ID: 1019659435

View in Genome Browser
Species Human (GRCh38)
Location 7:2215779-2215801
Sequence GCTGCTCACCTACAACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019659435_1019659444 18 Left 1019659435 7:2215779-2215801 CCTCCATGTTGTAGGTGAGCAGC 0: 1
1: 0
2: 0
3: 24
4: 168
Right 1019659444 7:2215820-2215842 TACCGAGGCTCCTCCAGGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 154
1019659435_1019659446 24 Left 1019659435 7:2215779-2215801 CCTCCATGTTGTAGGTGAGCAGC 0: 1
1: 0
2: 0
3: 24
4: 168
Right 1019659446 7:2215826-2215848 GGCTCCTCCAGGCAGGGCAGAGG 0: 1
1: 0
2: 6
3: 60
4: 515
1019659435_1019659440 3 Left 1019659435 7:2215779-2215801 CCTCCATGTTGTAGGTGAGCAGC 0: 1
1: 0
2: 0
3: 24
4: 168
Right 1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 17
1019659435_1019659442 13 Left 1019659435 7:2215779-2215801 CCTCCATGTTGTAGGTGAGCAGC 0: 1
1: 0
2: 0
3: 24
4: 168
Right 1019659442 7:2215815-2215837 CACAATACCGAGGCTCCTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 66
1019659435_1019659443 17 Left 1019659435 7:2215779-2215801 CCTCCATGTTGTAGGTGAGCAGC 0: 1
1: 0
2: 0
3: 24
4: 168
Right 1019659443 7:2215819-2215841 ATACCGAGGCTCCTCCAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019659435 Original CRISPR GCTGCTCACCTACAACATGG AGG (reversed) Intronic
900273780 1:1809838-1809860 GCCACTCACCTAGAACATAGAGG + Intronic
902376143 1:16030766-16030788 GCAGCTGACCTCCGACATGGGGG + Intronic
904276949 1:29391036-29391058 CCTGCTCACCTGCAAAGTGGTGG + Intergenic
904614988 1:31744723-31744745 GCTCCTCACCTGGAACACGGAGG + Exonic
906971122 1:50515055-50515077 ACTGCACACCTACAAGATGTAGG + Intronic
908199459 1:61779439-61779461 GAGGCTCACCTACATCATTGAGG + Intronic
909474874 1:76071606-76071628 GCATCTCACCTACTACGTGGGGG - Intergenic
909491067 1:76226835-76226857 CCTCCTCACCTCCAACATTGGGG + Intronic
909986391 1:82165479-82165501 GAGGCTCACCTACATTATGGAGG - Intergenic
911633970 1:100213322-100213344 GCCGCCCGCCTACAACCTGGAGG + Intronic
912326366 1:108767107-108767129 GCTGTTCACCTACAACAACTTGG + Intronic
912715211 1:111978662-111978684 GCTGCTCACCTCCCTCCTGGGGG + Intronic
913586210 1:120277964-120277986 GCTGCTCATCTACTTCCTGGAGG + Intergenic
913594443 1:120359864-120359886 GTTTCTCAGCTACAACCTGGAGG + Intergenic
913621976 1:120620405-120620427 GCTGCTCATCTACTTCCTGGAGG - Intergenic
914092819 1:144519120-144519142 GTTTCTCAGCTACAACCTGGAGG - Intergenic
914305709 1:146414753-146414775 GTTTCTCAGCTACAACCTGGAGG + Intergenic
914596346 1:149158053-149158075 GTTTCTCAGCTACAACCTGGAGG - Intergenic
915355781 1:155254715-155254737 GGTGGTCACCTTCAGCATGGTGG - Exonic
919892133 1:201983080-201983102 GCTGCTCACCTACCGCGTCGGGG + Exonic
923088200 1:230717752-230717774 GCTGCCCATCTATATCATGGGGG + Intergenic
923498049 1:234541923-234541945 GAGGCCCACCTGCAACATGGAGG - Intergenic
924372222 1:243362902-243362924 TCTGCTGACCTACAACTGGGTGG + Intronic
1064703327 10:18045049-18045071 GCTGCTCACCTTCAAGTTAGAGG + Intergenic
1065961619 10:30738476-30738498 GTAACTCACCTACAACCTGGGGG + Intergenic
1068976608 10:63016824-63016846 GAGGCTCAGCTACAATATGGAGG + Intergenic
1069867195 10:71511267-71511289 ACTCTTCACCTACACCATGGTGG - Intronic
1069917903 10:71798511-71798533 GCTGGTCACCTACACCCTGCTGG + Exonic
1070284136 10:75071363-75071385 GCTGCTCACCCCCACCCTGGTGG + Intergenic
1070654278 10:78260635-78260657 TCTGCCCACCTCCAACATGCTGG + Intergenic
1071407429 10:85351590-85351612 GGTGGTCTCTTACAACATGGTGG + Intergenic
1073649347 10:105342131-105342153 GCTCTCCACCTTCAACATGGGGG - Intergenic
1074278171 10:112024601-112024623 ACTCCACACCTACATCATGGTGG - Intergenic
1075897723 10:126012155-126012177 GATGCTCACACACAACACGGGGG - Intergenic
1076027202 10:127125559-127125581 GCTGCTCAGCCACATCCTGGAGG + Exonic
1076947246 10:133659761-133659783 GCTGCACACCTGCAATGTGGTGG + Intergenic
1078469610 11:11576483-11576505 AATGTTCACCTACAACATGCAGG + Intronic
1079116182 11:17641938-17641960 GCTGCTTACCAAGAACAGGGAGG - Exonic
1083908521 11:65690596-65690618 GCTACTGAGCTACAGCATGGGGG + Intergenic
1085927107 11:81035545-81035567 GCTTCTCACCTAATTCATGGGGG - Intergenic
1086858633 11:91897972-91897994 GCTGCTCATCTACAAAACAGAGG - Intergenic
1086929955 11:92682172-92682194 TCTCCTCAACTACAAAATGGGGG + Intronic
1089408293 11:118217060-118217082 GCAGCTCACCAACCGCATGGAGG + Intronic
1090906215 11:131076747-131076769 GCTGCTCACCTTGAAGGTGGTGG - Intergenic
1092007719 12:5083632-5083654 TCTTCACACCTACAACATGTGGG - Intergenic
1094251522 12:28367845-28367867 GTTGCCCACCTACATTATGGAGG - Intronic
1096796567 12:54081731-54081753 GCTGCACACCTGCGAGATGGCGG + Intergenic
1098551809 12:71770851-71770873 TCTTTTCACCTACAACATGGTGG + Intronic
1102254373 12:111407185-111407207 CCTCCTCACCTACATCATTGTGG - Intronic
1105307375 13:19178505-19178527 ACTGTTGACCTACAACATGTAGG - Intronic
1105475984 13:20728567-20728589 GCAGCCCACCTAGAACCTGGAGG + Intergenic
1110925546 13:81146729-81146751 GCTCCTCACCTCCCAGATGGTGG + Intergenic
1118435991 14:65771302-65771324 GCTGCTCACCTAGAAGAGGCAGG - Intergenic
1119266994 14:73268614-73268636 GCTGCTCATTTACAACTTGCGGG + Exonic
1122505043 14:102226870-102226892 CCTGCTCACCTCCAGCCTGGAGG + Intronic
1123510231 15:20991458-20991480 GCTGGCCACCTACCACTTGGTGG - Intergenic
1123567447 15:21565211-21565233 GCTGGCCACCTACCACTTGGTGG - Intergenic
1123603711 15:22002504-22002526 GCTGGCCACCTACCACTTGGTGG - Intergenic
1125574323 15:40744976-40744998 GCTGCTCAACAACAAGCTGGTGG - Exonic
1126341314 15:47644428-47644450 TCTGCTCACTTACAATAAGGTGG + Intronic
1128451364 15:67807558-67807580 GCTCCTCACCTGCAAAATGGGGG - Intergenic
1128824427 15:70698841-70698863 GCTCCCCACCTACAACAAGAAGG + Intronic
1130608285 15:85337331-85337353 TTTGCTCACCTGCAAAATGGAGG + Intergenic
1202975811 15_KI270727v1_random:292305-292327 GCTGGCCACCTACCACTTGGTGG - Intergenic
1135394252 16:22119003-22119025 GGCGCTCACCTGCACCATGGAGG + Exonic
1136984284 16:35084650-35084672 GCTGCACATCTAGAACAAGGTGG - Intergenic
1139361525 16:66402737-66402759 GCTGGTCACCTACGACGAGGAGG + Exonic
1142688351 17:1590850-1590872 GCGGCTCATCTTCTACATGGGGG - Exonic
1144671881 17:17137558-17137580 GCTTCTCACCAACATCAAGGGGG - Intronic
1144808217 17:17981519-17981541 GCTGCCCACCTACAACCTAGGGG - Intronic
1147307441 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG + Intergenic
1148949505 17:51298128-51298150 GCTGATCCCCTAAAGCATGGAGG - Intergenic
1149510668 17:57238623-57238645 GTTGCTCTCCTACCACATGTTGG + Intergenic
1149583318 17:57766946-57766968 GTTTCTCAGCTACAAAATGGAGG + Intergenic
1203171151 17_GL000205v2_random:148760-148782 GCTGCACACCTGCAATATGGTGG + Intergenic
1153654271 18:7268819-7268841 GCTCCTCATCAGCAACATGGGGG - Intergenic
1154115983 18:11613613-11613635 GCTCCTCACCTACCAGATGATGG - Intergenic
1154120374 18:11647603-11647625 GCTCCTCACCTACCAGATGATGG - Intergenic
1154120409 18:11647722-11647744 GCTCCTCACCTACCAGATGATGG - Intergenic
1160209416 18:76863988-76864010 GAGGCTCACCCACATCATGGAGG - Intronic
1162386217 19:10361981-10362003 GCTGCTAACTTTCACCATGGCGG - Intronic
1163507980 19:17719586-17719608 GCTCCTCACCTACGTCCTGGAGG + Exonic
1164017377 19:21264882-21264904 GCTCCTCACCTCCCAGATGGTGG - Intronic
1164017395 19:21264960-21264982 GCTCCTCACCTCCCAGATGGTGG - Intronic
1164537763 19:29099105-29099127 GCTCCTCAAATACAACATGCTGG - Intergenic
1165030683 19:32996017-32996039 GCTACTCACCAACAACACTGGGG + Exonic
1166244370 19:41515235-41515257 GCTCCTCACTTCCCACATGGTGG - Intergenic
1166860921 19:45810674-45810696 GCAGCCCACCTACAAGATGGCGG - Exonic
1167257881 19:48442226-48442248 GCTGGACATCGACAACATGGCGG + Exonic
1167600874 19:50454166-50454188 TCTGCTCACCTACAACTTGCAGG - Exonic
925603133 2:5629218-5629240 GTTGCTCAGCTACAACCTGGAGG + Intergenic
927233466 2:20848187-20848209 GAGGCCCACCAACAACATGGAGG - Intergenic
928934636 2:36662787-36662809 GCTCCTCACTTCCCACATGGTGG - Intergenic
929931475 2:46259533-46259555 GCTGGTCACCCACAGAATGGTGG - Intergenic
930711017 2:54551231-54551253 GCTTTTCACCTCCAACATGGAGG - Intronic
931636642 2:64346560-64346582 GCTGCCCACATGCAACCTGGAGG - Intergenic
936327706 2:111520048-111520070 ATTGCTCACCTAAAACATGTGGG + Intergenic
936724539 2:115297123-115297145 GCTGCTCACATAGAAAATGGAGG - Intronic
939371038 2:141300535-141300557 GAAGCTCACCTTCAACATTGAGG - Intronic
939517513 2:143187568-143187590 TCTCCTCATCTACAAGATGGAGG - Intronic
939838394 2:147157027-147157049 CCTCATCACCTGCAACATGGTGG - Intergenic
941739070 2:169013793-169013815 GCTACTCATCTACAACTTAGGGG + Intronic
942227391 2:173829364-173829386 GCGGCTTACCTAGAACATTGAGG - Intergenic
945415141 2:209561513-209561535 CCTGCTCACCTATAAAATGGAGG + Intronic
946276388 2:218634838-218634860 TCTGCTCACCTGCAAAATAGGGG + Intronic
947525106 2:230872816-230872838 GCTGCTCAACTCCACCAAGGAGG - Intronic
1172628536 20:36362920-36362942 GCTGCTCATCTCTAAGATGGGGG - Intronic
1173567701 20:44053347-44053369 GCTGCACAGCTGAAACATGGCGG + Intronic
1175132838 20:56802514-56802536 GCTGCTCACCCACACAATTGTGG - Intergenic
1176327135 21:5510590-5510612 GCTGCACACCTGCAATATGGTGG + Intergenic
1176400622 21:6310361-6310383 GCTGCACACCTGCAATATGGTGG - Intergenic
1176436535 21:6678743-6678765 GCTGCACACCTGCAATATGGTGG + Intergenic
1176460797 21:7005813-7005835 GCTGCACACCTGCAATATGGTGG + Intergenic
1176484358 21:7387591-7387613 GCTGCACACCTGCAATATGGTGG + Intergenic
1177500590 21:21949758-21949780 TCTGCTCTCCTACCACATGAGGG + Intergenic
1181462993 22:23096274-23096296 GGAGCTCACCTTCAAGATGGTGG + Exonic
1183700029 22:39445977-39445999 GCTGCTGACCTCCAAGCTGGAGG + Intergenic
1185358172 22:50387680-50387702 GCAGCTCAACTCCAACGTGGTGG - Intronic
952052775 3:29405705-29405727 ATTTCTCACCTAAAACATGGGGG + Intronic
952506037 3:34007568-34007590 TCTGCTCTCCTAAGACATGGTGG - Intergenic
952762046 3:36923594-36923616 ACTGCTCACCCACAACATTTTGG + Intronic
954380928 3:50218612-50218634 GCTGCACACCTACAGCAAGGTGG + Exonic
954464342 3:50645867-50645889 GCTCCTCACCAAGGACATGGGGG - Intronic
954618413 3:51982424-51982446 GCTGCTCACACATAACATGGGGG - Intronic
954707316 3:52488003-52488025 GCTGCTCACCTTCTACAAGGTGG + Exonic
954934706 3:54315660-54315682 GCTCTCCACCTGCAACATGGGGG + Intronic
955747528 3:62154825-62154847 GAAGTTCACCTACAACATGAGGG + Intronic
956898294 3:73686254-73686276 GCTTCTCATCTGCAAAATGGAGG + Intergenic
957080210 3:75630655-75630677 GCTGCACACCTGCAATGTGGTGG - Intergenic
958969196 3:100592500-100592522 TAGGCTCACCTCCAACATGGGGG - Intergenic
961498246 3:127309963-127309985 GCTGCTCATCTACAAAACAGAGG - Intergenic
961626013 3:128264297-128264319 GCTACTCTCCTGCAGCATGGAGG + Intronic
961984960 3:131122435-131122457 GCTTCTGACTTACAACATAGAGG + Intronic
963805227 3:149715203-149715225 CCTCTTCACCCACAACATGGTGG - Intronic
965363968 3:167775984-167776006 TTTTCTCACCTACAAAATGGGGG + Intronic
967323376 3:188215690-188215712 GCTGTTCTTCTATAACATGGAGG - Intronic
968665005 4:1816203-1816225 GCAGCCCACCTACAACACTGTGG + Intronic
968968996 4:3783822-3783844 GCTCCTCTCCTATAAAATGGGGG - Intergenic
969052222 4:4381060-4381082 GATGCTCACCTCCAAGATGCTGG - Exonic
969269749 4:6091509-6091531 GCACCTCACCTATAAAATGGGGG - Intronic
970104980 4:12571950-12571972 GCTGCTCACCTGCATCTTGGAGG + Intergenic
971199124 4:24495906-24495928 GAGGCTCACCTACATTATGGAGG + Intergenic
976321019 4:83715681-83715703 GATGCTCACCCACATTATGGGGG - Intergenic
978332614 4:107630814-107630836 GATACTCACCTACAAAATGGAGG + Intronic
984778691 4:183505261-183505283 GCTGCTCACCTGCTACGTGCAGG + Exonic
985450704 4:190060561-190060583 GCTGCACACCTGCAATGTGGTGG + Intergenic
994400229 5:99270437-99270459 GATGCTAAGCAACAACATGGAGG - Intergenic
995938413 5:117547590-117547612 GCTGATAACCTACAATTTGGTGG + Intergenic
998680167 5:144458220-144458242 TTTGCTCACCTGTAACATGGGGG - Intronic
999220032 5:149968068-149968090 ACTCTTCATCTACAACATGGAGG - Intronic
999433563 5:151544502-151544524 CCGGCTCATCTACAACATTGTGG - Exonic
1001284767 5:170414959-170414981 GCTGAGCACCTACTACATGCTGG - Intronic
1002012664 5:176296293-176296315 ACTGCTCACCTATGTCATGGAGG + Exonic
1002215173 5:177626441-177626463 ACTGCTCACCTATGTCATGGAGG - Intergenic
1002512697 5:179733118-179733140 GCTGCCCACCTGCCCCATGGCGG + Exonic
1002663718 5:180808020-180808042 TCTCTTCACCTACAAAATGGGGG - Intronic
1003820471 6:9890725-9890747 GCTGCTCTTCTATAAGATGGGGG + Intronic
1007109337 6:39304032-39304054 GCTGCTCTTCTCCCACATGGAGG - Exonic
1007705943 6:43791491-43791513 GGGCCTCACCTACAGCATGGGGG + Intergenic
1014743635 6:125174049-125174071 TTTGCTCATCTACAAAATGGTGG + Intronic
1019507394 7:1399185-1399207 ACTGCTGACCTATAACTTGGGGG - Intergenic
1019659435 7:2215779-2215801 GCTGCTCACCTACAACATGGAGG - Intronic
1026831711 7:73614356-73614378 GTTGCTCATCCATAACATGGCGG + Intronic
1028790573 7:94849331-94849353 GCTCCTCACTTCCAAGATGGTGG + Intergenic
1028790642 7:94849674-94849696 GCTCCTCACTTCCAAGATGGTGG + Intergenic
1029123226 7:98281825-98281847 GCCGCCCGCCTACAACCTGGAGG + Exonic
1029382253 7:100221753-100221775 GCTGTTGTCCTAGAACATGGTGG - Intronic
1029402414 7:100354202-100354224 GCTGCTGTCCTAGGACATGGTGG - Intronic
1031513590 7:122676680-122676702 GCTGCTCAGCCACATCCTGGAGG + Intronic
1031883871 7:127225377-127225399 TCAGCTCACCTTCAGCATGGTGG + Intronic
1032560667 7:132889595-132889617 GCTGCTGGCCTATAACTTGGTGG - Intronic
1033422801 7:141218174-141218196 GCTTCTCATCTACAGCATTGGGG + Intronic
1038829136 8:31037377-31037399 GCTGCTCACCTACTGCTTTGTGG + Intronic
1040930832 8:52733549-52733571 GCAGCTCCCCTTCCACATGGAGG + Intronic
1041992356 8:64008603-64008625 GCTGCTCACTTCCAAAGTGGAGG + Intergenic
1044345753 8:91102527-91102549 GCTTCCCCCCTTCAACATGGTGG + Intronic
1046177747 8:110600956-110600978 GGTGCTCATCTCCAACATTGGGG + Intergenic
1048338953 8:133524392-133524414 TCTGCTCACCTGCAAAATGCTGG - Intronic
1050044303 9:1527301-1527323 GGTGCTCCCCTTCAACATGATGG - Intergenic
1050481589 9:6093359-6093381 GCTGCACACCTACAACCATGTGG - Intergenic
1053098747 9:35351683-35351705 GCTGCTGACCCACAGCAAGGGGG - Intronic
1054449735 9:65397388-65397410 GCTGCACACCTGCGAGATGGAGG + Intergenic
1054751112 9:68907217-68907239 GGTGCTCACCTAAAAAATGGAGG - Intronic
1058647653 9:107145587-107145609 GCTGCTCAGCTTCAACATGCAGG + Intergenic
1058654857 9:107210942-107210964 GTTGTTCACCTACTACCTGGAGG + Intergenic
1059890108 9:118792354-118792376 TCTGCTCTCATACAACATGTAGG - Intergenic
1203434978 Un_GL000195v1:129916-129938 GCTGCACACCTGCAATATGGTGG - Intergenic
1188247685 X:27854691-27854713 GCTGCGCAAGTACAACATGAAGG + Intergenic
1189491433 X:41474158-41474180 GCTGCTCAACGACAACCTGCTGG + Exonic
1192656798 X:73002138-73002160 CCTGCTCACTTACCACATTGCGG + Intergenic
1192665322 X:73080863-73080885 CCTGCTCACTTACCACATTGCGG - Intergenic
1197820122 X:130533782-130533804 GCTGCTCACCTGCAACATTTTGG + Intergenic
1199788818 X:151130646-151130668 GCAGCTCATCTACAGCTTGGTGG + Intergenic