATGGAGATTGGAGTGATGGG - Intronic
1026930926 7:74222564-74222586 AAAATGGAGGTGGCAGTGGTGGG - Intronic
1026939550 7:74279410-74279432 AAGGTGGAGGTTGCAGTGAGTGG - Intergenic
1026958847 7:74395832-74395854 AATCTGGAGGTAGCTGTGACTGG + Intronic
1026994731 7:74608023-74608045 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
1028622633 7:92842008-92842030 ATAATGGAGGTTGCTGTTCTGGG + Intergenic
1028711519 7:93914516-93914538 AGGATGGAGGTTGCAGTGAGTGG + Intergenic
1030338185 7:108347952-108347974 AACATGGTGAGTGCAGTGATTGG - Intronic
1030697748 7:112604082-112604104 AAAATGGAGGTTGCAGTAAGCGG - Intergenic
1032811822 7:135426850-135426872 GAGATGGAGGTTGCAGTGAGTGG + Intronic
1033471014 7:141648893-141648915 AACACTGAGATTGCTGGGATGGG + Intronic
1034693586 7:153034471-153034493 GAGATGGAGGTTGCAGTGAGCGG - Intergenic
1034750374 7:153562651-153562673 AACATGGTGGTAGCTGTCACCGG - Intergenic
1035007820 7:155681989-155682011 AAGGTGGAGGTTGCAGTGAGTGG - Intronic
1037658854 8:20910181-20910203 AACATGGAGGCTGCTGATAGGGG + Intergenic
1038164945 8:25076844-25076866 AACATGGAGGTTTCTCATATTGG + Intergenic
1039826028 8:41174689-41174711 ACCATGGAGGTTGATGTGGGAGG + Intergenic
1039938318 8:42067363-42067385 GAGGTGGAGGTTGCAGTGATTGG - Intergenic
1040316489 8:46263628-46263650 AACATGGGGGCTTCTGAGATGGG - Intergenic
1040956954 8:52989362-52989384 GAAATGGAGGTTGCAGTGATCGG - Intergenic
1041349052 8:56930288-56930310 AACATTGTGGTTGGTCTGATTGG - Intergenic
1044586439 8:93873150-93873172 GAGACGGAGGTTGCTGTGAGCGG + Intronic
1044984697 8:97747291-97747313 AACATAGATGTTGCTGTGAAGGG - Intergenic
1046382757 8:113472492-113472514 AAAGTGGAGGTTGCAGTGAGCGG + Intergenic
1046945351 8:119969193-119969215 AAGATAGAGGATGCTGTGAATGG + Intronic
1047452978 8:124983330-124983352 TAAATGAAAGTTGCTGTGATAGG + Intergenic
1047603861 8:126454875-126454897 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1049568459 8:143356121-143356143 CACATGCAGGATGCTGTGGTGGG - Intronic
1049939626 9:532922-532944 AACAGGGAGGTGGCTGTGCTTGG + Intronic
1050274516 9:3983020-3983042 CACATGGAGCTTGATGTGGTTGG + Intronic
1050327209 9:4509215-4509237 AGCAAGGAGTTTGCTGTGACTGG + Intronic
1050633030 9:7580781-7580803 ATAATGGAGATTGATGTGATCGG - Intergenic
1055035961 9:71818785-71818807 AAGATGGAGGATGCAGTGAGCGG + Intergenic
1055110518 9:72555264-72555286 GAGATGGAGGTTGCTGTGAGCGG - Intronic
1055154215 9:73040564-73040586 GAGATGGAGGTTGCAGTGAGTGG + Intronic
1056277380 9:85006520-85006542 GACAAGGAGGCTGCTGTGGTTGG + Intronic
1056546719 9:87619951-87619973 GCCATGGAGGATGCTGTAATGGG - Intronic
1057003177 9:91531714-91531736 GAGATGGAGGTTGCAGTGAGTGG - Intergenic
1057344133 9:94233071-94233093 AACATGGAGGATGCAGTGTGAGG + Intergenic
1057596847 9:96421713-96421735 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
1059957770 9:119536054-119536076 AACATGAAGGTAGCTGGGGTGGG + Intergenic
1060078150 9:120614093-120614115 AAGATGGAGGTTGCAGTGAGTGG - Intronic
1060127354 9:121061115-121061137 GACATGGAGGTTGTAGTGAGCGG + Intergenic
1060568499 9:124615903-124615925 GTCATGGAGGTTGCAGTGAGCGG - Intronic
1061345944 9:130025107-130025129 AAGGTGGAGGTTGCAGTGAGTGG + Intronic
1061607405 9:131721495-131721517 CTCATGGAGCTTGCTGTGACTGG - Intronic
1062552178 9:137094083-137094105 GACGTGGAGGTTGCAGTGAGTGG - Intronic
1187899405 X:24013331-24013353 AAGGTGGAGGTTGCAGTGAGTGG - Intronic
1188432367 X:30118607-30118629 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
1190292672 X:49003058-49003080 CAAGCGGAGGTTGCTGTGATCGG - Intergenic
1190949411 X:55128139-55128161 AACTTGGATGTTGCCGAGATGGG - Intronic
1190978665 X:55433711-55433733 AACATTGAGACTACTGTGATAGG - Intergenic
1191695987 X:63991098-63991120 AATATGGGGTTTTCTGTGATTGG - Intergenic
1192444342 X:71199250-71199272 AATGTGGAGGTTGCAGTGAGCGG + Intergenic
1192572219 X:72215715-72215737 AATATGGAGGTTGGTGTCCTTGG - Intronic
1193514068 X:82441574-82441596 GAGATGGAGGTTGCAGTGAGCGG + Intergenic
1193715575 X:84931970-84931992 GAGATGGAGGTTGCAGTGAGCGG + Intergenic
1194974942 X:100385086-100385108 AAGGTGGAGGTTGCAGTGAATGG + Intronic
1196287756 X:113902000-113902022 AAGGTGGAGGTTGCAGTGAACGG - Intergenic
1196794348 X:119490232-119490254 AGGATGGAGGCTGCTGTGATGGG + Intergenic
1197347378 X:125340786-125340808 AAGATGGGGGTTCATGTGATGGG - Intergenic
1197655530 X:129112578-129112600 TCCATGGAGGCTGCTCTGATAGG - Intergenic
1198509825 X:137339238-137339260 AGCATGGAAGGCGCTGTGATGGG + Intergenic
1198764713 X:140068610-140068632 AAGGTGGAGGTTGCAGTGAGTGG + Intergenic
1198875328 X:141218935-141218957 AACGTGCAGGTTGCTGACATAGG + Intergenic
1200410632 Y:2857484-2857506 GAGATGGAGGTTGCAGTGAGCGG - Intronic