ID: 1019659433

View in Genome Browser
Species Human (GRCh38)
Location 7:2215767-2215789
Sequence CAACATGGAGGTTGCTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 271}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659433_1019659440 15 Left 1019659433 7:2215767-2215789 CCATCACAGCAACCTCCATGTTG 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659433_1019659443 29 Left 1019659433 7:2215767-2215789 CCATCACAGCAACCTCCATGTTG 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1019659443 7:2215819-2215841 ATACCGAGGCTCCTCCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 111
1019659433_1019659437 -8 Left 1019659433 7:2215767-2215789 CCATCACAGCAACCTCCATGTTG 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1019659437 7:2215782-2215804 CCATGTTGTAGGTGAGCAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 231
1019659433_1019659439 -4 Left 1019659433 7:2215767-2215789 CCATCACAGCAACCTCCATGTTG 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1019659439 7:2215786-2215808 GTTGTAGGTGAGCAGCTGGTGGG 0: 1
1: 0
2: 1
3: 24
4: 185
1019659433_1019659438 -5 Left 1019659433 7:2215767-2215789 CCATCACAGCAACCTCCATGTTG 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1019659438 7:2215785-2215807 TGTTGTAGGTGAGCAGCTGGTGG 0: 1
1: 0
2: 0
3: 19
4: 216
1019659433_1019659444 30 Left 1019659433 7:2215767-2215789 CCATCACAGCAACCTCCATGTTG 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1019659444 7:2215820-2215842 TACCGAGGCTCCTCCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 154
1019659433_1019659442 25 Left 1019659433 7:2215767-2215789 CCATCACAGCAACCTCCATGTTG 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1019659442 7:2215815-2215837 CACAATACCGAGGCTCCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659433 Original CRISPR CAACATGGAGGTTGCTGTGA TGG (reversed) Intronic
900673234 1:3868751-3868773 GCACATGGAGGGTGCTGTGGAGG + Intronic
900831662 1:4969873-4969895 CAACAAGAAGGCTGCTGGGATGG + Intergenic
901568279 1:10137334-10137356 CAACATGGATGTGGCGGTGGAGG - Intronic
902866412 1:19282952-19282974 CAGCAGGGAGGTGGCTGGGACGG - Intronic
902869364 1:19304446-19304468 CAGCAGGGAGGTGGCTGGGACGG - Intronic
903853384 1:26321322-26321344 AAACGTGGAGGTTAGTGTGATGG - Intergenic
903889613 1:26560830-26560852 CAACATGGAGTATGCTGTCAAGG + Exonic
904791150 1:33022425-33022447 GAAGGTGGAGGTTGCAGTGAGGG - Intronic
904858629 1:33518545-33518567 CAATCTGGATATTGCTGTGAAGG + Intronic
906376388 1:45300071-45300093 CACCACAGATGTTGCTGTGAGGG + Intronic
907124267 1:52035386-52035408 CAATCTGTAGGTTGTTGTGAGGG + Intronic
907189160 1:52633992-52634014 GAAGATGGAAGTTGCTGTTAGGG - Intronic
907630994 1:56081551-56081573 CAAAATGAAGGTGACTGTGAGGG + Intergenic
908931059 1:69316188-69316210 CAGCATGCAGGTTGCTGTGTGGG + Intergenic
909417072 1:75418036-75418058 CCACATGAAGTTTGGTGTGAGGG - Intronic
910013332 1:82492157-82492179 CAACATAGATGTTTCTGTGTGGG + Intergenic
911150971 1:94596573-94596595 CAACATGGATGTTGTCCTGAGGG - Intergenic
913956995 1:143310170-143310192 CAACACGGAGGTTGGGGTGCTGG + Intergenic
913980444 1:143505484-143505506 CAACACGGAGGTTGGGGTGCTGG - Intergenic
914074804 1:144331913-144331935 CAACACGGAGGTTGGGGTGCTGG - Intergenic
914104374 1:144634580-144634602 CAACACGGAGGTTGGGGTGCTGG + Intergenic
914503280 1:148265743-148265765 ACAGATGGAGGTTGCAGTGAGGG - Intergenic
914510474 1:148328183-148328205 ACAGATGGAGGTTGCAGTGAGGG + Intergenic
915766656 1:158369916-158369938 CAACATAGAGGTTGATTTGAAGG + Intergenic
916628650 1:166587998-166588020 CAATTTCGATGTTGCTGTGAAGG - Intergenic
918382385 1:183969112-183969134 CAACATAGAGGGTGCTGGTATGG + Intronic
920389424 1:205589847-205589869 CAAGAGGGAGGTGGCTGGGATGG + Intronic
920525213 1:206661173-206661195 CAACATGGAGCTAGATGTGGGGG + Intronic
921310998 1:213843259-213843281 CAGTCTGGATGTTGCTGTGAAGG - Intergenic
921813303 1:219538663-219538685 CAACTTGCAGCTTGCTGAGAAGG + Intergenic
922179945 1:223225681-223225703 CAACATGGAGGTGCCAGGGATGG - Intronic
1063445505 10:6112120-6112142 CCAGAAGGAGGTTGTTGTGATGG + Intronic
1070129967 10:73648957-73648979 CAAGAGGGAGCTTGCTGGGATGG - Intronic
1070843646 10:79505188-79505210 GAGCATGGAGGCTGCGGTGAGGG - Intergenic
1070930020 10:80254412-80254434 GAGCATGGAGGCTGCGGTGAGGG + Intergenic
1072602747 10:96945068-96945090 CAAGATGGTGGTTACTGTGATGG + Intronic
1073989664 10:109248192-109248214 CTACATGGAGGTTTCTGGCAGGG + Intergenic
1074192123 10:111147240-111147262 CAACCTAGGTGTTGCTGTGAAGG - Intergenic
1074788172 10:116860004-116860026 CAACATGGATGTTCGTTTGATGG + Intronic
1076272395 10:129165845-129165867 CCACATGCAGGTTGCAGAGATGG - Intergenic
1076743411 10:132499570-132499592 CCACAAGGAAGGTGCTGTGAGGG - Intergenic
1076766602 10:132638271-132638293 AGACTTGGAGGCTGCTGTGATGG - Intronic
1077453423 11:2664260-2664282 AAACAAGGAGGTTGCTGCAAAGG + Intronic
1077694402 11:4381251-4381273 TAACCTAGATGTTGCTGTGAAGG - Intergenic
1079611882 11:22443128-22443150 CAATATGGATGTTGCTGTGAAGG + Intergenic
1080383014 11:31793525-31793547 CAACATGGAGCCAGATGTGAAGG + Exonic
1082242642 11:49888570-49888592 CAACATGAGGGGTGCAGTGAGGG + Intergenic
1082836013 11:57650451-57650473 TAATATGGAGGTAGCTGTTAAGG - Intronic
1083911904 11:65714767-65714789 CAACGTGGAGGGTGCTGGGAAGG - Intronic
1084548828 11:69828688-69828710 CCACATGGTGCTTGCTGTCAGGG + Intergenic
1086123701 11:83327856-83327878 CCATCTGGATGTTGCTGTGAAGG + Intergenic
1086242235 11:84709050-84709072 TCACATGGAAGCTGCTGTGAGGG + Intronic
1086756081 11:90563944-90563966 CCATATCCAGGTTGCTGTGAAGG - Intergenic
1088477446 11:110257897-110257919 CAACAGGGAGGATTCTATGATGG - Exonic
1090548736 11:127795059-127795081 CAACTTGCAGGTTGCAGTGAAGG + Intergenic
1091197978 11:133747800-133747822 CAACCTGGAGGTGTCAGTGATGG + Intergenic
1092112848 12:5976164-5976186 CGACATGGAGGATGCCGTGATGG - Exonic
1092872420 12:12817796-12817818 CAAACTGAGGGTTGCTGTGAGGG + Intronic
1093039338 12:14360835-14360857 GGACGTGGAGGTTGCAGTGAGGG - Intergenic
1094036929 12:26081750-26081772 AAACATGAAAGTAGCTGTGAAGG - Intergenic
1095528469 12:43156419-43156441 TAACATGAAGGTTTATGTGATGG + Intergenic
1095731791 12:45513505-45513527 CAATCTGAATGTTGCTGTGAAGG + Intergenic
1098997211 12:77134659-77134681 TAATATAGATGTTGCTGTGAAGG - Intergenic
1099111174 12:78563194-78563216 CAATATAGATGCTGCTGTGAAGG + Intergenic
1100331626 12:93587977-93587999 CAATATGGAGGCTGCTCTGGAGG + Intergenic
1101388718 12:104280587-104280609 AAGCATAGATGTTGCTGTGAAGG + Intronic
1101953110 12:109191613-109191635 GAACATGGTGGTGGCTTTGAAGG + Exonic
1102928108 12:116842259-116842281 CAACAAGGAGGATACAGTGAAGG - Intronic
1104618120 12:130287378-130287400 CATCTCGAAGGTTGCTGTGAAGG + Intergenic
1104755236 12:131265032-131265054 GAACGTGGAGGATGCTGTGCTGG + Intergenic
1106079923 13:26491856-26491878 CAATCTGGATGTGGCTGTGAAGG - Intergenic
1106730496 13:32537201-32537223 CAACATGGTGGTTTATGGGAGGG + Intronic
1107996253 13:45864162-45864184 CAACAAGGAGGGTGGTGGGAGGG + Intergenic
1108957332 13:56176260-56176282 CAACATGTGAGTTGCTATGAAGG - Intergenic
1109725376 13:66333863-66333885 CAACATAAAGGTCCCTGTGAAGG + Intronic
1109829329 13:67766117-67766139 CAACATGGAGTCAGCTGTGCCGG + Intergenic
1110792671 13:79602351-79602373 CCACATGGAGGTTGCTGGGGAGG - Intergenic
1111371851 13:87329390-87329412 TAACATAGATGCTGCTGTGAAGG + Intergenic
1112433264 13:99372071-99372093 CAAGAAGGAGGCTGCTGTGCAGG + Intronic
1112619264 13:101037950-101037972 CTAGCTGGATGTTGCTGTGAAGG + Intergenic
1112993130 13:105538530-105538552 CGGCAGGGGGGTTGCTGTGAGGG - Intergenic
1113163109 13:107405781-107405803 CAGAATGGAGGTTTCTGTGCTGG + Intronic
1113608253 13:111625543-111625565 CAGTTTGGATGTTGCTGTGAAGG + Intronic
1115838289 14:37434874-37434896 CAATCTAGATGTTGCTGTGAAGG - Intronic
1117293150 14:54353158-54353180 CCCCATGAAGGTTACTGTGAGGG - Intergenic
1118143739 14:63113694-63113716 CAACATGTTGGTAGCTGGGAAGG - Intergenic
1119237821 14:73034439-73034461 GGAGGTGGAGGTTGCTGTGAGGG - Intergenic
1119566051 14:75630294-75630316 TAACATGGAGGCAGCTGGGATGG - Intronic
1121303378 14:92889603-92889625 CACCATGGAGGTTGATCTTAGGG + Intergenic
1122725671 14:103749844-103749866 CAACATGGAGGTGGCCATGATGG - Exonic
1202939398 14_KI270725v1_random:131835-131857 CAACACGGAGGTTGGGGTGCTGG + Intergenic
1123393747 15:19904452-19904474 CAACATGGAGGTTGGGGTGCTGG - Intergenic
1124361413 15:29039199-29039221 CACCAGGGAGATTCCTGTGAGGG + Intronic
1124853439 15:33363056-33363078 CCAGATGAAGGTTGCTGTGTTGG - Intronic
1125338523 15:38651975-38651997 CAACATGCAGGCTGAAGTGAAGG + Intergenic
1129044532 15:72722249-72722271 CCACCTGGAGTCTGCTGTGATGG - Intronic
1130016003 15:80186939-80186961 GGACATGCAGGGTGCTGTGATGG - Exonic
1130108732 15:80948248-80948270 CAAGATGGAGAGTGCTGTGTGGG + Intronic
1130789428 15:87136703-87136725 GAACATGGAGGTTGTCTTGAGGG + Intergenic
1131461782 15:92622705-92622727 CAACATGCAGGGAGCAGTGAGGG - Intronic
1132053689 15:98633336-98633358 CAACATGGAGGTTACTCGGGAGG + Intergenic
1136751848 16:32644285-32644307 CAACACGGAGGTTGAGGTGCTGG + Intergenic
1136767900 16:32805150-32805172 CAACACGGAGGTTGGGGTGCTGG + Intergenic
1136800249 16:33065547-33065569 CAACACGGAGGTTGGGGTGCTGG - Intergenic
1136902642 16:34055894-34055916 CAACATGGAGGTTGGGGTGCTGG - Intergenic
1136911302 16:34146778-34146800 CAACCAGGCGGTTGATGTGACGG - Intergenic
1136958146 16:34809293-34809315 CAACACGGAGGTTGGGGTGCTGG - Intergenic
1137994881 16:53199741-53199763 CAAGATGGAAGTAGCTGAGATGG - Intronic
1140811209 16:78579936-78579958 TAAAATGCAGGTGGCTGTGAGGG + Intronic
1141185254 16:81782425-81782447 CAAAATGGAAGTTGCTGTGGTGG + Intronic
1203053986 16_KI270728v1_random:903540-903562 CAACACGGAGGTTGGGGTGCTGG + Intergenic
1203070291 16_KI270728v1_random:1067172-1067194 CAACACGGAGGTTGGGGTGCTGG + Intergenic
1143568130 17:7737593-7737615 CAAGATGGAGATTGCAGTGGGGG + Intronic
1143883359 17:10047387-10047409 CTACAGGCAGGTAGCTGTGAGGG + Intronic
1145715865 17:27020435-27020457 CAAAGTGGAGCTTGCAGTGAGGG + Intergenic
1146989261 17:37253014-37253036 AAACATGGTGGTGGCTTTGAAGG - Exonic
1150076137 17:62193685-62193707 CAGCCTAGACGTTGCTGTGAAGG - Intergenic
1151726639 17:75888847-75888869 CAAGATGGAGGCTGCAATGACGG + Intronic
1152290056 17:79435260-79435282 CCACATGGAGGTTGGAGTGTAGG + Intronic
1152521393 17:80858733-80858755 AAACATGGAGGTGGCAGGGAGGG + Intronic
1152632300 17:81415705-81415727 CAGCATGGAGGTGGCTATGTTGG - Intronic
1154517817 18:15192591-15192613 CAACATGGAGGTTGGGGTGCTGG + Intergenic
1156498637 18:37542994-37543016 TAAAATGGAGGTGGGTGTGATGG - Intronic
1156670366 18:39462001-39462023 CAGCTTGGATGTTGCTGTGAAGG + Intergenic
1156936882 18:42720089-42720111 CAACTTAGTGATTGCTGTGAGGG + Intergenic
1156973940 18:43193494-43193516 CAGGGAGGAGGTTGCTGTGATGG - Intergenic
1159079945 18:63725718-63725740 CAGTCTGGATGTTGCTGTGAAGG - Intronic
1161955998 19:7495462-7495484 GGACATTGAGGTTGCAGTGAGGG - Intronic
1162579350 19:11519078-11519100 AGAGATGGAGGTTCCTGTGAGGG + Exonic
1164868594 19:31625397-31625419 GAACATGGAGGATGCTCTGCTGG + Intergenic
1166048628 19:40244732-40244754 CATCCTGGAAGATGCTGTGAAGG - Intronic
1167104978 19:47424853-47424875 CAGCCTAGATGTTGCTGTGAAGG + Intergenic
1167675971 19:50885902-50885924 TAAATTGGAGGTTGCTGTAAAGG - Intergenic
1168415482 19:56165167-56165189 TAACATGGGGGTTACAGTGAGGG + Intergenic
925623216 2:5815379-5815401 CAAAAATGAGGTTGCTGTGTTGG - Intergenic
925752927 2:7105823-7105845 CAATTTGCAGATTGCTGTGATGG - Intergenic
927545457 2:23949010-23949032 GGAGATGGAGGTTGCAGTGAGGG - Intronic
928264552 2:29800620-29800642 CAACAGGGAGGTTGCTGAGAAGG + Intronic
931598426 2:63976237-63976259 CTACTTGGGGGTTGCTGAGATGG + Intronic
932736073 2:74255648-74255670 AAACGTGGAGGCTGCTGGGAAGG - Intronic
933284711 2:80373296-80373318 CAACATGTAGGTTGTTTTCATGG + Intronic
933415612 2:81983397-81983419 CAATGTGGCAGTTGCTGTGAGGG + Intergenic
933948627 2:87309152-87309174 GCACATGGATGTTGCTGTGGAGG - Intergenic
935631681 2:105217325-105217347 CAATCAGGATGTTGCTGTGAAGG - Intergenic
936331571 2:111552444-111552466 GCACATGGATGTTGCTGTGGAGG + Intergenic
936524780 2:113235226-113235248 CAACATGAAGTTCTCTGTGACGG - Intronic
937672106 2:124549011-124549033 GAGCATGGAGGCTGTTGTGATGG - Intronic
938115829 2:128602464-128602486 GAACATGGGGATTGCTGTGGGGG + Intergenic
940241552 2:151568352-151568374 CAGCAGGGGGGTTTCTGTGAGGG + Exonic
940367727 2:152867162-152867184 CAATCTAGATGTTGCTGTGAAGG - Intergenic
942403209 2:175625395-175625417 CAAATTGGAGCTTCCTGTGAAGG - Intergenic
942589090 2:177521692-177521714 CCACATGGTGGTTGCTGTTGAGG + Intronic
942764700 2:179441200-179441222 CAACAAGGAGGATGCTGCGGAGG + Intergenic
943656681 2:190516558-190516580 TCACATGGAGCTTGCTGGGATGG + Intronic
945102292 2:206273374-206273396 CAACGTGGATGTTGCTGTGCAGG - Intergenic
945484359 2:210377591-210377613 TCACATTGATGTTGCTGTGAGGG - Intergenic
945690018 2:213022008-213022030 CAGCATGGAGGCTGCTGGGCAGG - Exonic
946501200 2:220249212-220249234 CTACATGTAGGTTTCTGTGGAGG - Intergenic
947153861 2:227141037-227141059 CATCATGGTGATTGCTGTTAAGG - Intronic
947331640 2:229035130-229035152 CAGCCTAGATGTTGCTGTGAAGG + Intronic
948072916 2:235141830-235141852 CAACCTGGGGGTTGCTGTGAAGG + Intergenic
948557074 2:238820401-238820423 CTACATGCATGTTGCTGTCAAGG - Intergenic
948691746 2:239710042-239710064 TAACCTTGATGTTGCTGTGAAGG - Intergenic
948854590 2:240724283-240724305 CAAAGTGGAGGCTGCTGTGGGGG - Intronic
1170867633 20:20174240-20174262 CAAACTGGAGGAGGCTGTGAAGG - Intronic
1171906641 20:30905059-30905081 CAACCAGGCGGTTGATGTGACGG - Intergenic
1172694925 20:36815973-36815995 GATCATGGAGGTGGCTGTGGGGG - Exonic
1173621716 20:44441969-44441991 CACCATGGAGGTTGGAGAGAGGG + Intergenic
1173624450 20:44462028-44462050 CAACATGGAGGAGGATGTAAGGG + Exonic
1174461818 20:50688735-50688757 CACCATGGACGCTGCTGTGCTGG + Intronic
1176583796 21:8555376-8555398 CAACACGGAGGTTGGGGTGCTGG - Intergenic
1176836864 21:13800887-13800909 CTACATGGTGATAGCTGTGAAGG + Intergenic
1178511986 21:33213037-33213059 CAGCCTAGATGTTGCTGTGAAGG - Intergenic
1179284723 21:39967602-39967624 CAGCCTAGAAGTTGCTGTGAAGG - Intergenic
1179562625 21:42225745-42225767 CAACATGGAGGCCACTGAGACGG + Exonic
1180266606 22:10532288-10532310 CAACACGGAGGTTGGGGTGCTGG - Intergenic
1183087137 22:35493320-35493342 AATCATGAAGGTTGCTGTGGGGG + Intergenic
1184894340 22:47398399-47398421 CACCATGGATGTTGTTGTAAGGG - Intergenic
1185055969 22:48578502-48578524 AAACATGGAGATCTCTGTGAAGG - Intronic
950161245 3:10762926-10762948 CAAAACAGAGGTTGTTGTGAAGG + Intergenic
950736532 3:15013556-15013578 CAACATGGAGGCTGCTCTCATGG - Intronic
951484728 3:23199374-23199396 TATCAAGGAGGTTGCTGTCATGG - Intergenic
953215995 3:40919114-40919136 CAGCCTAGATGTTGCTGTGAGGG + Intergenic
954247387 3:49342234-49342256 CACTATGGAGGTGGCTGTGAGGG + Intergenic
957326723 3:78705548-78705570 GAACATCAAGGTTTCTGTGATGG + Intronic
957881651 3:86221832-86221854 CAACATGGATGCGGTTGTGAGGG + Intergenic
959493756 3:107023928-107023950 AAACATGGATGATGCTATGAGGG + Intergenic
960474781 3:118110509-118110531 CAACAAGGAGGTGGCTGAAAGGG - Intergenic
960785814 3:121372059-121372081 CAGCATGGAGGCTGCTGTTGGGG + Intronic
961276273 3:125729604-125729626 CGATGTGGAGGTTGCAGTGAGGG + Intergenic
961428845 3:126865600-126865622 CAAAATGGTGGTAGCAGTGAAGG - Intronic
961517770 3:127448909-127448931 AAACATGGTGGTTACTGTTATGG + Intergenic
961866759 3:129959057-129959079 CACCATGTGGGCTGCTGTGAGGG - Intergenic
962151255 3:132895717-132895739 TTACCTGGAGATTGCTGTGATGG - Intergenic
962274784 3:134003768-134003790 CAATCTGGGTGTTGCTGTGAAGG + Intronic
962968734 3:140379359-140379381 CATCGTGGAGGTTGCCGAGAAGG + Intronic
963063002 3:141240454-141240476 GAACATGGAGGATGGTGTGTGGG + Intronic
964739833 3:159953730-159953752 CAAAATGGAGTTTGCTTTGTTGG - Intergenic
964741174 3:159967795-159967817 CAGCATGGAGTTTGCTGGGGAGG - Intergenic
964766932 3:160188555-160188577 CCACATGGAGGTTCCAGAGAAGG - Intergenic
969442826 4:7227467-7227489 CAACCTGCAGGCTGCTGTGGAGG - Intronic
969475234 4:7418644-7418666 GAACATTGAAGTTGCAGTGAGGG + Intronic
972569327 4:40296126-40296148 CAGTTTGGATGTTGCTGTGAAGG - Intergenic
973665285 4:53153010-53153032 AACCATGAAGGTTGCTGTCATGG + Intronic
974372603 4:61037230-61037252 CTCCATCCAGGTTGCTGTGAAGG + Intergenic
975730984 4:77337016-77337038 TAACAAGGTGGTAGCTGTGATGG + Intronic
977568680 4:98608460-98608482 GAACATGCAGCTTGCTGTGCTGG - Intronic
979194409 4:117903213-117903235 CAGCCTAGATGTTGCTGTGAAGG - Intergenic
980196790 4:129599802-129599824 CAATATGGAGGTAACTGGGAGGG - Intergenic
981006926 4:139884649-139884671 CAACAGTGAGATTGCTGGGAAGG - Intronic
984657636 4:182336220-182336242 CAACATGGAGGATGCCAAGATGG - Intronic
984791470 4:183618819-183618841 TAACTTGGATGTTGCTGTGAAGG - Intergenic
985093684 4:186390579-186390601 CATTATAGATGTTGCTGTGAAGG - Intergenic
985212085 4:187605984-187606006 CTACATCCATGTTGCTGTGAAGG + Intergenic
992414242 5:76537770-76537792 CAACATGCAGGTCTGTGTGATGG + Intronic
992493926 5:77272818-77272840 CAACTAGGAGGTTTCTGTGCTGG + Intronic
993164164 5:84330871-84330893 CAACAGAGAAGTTGCTGTAAGGG - Intronic
994043877 5:95286037-95286059 CCACATGGAGCTTATTGTGAGGG + Intergenic
995675782 5:114660847-114660869 CAGCATGAAGTTTGCTGGGATGG - Intergenic
998735018 5:145127627-145127649 CAATATGGAGGAAGCTGAGATGG + Intergenic
999016793 5:148115565-148115587 CAAGGTGGGGGATGCTGTGAAGG + Intronic
999245446 5:150151902-150151924 TAATTTTGAGGTTGCTGTGACGG + Intronic
999720230 5:154394064-154394086 CAAAATGGAGATTGGTCTGAGGG + Intronic
1000226156 5:159263637-159263659 CAACAAGGAGGTTGAGGGGAGGG - Intronic
1001217423 5:169868886-169868908 CAACATAGAGGATGGAGTGAGGG + Intronic
1002363112 5:178689006-178689028 CAACCTGGTGGTTGCCGGGAAGG - Intergenic
1003445501 6:6179978-6180000 CAGCATGGAGGTGACAGTGAAGG - Intronic
1003460457 6:6323535-6323557 CACCGTGGAGGTGGTTGTGAGGG - Intergenic
1004299872 6:14447722-14447744 CAGTCTGGATGTTGCTGTGAAGG - Intergenic
1007504604 6:42325876-42325898 CTACATCCATGTTGCTGTGAAGG - Intronic
1009741248 6:67748756-67748778 CAGGATGGATTTTGCTGTGAGGG + Intergenic
1011818976 6:91228104-91228126 CAACCTGGATGTTTCTGTGAGGG - Intergenic
1013191713 6:107809445-107809467 CATCATGGTGGTCCCTGTGAAGG + Intronic
1013197054 6:107853419-107853441 CAGAATGGTGGTTGCTGGGATGG - Intergenic
1013456466 6:110334131-110334153 GAAGATGGAGATTGCTGTGCAGG - Intronic
1013761081 6:113518573-113518595 CCACATAGAGCTGGCTGTGACGG - Intergenic
1014760268 6:125348527-125348549 TAATATAGATGTTGCTGTGAAGG - Intergenic
1015752805 6:136577613-136577635 CAGCAGGGAGGTTGCAGAGAGGG - Intronic
1016687973 6:146902844-146902866 CAGTATGTAGGTTGCTGTGTTGG + Intergenic
1017959895 6:159212626-159212648 CAACATGGAGCTCGCTGTCTCGG - Intronic
1018699791 6:166417319-166417341 CAGTCTAGAGGTTGCTGTGAAGG + Intronic
1019659433 7:2215767-2215789 CAACATGGAGGTTGCTGTGATGG - Intronic
1019664559 7:2245055-2245077 CAACAGTGAGGGTGCTGGGAGGG - Intronic
1020639608 7:10739177-10739199 CAACATGGAGGTGGTTGGAAAGG + Intergenic
1021094732 7:16523040-16523062 AAAGATGGAGGTTGATGAGATGG + Intronic
1021137379 7:16981973-16981995 CTACATCAATGTTGCTGTGAAGG + Intergenic
1021866313 7:24961990-24962012 CAACAGGAAGGTTGATGTGCTGG - Intronic
1022633707 7:32110929-32110951 CAAATTGGAGGGTGCTGTTAGGG + Intronic
1023836094 7:44068043-44068065 TAACATGGAGGTGGCAGTGGTGG + Intronic
1024139958 7:46452746-46452768 CAATCTAGGGGTTGCTGTGAAGG + Intergenic
1024151851 7:46579672-46579694 AAACAAAGAGGCTGCTGTGAGGG + Intergenic
1024203406 7:47129664-47129686 TAACATGGGGGTTGGAGTGATGG - Intergenic
1025482350 7:60997688-60997710 CAACACGGAGGTTGGGGTGCTGG - Intergenic
1025562473 7:62385519-62385541 CAACACGGAGGTTGGGGTGCTGG - Intergenic
1025877825 7:65503056-65503078 CAACACGGAGGTTGGGGTGCTGG + Intergenic
1025882159 7:65548757-65548779 CAACACGGAGGTTGGGGTGCTGG + Intergenic
1025891283 7:65653874-65653896 CAACACGGAGGTTGGGGTGCTGG - Intergenic
1026591798 7:71702750-71702772 GAACAGGGAGGTAGCTGTGGAGG + Intronic
1027581581 7:80003934-80003956 CAACATGGAATTGGCTGTGTGGG + Intergenic
1028930269 7:96405182-96405204 TAACATGGAGGCTCCTCTGATGG - Intergenic
1032079309 7:128850743-128850765 CAGCAGGGAGGTTGCAGTGGGGG + Intronic
1032792307 7:135251560-135251582 AACCCTGGAGGTGGCTGTGAGGG - Intronic
1034632569 7:152542139-152542161 GACCATGGAGGTTTCTGTGAAGG + Intergenic
1035377778 7:158416780-158416802 CAGCAGGGAAGTGGCTGTGAGGG + Intronic
1036658460 8:10692432-10692454 CACCATGGAGGCTGCTGGGCTGG - Intronic
1037658853 8:20910180-20910202 CAACATGGAGGCTGCTGATAGGG + Intergenic
1038910699 8:31960385-31960407 CACCATGGAGGAGGCTATGAAGG + Intronic
1039957423 8:42218103-42218125 CAGGGTGGAGGCTGCTGTGAGGG - Intergenic
1040520587 8:48172925-48172947 CCCCATGGGGGTTTCTGTGAGGG + Intergenic
1041523375 8:58778890-58778912 CAGTCTGGATGTTGCTGTGAAGG - Intergenic
1042701919 8:71624959-71624981 CAATATAGGTGTTGCTGTGAAGG - Intergenic
1044593817 8:93939710-93939732 CAACTTGAAGGTTGGGGTGATGG + Intergenic
1044984698 8:97747292-97747314 TAACATAGATGTTGCTGTGAAGG - Intergenic
1045968215 8:108050744-108050766 CAACGTGGAGGGTGGTGAGAGGG - Intronic
1046438771 8:114230963-114230985 CCACCTGGAAGCTGCTGTGAGGG + Intergenic
1048809855 8:138276100-138276122 CAACATGGGGCTTTCTGAGAAGG + Intronic
1049568460 8:143356122-143356144 CCACATGCAGGATGCTGTGGTGG - Intronic
1051345090 9:16144210-16144232 CAGCCTAGATGTTGCTGTGAAGG - Intergenic
1052260127 9:26505332-26505354 CAGTATAGACGTTGCTGTGAGGG + Intergenic
1053417554 9:37956303-37956325 CCACAGGGAGGTTTCTGTGGGGG - Intronic
1055558594 9:77500551-77500573 CAACATGAAGGATTCTGTGGTGG - Intronic
1059957769 9:119536053-119536075 CAACATGAAGGTAGCTGGGGTGG + Intergenic
1062666390 9:137675401-137675423 CAATAGGGGGGTTGGTGTGAGGG + Intronic
1203613756 Un_KI270749v1:33228-33250 CAACACGGAGGTTGGGGTGCTGG - Intergenic
1187539040 X:20172745-20172767 AAACATGGAGTTTGCAGTGAAGG - Exonic
1188581642 X:31721290-31721312 CAATCTAGATGTTGCTGTGAAGG + Intronic
1188730807 X:33644042-33644064 AAACATCGAGGTTGCTCAGAGGG + Intergenic
1189120641 X:38390753-38390775 AAACATGGATGTTGATGAGATGG - Intronic
1190977347 X:55418721-55418743 GAACATGGGTGTTGCTGTGTTGG - Intergenic
1192261967 X:69510963-69510985 GAACATGGAGGTTGGAGTGGGGG - Intronic
1192638756 X:72844500-72844522 CAGCAAGGGGGTTGCAGTGAAGG + Intronic
1192642956 X:72876308-72876330 CAGCAAGGGGGTTGCAGTGAAGG - Intronic
1192737438 X:73862518-73862540 CAGCATGAAGGATGCAGTGATGG + Intergenic
1193648915 X:84106364-84106386 CAACATGGAATTTGCAGTGAAGG - Exonic
1194735273 X:97505495-97505517 CAACCTGGAGTTTGCAGTAATGG + Intronic
1196794347 X:119490231-119490253 AAGGATGGAGGCTGCTGTGATGG + Intergenic
1198381983 X:136092569-136092591 CAACATGACTGTTGTTGTGAAGG - Intergenic
1198437280 X:136629617-136629639 CAGCATGCAGCTGGCTGTGATGG + Intergenic
1198509824 X:137339237-137339259 CAGCATGGAAGGCGCTGTGATGG + Intergenic